fastp report
General
fastp version:0.23.1 (https://github.com/OpenGene/fastp)
sequencing:paired end (150 cycles + 150 cycles)
mean length before filtering:150bp, 150bp
mean length after filtering:143bp, 143bp
duplication rate:25.882685%
Insert size peak:264
Before filtering
total reads:40.524798 M
total bases:6.078720 G
Q20 bases:5.969518 G (98.203545%)
Q30 bases:5.771636 G (94.948221%)
GC content:49.751898%
After filtering
total reads:40.300302 M
total bases:5.785915 G
Q20 bases:5.705549 G (98.611008%)
Q30 bases:5.523232 G (95.459964%)
GC content:49.647162%
Filtering result
reads passed filters:40.300302 M (99.446028%)
reads with low quality:175.510000 K (0.433093%)
reads with too many N:29.070000 K (0.071734%)
reads too short:19.916000 K (0.049145%)
Adapter or bad ligation of read1
SequenceOccurrences
A16326
AG16963
AGA17414
AGAT16471
AGATC15786
AGATCG16203
AGATCGG15645
AGATCGGA14573
AGATCGGAA14003
AGATCGGAAG14250
AGATCGGAAGA12907
AGATCGGAAGAG14058
AGATCGGAAGAGC14301
AGATCGGAAGAGCA14643
AGATCGGAAGAGCAC15156
AGATCGGAAGAGCACA15007
AGATCGGAAGAGCACAC13393
AGATCGGAAGAGCACACG12669
AGATCGGAAGAGCACACGT11852
AGATCGGAAGAGCACACGTC11583
AGATCGGAAGAGCACACGTCT12469
AGATCGGAAGAGCACACGTCTG12858
AGATCGGAAGAGCACACGTCTGA13036
AGATCGGAAGAGCACACGTCTGAA12727
AGATCGGAAGAGCACACGTCTGAAC12856
AGATCGGAAGAGCACACGTCTGAACT12434
AGATCGGAAGAGCACACGTCTGAACTC12222
AGATCGGAAGAGCACACGTCTGAACTCC11625
AGATCGGAAGAGCACACGTCTGAACTCCA10711
AGATCGGAAGAGCACACGTCTGAACTCCAG10190
AGATCGGAAGAGCACACGTCTGAACTCCAGT9966
AGATCGGAAGAGCACACGTCTGAACTCCAGTC10373
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA10438
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC11498
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACA13169
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAA12593
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAC11375
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACT10280
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTT9234
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTC9572
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTCCG10254
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTCCGT13463
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTCCGTC9789
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTCCGTCA25959
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTCCGTCAT9872
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTCCGTCATCTC15223
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTCCGTCATCTCGT12627
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTCCGTCATCTCGTATGC10905
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTCCGTCATCTCGTATGCC10573
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTCCGTCATCTCGTATGCCG11181
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTCCGTCATCTCGTATGCCGTC9714
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTCCGTCATCTCGTATGCCGTCTTCTGCTTGAAAA12413
other adapter sequences236791
Adapter or bad ligation of read2
SequenceOccurrences
A18684
AG16849
AGA16897
AGAT15856
AGATC15170
AGATCG18161
AGATCGG15843
AGATCGGA15529
AGATCGGAA13551
AGATCGGAAG13489
AGATCGGAAGA12886
AGATCGGAAGAG15972
AGATCGGAAGAGC14552
AGATCGGAAGAGCG14824
AGATCGGAAGAGCGT19571
AGATCGGAAGAGCGTC13244
AGATCGGAAGAGCGTCG18720
AGATCGGAAGAGCGTCGT13523
AGATCGGAAGAGCGTCGTG11311
AGATCGGAAGAGCGTCGTGTA9360
AGATCGGAAGAGCGTCGTGTAG13143
AGATCGGAAGAGCGTCGTGTAGG19073
AGATCGGAAGAGCGTCGTGTAGGG15695
AGATCGGAAGAGCGTCGTGTAGGGA12070
AGATCGGAAGAGCGTCGTGTAGGGAA9648
AGATCGGAAGAGCGTCGTGTAGGGAAAGAG10729
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGT10650
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG10160
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT11128
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTT10421
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTT11486
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTTC10685
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTTCG10211
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTTCGA11514
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTTCGACG9993
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTTCGACGTCTGTG10937
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTTCGACGTCTGTGT9455
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTTCGACGTCTGTGTAGATCTCGGT9662
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTTCGACGTCTGTGTAGATCTCGGTGGTCGC12739
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTTCGACGTCTGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAA15778
other adapter sequences382052
This estimation is based on paired-end overlap analysis, and there are 57.191679% reads found not overlapped.
The nonoverlapped read pairs may have insert size <30 or >270, or contain too much sequencing errors to be detected as overlapped.
Value of each position will be shown on mouse over.
Value of each position will be shown on mouse over.
Darker background means larger counts. The count will be shown on mouse over.
AAATACAGTATTTCTGCACTCCCGGAGTGCGG
AAAAAAAAAAAATAAAACAAAAGAAATAAAATTAAATCAAATGAAACAAAACTAAACCAAACGAAAGAAAAGTAAAGCAAAGG
AATAATAAAATATAATACAATAGAATTAAATTTAATTCAATTGAATCAAATCTAATCCAATCGAATGAAATGTAATGCAATGG
AACAACAAAACATAACACAACAGAACTAAACTTAACTCAACTGAACCAAACCTAACCCAACCGAACGAAACGTAACGCAACGG
AAGAAGAAAAGATAAGACAAGAGAAGTAAAGTTAAGTCAAGTGAAGCAAAGCTAAGCCAAGCGAAGGAAAGGTAAGGCAAGGG
ATAATAAAATAATATAACATAAGATATAATATTATATCATATGATACAATACTATACCATACGATAGAATAGTATAGCATAGG
ATTATTAAATTATATTACATTAGATTTAATTTTATTTCATTTGATTCAATTCTATTCCATTCGATTGAATTGTATTGCATTGG
ATCATCAAATCATATCACATCAGATCTAATCTTATCTCATCTGATCCAATCCTATCCCATCCGATCGAATCGTATCGCATCGG
ATGATGAAATGATATGACATGAGATGTAATGTTATGTCATGTGATGCAATGCTATGCCATGCGATGGAATGGTATGGCATGGG
ACAACAAAACAATACAACACAAGACATAACATTACATCACATGACACAACACTACACCACACGACAGAACAGTACAGCACAGG
ACTACTAAACTATACTACACTAGACTTAACTTTACTTCACTTGACTCAACTCTACTCCACTCGACTGAACTGTACTGCACTGG
ACCACCAAACCATACCACACCAGACCTAACCTTACCTCACCTGACCCAACCCTACCCCACCCGACCGAACCGTACCGCACCGG
ACGACGAAACGATACGACACGAGACGTAACGTTACGTCACGTGACGCAACGCTACGCCACGCGACGGAACGGTACGGCACGGG
AGAAGAAAAGAATAGAACAGAAGAGATAAGATTAGATCAGATGAGACAAGACTAGACCAGACGAGAGAAGAGTAGAGCAGAGG
AGTAGTAAAGTATAGTACAGTAGAGTTAAGTTTAGTTCAGTTGAGTCAAGTCTAGTCCAGTCGAGTGAAGTGTAGTGCAGTGG
AGCAGCAAAGCATAGCACAGCAGAGCTAAGCTTAGCTCAGCTGAGCCAAGCCTAGCCCAGCCGAGCGAAGCGTAGCGCAGCGG
AGGAGGAAAGGATAGGACAGGAGAGGTAAGGTTAGGTCAGGTGAGGCAAGGCTAGGCCAGGCGAGGGAAGGGTAGGGCAGGGG
TAATAAAATAAATTAAACTAAAGTAATATAATTTAATCTAATGTAACATAACTTAACCTAACGTAAGATAAGTTAAGCTAAGG
TATTATAATATATTATACTATAGTATTATATTTTATTCTATTGTATCATATCTTATCCTATCGTATGATATGTTATGCTATGG
TACTACAATACATTACACTACAGTACTATACTTTACTCTACTGTACCATACCTTACCCTACCGTACGATACGTTACGCTACGG
TAGTAGAATAGATTAGACTAGAGTAGTATAGTTTAGTCTAGTGTAGCATAGCTTAGCCTAGCGTAGGATAGGTTAGGCTAGGG
TTATTAAATTAATTTAACTTAAGTTATATTATTTTATCTTATGTTACATTACTTTACCTTACGTTAGATTAGTTTAGCTTAGG
TTTTTTAATTTATTTTACTTTAGTTTTATTTTTTTTTCTTTTGTTTCATTTCTTTTCCTTTCGTTTGATTTGTTTTGCTTTGG
TTCTTCAATTCATTTCACTTCAGTTCTATTCTTTTCTCTTCTGTTCCATTCCTTTCCCTTCCGTTCGATTCGTTTCGCTTCGG
TTGTTGAATTGATTTGACTTGAGTTGTATTGTTTTGTCTTGTGTTGCATTGCTTTGCCTTGCGTTGGATTGGTTTGGCTTGGG
TCATCAAATCAATTCAACTCAAGTCATATCATTTCATCTCATGTCACATCACTTCACCTCACGTCAGATCAGTTCAGCTCAGG
TCTTCTAATCTATTCTACTCTAGTCTTATCTTTTCTTCTCTTGTCTCATCTCTTCTCCTCTCGTCTGATCTGTTCTGCTCTGG
TCCTCCAATCCATTCCACTCCAGTCCTATCCTTTCCTCTCCTGTCCCATCCCTTCCCCTCCCGTCCGATCCGTTCCGCTCCGG
TCGTCGAATCGATTCGACTCGAGTCGTATCGTTTCGTCTCGTGTCGCATCGCTTCGCCTCGCGTCGGATCGGTTCGGCTCGGG
TGATGAAATGAATTGAACTGAAGTGATATGATTTGATCTGATGTGACATGACTTGACCTGACGTGAGATGAGTTGAGCTGAGG
TGTTGTAATGTATTGTACTGTAGTGTTATGTTTTGTTCTGTTGTGTCATGTCTTGTCCTGTCGTGTGATGTGTTGTGCTGTGG
TGCTGCAATGCATTGCACTGCAGTGCTATGCTTTGCTCTGCTGTGCCATGCCTTGCCCTGCCGTGCGATGCGTTGCGCTGCGG
TGGTGGAATGGATTGGACTGGAGTGGTATGGTTTGGTCTGGTGTGGCATGGCTTGGCCTGGCGTGGGATGGGTTGGGCTGGGG
CAACAAAACAAATCAAACCAAAGCAATACAATTCAATCCAATGCAACACAACTCAACCCAACGCAAGACAAGTCAAGCCAAGG
CATCATAACATATCATACCATAGCATTACATTTCATTCCATTGCATCACATCTCATCCCATCGCATGACATGTCATGCCATGG
CACCACAACACATCACACCACAGCACTACACTTCACTCCACTGCACCACACCTCACCCCACCGCACGACACGTCACGCCACGG
CAGCAGAACAGATCAGACCAGAGCAGTACAGTTCAGTCCAGTGCAGCACAGCTCAGCCCAGCGCAGGACAGGTCAGGCCAGGG
CTACTAAACTAATCTAACCTAAGCTATACTATTCTATCCTATGCTACACTACTCTACCCTACGCTAGACTAGTCTAGCCTAGG
CTTCTTAACTTATCTTACCTTAGCTTTACTTTTCTTTCCTTTGCTTCACTTCTCTTCCCTTCGCTTGACTTGTCTTGCCTTGG
CTCCTCAACTCATCTCACCTCAGCTCTACTCTTCTCTCCTCTGCTCCACTCCTCTCCCCTCCGCTCGACTCGTCTCGCCTCGG
CTGCTGAACTGATCTGACCTGAGCTGTACTGTTCTGTCCTGTGCTGCACTGCTCTGCCCTGCGCTGGACTGGTCTGGCCTGGG
CCACCAAACCAATCCAACCCAAGCCATACCATTCCATCCCATGCCACACCACTCCACCCCACGCCAGACCAGTCCAGCCCAGG
CCTCCTAACCTATCCTACCCTAGCCTTACCTTTCCTTCCCTTGCCTCACCTCTCCTCCCCTCGCCTGACCTGTCCTGCCCTGG
CCCCCCAACCCATCCCACCCCAGCCCTACCCTTCCCTCCCCTGCCCCACCCCTCCCCCCCCCGCCCGACCCGTCCCGCCCCGG
CCGCCGAACCGATCCGACCCGAGCCGTACCGTTCCGTCCCGTGCCGCACCGCTCCGCCCCGCGCCGGACCGGTCCGGCCCGGG
CGACGAAACGAATCGAACCGAAGCGATACGATTCGATCCGATGCGACACGACTCGACCCGACGCGAGACGAGTCGAGCCGAGG
CGTCGTAACGTATCGTACCGTAGCGTTACGTTTCGTTCCGTTGCGTCACGTCTCGTCCCGTCGCGTGACGTGTCGTGCCGTGG
CGCCGCAACGCATCGCACCGCAGCGCTACGCTTCGCTCCGCTGCGCCACGCCTCGCCCCGCCGCGCGACGCGTCGCGCCGCGG
CGGCGGAACGGATCGGACCGGAGCGGTACGGTTCGGTCCGGTGCGGCACGGCTCGGCCCGGCGCGGGACGGGTCGGGCCGGGG
GAAGAAAAGAAATGAAACGAAAGGAATAGAATTGAATCGAATGGAACAGAACTGAACCGAACGGAAGAGAAGTGAAGCGAAGG
GATGATAAGATATGATACGATAGGATTAGATTTGATTCGATTGGATCAGATCTGATCCGATCGGATGAGATGTGATGCGATGG
GACGACAAGACATGACACGACAGGACTAGACTTGACTCGACTGGACCAGACCTGACCCGACCGGACGAGACGTGACGCGACGG
GAGGAGAAGAGATGAGACGAGAGGAGTAGAGTTGAGTCGAGTGGAGCAGAGCTGAGCCGAGCGGAGGAGAGGTGAGGCGAGGG
GTAGTAAAGTAATGTAACGTAAGGTATAGTATTGTATCGTATGGTACAGTACTGTACCGTACGGTAGAGTAGTGTAGCGTAGG
GTTGTTAAGTTATGTTACGTTAGGTTTAGTTTTGTTTCGTTTGGTTCAGTTCTGTTCCGTTCGGTTGAGTTGTGTTGCGTTGG
GTCGTCAAGTCATGTCACGTCAGGTCTAGTCTTGTCTCGTCTGGTCCAGTCCTGTCCCGTCCGGTCGAGTCGTGTCGCGTCGG
GTGGTGAAGTGATGTGACGTGAGGTGTAGTGTTGTGTCGTGTGGTGCAGTGCTGTGCCGTGCGGTGGAGTGGTGTGGCGTGGG
GCAGCAAAGCAATGCAACGCAAGGCATAGCATTGCATCGCATGGCACAGCACTGCACCGCACGGCAGAGCAGTGCAGCGCAGG
GCTGCTAAGCTATGCTACGCTAGGCTTAGCTTTGCTTCGCTTGGCTCAGCTCTGCTCCGCTCGGCTGAGCTGTGCTGCGCTGG
GCCGCCAAGCCATGCCACGCCAGGCCTAGCCTTGCCTCGCCTGGCCCAGCCCTGCCCCGCCCGGCCGAGCCGTGCCGCGCCGG
GCGGCGAAGCGATGCGACGCGAGGCGTAGCGTTGCGTCGCGTGGCGCAGCGCTGCGCCGCGCGGCGGAGCGGTGCGGCGCGGG
GGAGGAAAGGAATGGAACGGAAGGGATAGGATTGGATCGGATGGGACAGGACTGGACCGGACGGGAGAGGAGTGGAGCGGAGG
GGTGGTAAGGTATGGTACGGTAGGGTTAGGTTTGGTTCGGTTGGGTCAGGTCTGGTCCGGTCGGGTGAGGTGTGGTGCGGTGG
GGCGGCAAGGCATGGCACGGCAGGGCTAGGCTTGGCTCGGCTGGGCCAGGCCTGGCCCGGCCGGGCGAGGCGTGGCGCGGCGG
GGGGGGAAGGGATGGGACGGGAGGGGTAGGGTTGGGTCGGGTGGGGCAGGGCTGGGCCGGGCGGGGGAGGGGTGGGGCGGGGG
Sampling rate: 1 / 20
overrepresented sequencecount (% of bases)distribution: cycle 1 ~ cycle 150
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA136 (0.003580%)
AAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCA49 (0.003224%)
AAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATG69 (0.004540%)
AAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACA14 (0.000921%)
AAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTC55 (0.003619%)
AAAACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTG6 (0.000395%)
AAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAA32 (0.002106%)
AAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCC11 (0.000724%)
AAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAA20 (0.001316%)
AAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATT10 (0.000658%)
AAAAGACTTCCAACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGG8 (0.000526%)
AAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAG21 (0.001382%)
AAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCAT48 (0.003159%)
AAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGA35 (0.002303%)
AAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTAC22 (0.001448%)
AAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGG30 (0.001974%)
AAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGG5 (0.000329%)
AAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACAT17 (0.001119%)
AAAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTT45 (0.002961%)
AAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGA16 (0.001053%)
AAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTAT21 (0.001382%)
AAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAA41 (0.002698%)
AAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTG5 (0.000329%)
AAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGAC8 (0.000526%)
AAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTC29 (0.001908%)
AAAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCC4 (0.000263%)
AAAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAA7 (0.000461%)
AAAATGACTCCCTCCATCTCATGGAGTCTGCTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCT14 (0.000921%)
AAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTG27 (0.001777%)
AAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGAT6 (0.000395%)
AAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCATGGGCTAGATTTCCGGCTAGA5 (0.000329%)
AAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCA18 (0.001184%)
AAACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGC10 (0.000658%)
AAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGC27 (0.001777%)
AAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATT13 (0.000855%)
AAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAAC11 (0.000724%)
AAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGG15 (0.000987%)
AAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCT24 (0.001579%)
AAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGT3 (0.000197%)
AAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGC6 (0.000395%)
AAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTGAGAAAAAAAGACATGAAGACTCAGGACT6 (0.000395%)
AAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAAC6 (0.000395%)
AAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTT9 (0.000592%)
AAACTCCATGAAGCTTCATAGGAGCAACAATACTAATAATCGCACATGGCCTCACATCATCACTCCTATTCTGCCTAGCAAACTCCAACTACGAACGGAT5 (0.000329%)
AAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTG23 (0.001513%)
AAACTGTTCTGTGAGGCAGCTGACTGAGCACGCGGTGGAGGGAGACTGTGACTTCCACATCCTGAAACAAGACGGCCAGTTCAGGGTGATGCACACCCAG6 (0.000395%)
AAACTTCTCCACCAGCTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAAC42 (0.004090%)
AAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGT227 (0.014937%)
AAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACG17 (0.001119%)
AAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTG34 (0.002237%)
AAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATT31 (0.002040%)
AAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACAT10 (0.000658%)
AAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATG13 (0.000855%)
AAAGACTTCCAACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGGC3 (0.000197%)
AAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGA4 (0.000263%)
AAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGT9 (0.000592%)
AAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATC15 (0.000987%)
AAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGG34 (0.002237%)
AAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGC28 (0.001842%)
AAAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACT1468 (0.038640%)
AAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGC50 (0.003290%)
AAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCC116 (0.007633%)
AAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACT13 (0.000855%)
AAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACC6 (0.000395%)
AAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGA7 (0.000461%)
AAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGC7 (0.000461%)
AAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACA40 (0.002632%)
AAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTT116 (0.007633%)
AAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTTT7 (0.000461%)
AAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGT37 (0.002435%)
AAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACT23 (0.001513%)
AAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTC4 (0.000263%)
AAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAA8 (0.000526%)
AAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAAT4 (0.000263%)
AAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTG15 (0.000987%)
AAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATT4 (0.000263%)
AAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGT4 (0.000263%)
AAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAAC6 (0.000395%)
AAATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTG5 (0.000329%)
AAATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTG9 (0.000592%)
AAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTT17 (0.001119%)
AAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGA19 (0.001250%)
AAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAA13 (0.000855%)
AAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAA15 (0.000987%)
AAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTT40 (0.002632%)
AAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACT3 (0.000197%)
AAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTA9 (0.000592%)
AAATATGTCACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGAT10 (0.000658%)
AAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTA20 (0.001316%)
AAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCT20 (0.001316%)
AAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCA8 (0.000526%)
AAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCG35 (0.002303%)
AAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGATCCAATAATTACATGGAGTCCATGGAAT5 (0.000329%)
AAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAA12 (0.000790%)
AAATGACTCCCTCCATCTCATGGAGTCTGCTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTC11 (0.000724%)
AAATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGG36 (0.002369%)
AAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTT20 (0.001316%)
AAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGATC4 (0.000263%)
AAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGA42 (0.002764%)
AAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCATGGGCTAGATTTCCGGCTAGAG6 (0.000395%)
AAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGT13 (0.000855%)
AAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCA10 (0.000658%)
AAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGATTAGGTGT4 (0.000263%)
AAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAG18 (0.001184%)
AAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCAC172 (0.011318%)
AAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGC5 (0.000329%)
AAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGT4 (0.000263%)
AAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAA6 (0.000395%)
AACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAA12 (0.000790%)
AACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTT4 (0.000263%)
AACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCA9 (0.000592%)
AACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACA4 (0.000263%)
AACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGG3 (0.000197%)
AACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCC4 (0.000263%)
AACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGG15 (0.000987%)
AACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATT20 (0.001316%)
AACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAA17 (0.001119%)
AACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAA7 (0.000461%)
AACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGG11 (0.000724%)
AACAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCT11 (0.000724%)
AACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCA5 (0.000329%)
AACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCT17 (0.001119%)
AACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGT8 (0.000526%)
AACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGA6 (0.000395%)
AACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTGTG3 (0.000197%)
AACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATA8 (0.000526%)
AACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGC18 (0.001184%)
AACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACT12 (0.000790%)
AACCAATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCAT8 (0.000526%)
AACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATT21 (0.001382%)
AACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGA7 (0.000461%)
AACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTG18 (0.001184%)
AACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATG15 (0.000987%)
AACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTTG6 (0.000395%)
AACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCA6 (0.000395%)
AACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTC9 (0.000592%)
AACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTC5 (0.000329%)
AACCTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGAT40 (0.002632%)
AACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCG6 (0.000395%)
AACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGG9 (0.000592%)
AACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAAT3 (0.000197%)
AACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTA3 (0.000197%)
AACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGT3 (0.000197%)
AACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATC6 (0.000395%)
AACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAAC4 (0.000263%)
AACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCG3 (0.000197%)
AACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGG3 (0.000197%)
AACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTT3 (0.000197%)
AACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAA3 (0.000197%)
AACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGA8 (0.000526%)
AACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGT6 (0.000395%)
AAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTG43 (0.002830%)
AAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGA9 (0.000592%)
AAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGG10 (0.000658%)
AAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGC16 (0.001053%)
AAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAG4 (0.000263%)
AAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGT39 (0.002566%)
AAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCA23 (0.001513%)
AAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTG27 (0.001777%)
AAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGG32 (0.002106%)
AAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCA51 (0.003356%)
AAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGG133 (0.008752%)
AAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTT12 (0.000790%)
AAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATG9 (0.000592%)
AAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGC5 (0.000329%)
AAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGC84 (0.005527%)
AAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGA9 (0.000592%)
AAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCC33 (0.002172%)
AAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGC64 (0.004211%)
AAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCA32 (0.002106%)
AAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCC11 (0.000724%)
AAGACGGTCCAGGATGCGCTAAGTAGCGTGCAGGAGTCCGATATAGCTGTGGTGGCCAGGGGCTGGATGGACAATCACTTCAGATCCCTGAAAGGCTACT3 (0.000197%)
AAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGA10 (0.000658%)
AAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACC5 (0.000329%)
AAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTA12 (0.000790%)
AAGACTTCCAACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGGCT13 (0.000855%)
AAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGAT4 (0.000263%)
AAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTTGTGGAAAGTGCAGGCTTCCAGGA3 (0.000197%)
AAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCT5 (0.000329%)
AAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTT14 (0.000921%)
AAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATA13 (0.000855%)
AAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGC6 (0.000395%)
AAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAAC8 (0.000526%)
AAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACG7 (0.000461%)
AAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGAC3 (0.000197%)
AAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCG11 (0.000724%)
AAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGT14 (0.000921%)
AAGATAAGTAGGTTGGCTACTAGGATTCAGTACAAAATTTGTGTGATTGGGCGGAATATTAGGCTTCGTTGCTTTGAGGTATGAAGGAAAGGTATTAGGG9 (0.000592%)
AAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGT3 (0.000197%)
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTT2483 (0.065356%)
AAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCC5 (0.000329%)
AAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCT5 (0.000329%)
AAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCC56 (0.003685%)
AAGCACGATGTCAAGGGATGAGTTGGATAAAACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGAT3 (0.000197%)
AAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGT6 (0.000395%)
AAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGT8 (0.000526%)
AAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCA10 (0.000658%)
AAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGA3 (0.000197%)
AAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTT20 (0.001316%)
AAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCT6 (0.000395%)
AAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCC5 (0.000329%)
AAGCCCTACTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGG3 (0.000197%)
AAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGA6 (0.000395%)
AAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCA3 (0.000197%)
AAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAA9 (0.000592%)
AAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAG3 (0.000197%)
AAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGA3 (0.000197%)
AAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGT3 (0.000197%)
AAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCT12 (0.000790%)
AAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTC1021 (0.067185%)
AAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGG5 (0.000329%)
AAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCA30 (0.001974%)
AAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAA10 (0.000658%)
AAGGCACAGCAGCGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACC8 (0.000526%)
AAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAG4 (0.000263%)
AAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGC29 (0.001908%)
AAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTTTG6 (0.000395%)
AAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTG21 (0.001382%)
AAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTT44 (0.002895%)
AAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGT26 (0.001711%)
AAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTG12 (0.000790%)
AAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAAC3 (0.000197%)
AAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTC5 (0.000329%)
AAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGAT6 (0.000395%)
AAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCAT11 (0.000724%)
AAGGGCTATTAGTGTTAGTTCTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAATAATTATGTATATTGAG6 (0.000395%)
AAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGG8 (0.000526%)
AAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATG3 (0.000197%)
AAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGC35 (0.002303%)
AAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCG4 (0.000263%)
AAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGC14 (0.000921%)
AAGTAGGTTGGCTACTAGGATTCAGTACAAAATTTGTGTGATTGGGCGGAATATTAGGCTTCGTTGCTTTGAGGTATGAAGGAAAGGTATTAGGGCTAAA3 (0.000197%)
AAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAG3 (0.000197%)
AAGTCTCAGCAACAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTG3 (0.000197%)
AAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCA4 (0.000263%)
AAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATA9 (0.000592%)
AAGTGAGCTTTTTAGTTTGTGTCGGAAGCCTGTAATTACGGCTCCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGTA4 (0.000263%)
AAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATG94 (0.009155%)
AAGTGGGTAACCTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGT21 (0.001382%)
AAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCT6 (0.000395%)
AAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAG10 (0.000658%)
AAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAG6 (0.000395%)
AAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGCTT10 (0.000658%)
AAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACA9 (0.000592%)
AATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGG3 (0.000197%)
AATAAATATGATTAGGGAAACAATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTTTGATAATAAGTTTAACTAGTCAGTGT11 (0.000724%)
AATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGA10 (0.000658%)
AATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACA3 (0.000197%)
AATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTC11 (0.000724%)
AATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATA3 (0.000197%)
AATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATG24 (0.001579%)
AATACGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTA462 (0.030401%)
AATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACA5 (0.000329%)
AATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCATGGGCTAGA6 (0.000395%)
AATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAA10 (0.000658%)
AATATGATTAGGGAAACAATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTTTGATAATAAGTTTAACTAGTCAGTGTTGGA4 (0.000263%)
AATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGT6 (0.000395%)
AATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCC6 (0.000395%)
AATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTC16 (0.001053%)
AATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTAC7 (0.000461%)
AATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTC3 (0.000197%)
AATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTG5 (0.000329%)
AATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATC22 (0.001448%)
AATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGT8 (0.000526%)
AATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCAC3 (0.000197%)
AATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGT13 (0.000855%)
AATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGA32 (0.002106%)
AATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGC7 (0.000461%)
AATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTC11 (0.000724%)
AATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTT5 (0.000329%)
AATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATA12 (0.000790%)
AATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTA5 (0.000329%)
AATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTT3 (0.000197%)
AATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAG4 (0.000263%)
AATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAA13 (0.000855%)
AATGACTCCCTCCATCTCATGGAGTCTGCTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCC5 (0.000329%)
AATGACTCCCTCCATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCC490 (0.032244%)
AATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGG13 (0.000855%)
AATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGG4 (0.000263%)
AATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAA3 (0.000197%)
AATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTC3 (0.000197%)
AATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCAT11 (0.000724%)
AATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCC5 (0.000329%)
AATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTT7 (0.000461%)
AATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTT4 (0.000263%)
AATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAG12 (0.000790%)
AATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCT41 (0.002698%)
AATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTT29 (0.001908%)
AATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGC8 (0.000526%)
AATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGA3 (0.000197%)
AATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGT3 (0.000197%)
AATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTC9 (0.000592%)
AATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGTCAGAAAT5 (0.000329%)
AATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGG11 (0.000724%)
AATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGA45 (0.002961%)
AATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGT15 (0.000987%)
AATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCT3 (0.000197%)
AATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACA6 (0.000395%)
AATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCA3 (0.000197%)
AATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCCCAAATCATTATACCGAT3 (0.000197%)
AATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGG12 (0.000790%)
AATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTT54 (0.003553%)
AATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAA17 (0.001119%)
AATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTA11 (0.000724%)
AATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTAT9 (0.000592%)
ACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGA3 (0.000197%)
ACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAG3 (0.000197%)
ACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAG11 (0.000724%)
ACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTG5 (0.000329%)
ACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCA3 (0.000197%)
ACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGT11 (0.000724%)
ACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCA8 (0.000526%)
ACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTT3 (0.000197%)
ACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGG4 (0.000263%)
ACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAG18 (0.001184%)
ACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATA50 (0.003290%)
ACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTT18 (0.001184%)
ACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCT3 (0.000197%)
ACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGT14 (0.000921%)
ACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTT9 (0.000592%)
ACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGT3 (0.000197%)
ACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACAC5 (0.000329%)
ACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACT4 (0.000263%)
ACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAG19 (0.001250%)
ACACACACACACACACACACACACACACACACACACACAC207 (0.005449%)
ACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACA3 (0.000197%)
ACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTG19 (0.001250%)
ACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCAC3 (0.000197%)
ACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCA4 (0.000263%)
ACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTG9 (0.000592%)
ACACGTCTGAACTCCAGTCACAACTTCCGTCATCTCGTAT10 (0.000263%)
ACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGC3 (0.000197%)
ACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGT6 (0.000395%)
ACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCA6 (0.000395%)
ACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGC7 (0.000461%)
ACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAG4 (0.000263%)
ACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTT3 (0.000197%)
ACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTT3 (0.000197%)
ACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCG12 (0.000790%)
ACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTC11 (0.000724%)
ACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCA6 (0.000395%)
ACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGC3 (0.000197%)
ACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGG4 (0.000263%)
ACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATA18 (0.001184%)
ACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTG3 (0.000197%)
ACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAA9 (0.000592%)
ACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAA5 (0.000329%)
ACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATAC3 (0.000197%)
ACATCCCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATAT461 (0.030335%)
ACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAA3 (0.000197%)
ACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGA4 (0.000263%)
ACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAG5 (0.000329%)
ACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCA7 (0.000461%)
ACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGT16 (0.001053%)
ACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTC3 (0.000197%)
ACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCC17 (0.001119%)
ACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGG4 (0.000263%)
ACCAATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATT10 (0.000658%)
ACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTC11 (0.000724%)
ACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCT4 (0.000263%)
ACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCA14 (0.000921%)
ACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGG11 (0.000724%)
ACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACAC4 (0.000263%)
ACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATG4 (0.000263%)
ACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGT8 (0.000526%)
ACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACT3 (0.000197%)
ACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACAT4 (0.000263%)
ACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGA11 (0.000724%)
ACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGA5 (0.000329%)
ACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCA3 (0.000197%)
ACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGG4 (0.000263%)
ACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAA9 (0.000592%)
ACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGA11 (0.000724%)
ACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGA5 (0.000329%)
ACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAG5 (0.000329%)
ACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCT24 (0.001579%)
ACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGAT3 (0.000197%)
ACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGC11 (0.000724%)
ACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGG11 (0.000724%)
ACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATG4 (0.000263%)
ACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTGAGAAA5 (0.000329%)
ACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCA12 (0.000790%)
ACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTC11 (0.000724%)
ACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGA11 (0.000724%)
ACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGA5 (0.000329%)
ACGATGTCAAGGGATGAGTTGGATAAAACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATT14 (0.000921%)
ACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATG10 (0.000658%)
ACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCC4 (0.000263%)
ACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAG7 (0.000461%)
ACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATT30 (0.001974%)
ACGGCACTGATGGAGGACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGG178 (0.011713%)
ACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTA3 (0.000197%)
ACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCA6 (0.000395%)
ACGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATA4 (0.000263%)
ACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCG4 (0.000263%)
ACGTTGGTATCGTTGAACGGAGTCAGGAGTGGGCACCGTGGGCACAACTTACGAACGTCCTCTGCAGAGTCTGGGGTGGAATGACACTGGGTGTGCATCA3 (0.000197%)
ACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCC3 (0.000197%)
ACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAA3 (0.000197%)
ACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCCCAAATCATTATACC3 (0.000197%)
ACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCT7 (0.000461%)
ACTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAA17 (0.001119%)
ACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATT4 (0.000263%)
ACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAAC24 (0.001579%)
ACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGC27 (0.001777%)
ACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAG5 (0.000329%)
ACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGC3 (0.000197%)
ACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAA10 (0.000658%)
ACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTC5 (0.000329%)
ACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAA10 (0.000658%)
ACTCCATGAAGCTTCATAGGAGCAACAATACTAATAATCGCACATGGCCTCACATCATCACTCCTATTCTGCCTAGCAAACTCCAACTACGAACGGATCC5 (0.000329%)
ACTCCCTCCATCTCATGGAGTCTGCTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGA3 (0.000197%)
ACTCCCTCCATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGA6 (0.000395%)
ACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTT3 (0.000197%)
ACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCT15 (0.000987%)
ACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATT4 (0.000263%)
ACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTC6 (0.000395%)
ACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTGAGAAAAAAAGACATGAA93 (0.006120%)
ACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAG3 (0.000197%)
ACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCAT11 (0.000724%)
ACTGCCTTGACTTTTTCCCCAGTCATGGTCTCCAGTTCGCACTCCTCCCCCAGGGTGAACTCATTGCGGACCACTTTGGGTCCATAGGTGATGGTGAGTT4 (0.000263%)
ACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGT16 (0.001053%)
ACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCC5 (0.000329%)
ACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTCCTCACAT3 (0.000197%)
ACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCAT3 (0.000197%)
ACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGA6 (0.000395%)
ACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGA3 (0.000197%)
ACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTC5 (0.000329%)
ACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGT14 (0.000921%)
ACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCAT13 (0.000855%)
ACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCCCAAAT3 (0.000197%)
ACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTG9 (0.000592%)
ACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGC4 (0.000263%)
ACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAG7 (0.000461%)
ACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTA7 (0.000461%)
ACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTG5 (0.000329%)
ACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTC4 (0.000263%)
ACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATC6 (0.000395%)
ACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTC11 (0.000724%)
ACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTG10 (0.000658%)
ACTTTCCATCCCTTGAACCAAGGCATATTAGCACTTGGCTCCAGCATGTTGTCACCATTCCAACCAGAAATTGGCACAAATGCTACTGTGTCAGGGTTGT3 (0.000197%)
ACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGGT6 (0.000395%)
ACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTT10 (0.000658%)
ACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACT6 (0.000395%)
ACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCT4 (0.000263%)
AGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAA8 (0.000526%)
AGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGG18 (0.001184%)
AGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACT11 (0.000724%)
AGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAA41 (0.002698%)
AGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGA17 (0.001119%)
AGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCT4 (0.000263%)
AGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCC5 (0.000329%)
AGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAG9 (0.000592%)
AGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATC4 (0.000263%)
AGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTG74 (0.004869%)
AGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAA11 (0.000724%)
AGAACATGTGTTGGGGCCAAGAGACTTGTCCAAACACAGGGCCCCATCAACTTTCTCATGGGGCCAGGAAACCTCTGTCCATGTTGCCTGGGCTCCTGAC10 (0.000658%)
AGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCAT11 (0.000724%)
AGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTG22 (0.001448%)
AGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGT4 (0.000263%)
AGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCAT74 (0.004869%)
AGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCT52 (0.003422%)
AGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGT28 (0.001842%)
AGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATG15 (0.000987%)
AGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAA17 (0.001119%)
AGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTA22 (0.001448%)
AGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCC6 (0.000395%)
AGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTT4 (0.000263%)
AGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGACAAGTCCACCACGGTGAAGGTGCCCATGATGATGCTCTCGGGCATGCTTGA6 (0.000395%)
AGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCG259 (0.017043%)
AGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTT4 (0.000263%)
AGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCT8 (0.000526%)
AGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGT21 (0.001382%)
AGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTA13 (0.000855%)
AGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGG5 (0.000329%)
AGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGA7 (0.000461%)
AGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGG5 (0.000329%)
AGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAG21 (0.001382%)
AGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAG14 (0.000921%)
AGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGATTAGGTGTATTAATA6 (0.000395%)
AGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTC19 (0.001250%)
AGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGT26 (0.001711%)
AGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCT19 (0.001250%)
AGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAG4 (0.000263%)
AGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTT8 (0.000526%)
AGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACT3 (0.000197%)
AGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCC14 (0.000921%)
AGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTAC13 (0.000855%)
AGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGA6 (0.000395%)
AGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCC17 (0.001119%)
AGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCAC10 (0.000658%)
AGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGC54 (0.003553%)
AGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCT3 (0.000197%)
AGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCC6 (0.000395%)
AGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAA9 (0.000592%)
AGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCT30 (0.001974%)
AGACGGTCCAGGATGCGCTAAGTAGCGTGCAGGAGTCCGATATAGCTGTGGTGGCCAGGGGCTGGATGGACAATCACTTCAGATCCCTGAAAGGCTACTG11 (0.000724%)
AGACGTGGCTGTAAAAGTGTTCAAAAAGACCTCTGAGGGATCCTGGGAGCCCTTTGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACC6 (0.000395%)
AGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCAC8 (0.000526%)
AGACTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAAT382 (0.025137%)
AGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAA32 (0.002106%)
AGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCA3 (0.000197%)
AGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTA33 (0.002172%)
AGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCT5 (0.000329%)
AGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAG17 (0.001119%)
AGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTG3 (0.000197%)
AGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTT13 (0.000855%)
AGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTG7 (0.000461%)
AGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGAC4 (0.000263%)
AGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGC81 (0.005330%)
AGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTC630 (0.041456%)
AGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTG36 (0.002369%)
AGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGAT6 (0.000395%)
AGAGCACACGTCTGAACTCCAGTCACAACTTCCGTCATCT9 (0.000237%)
AGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAGCAGCT5 (0.000329%)
AGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCA4 (0.000263%)
AGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATA13 (0.000855%)
AGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGACTCTCTGCGCAC3 (0.000197%)
AGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACA4 (0.000263%)
AGAGGACGTTCGTAAGTTGTGCCCACGGTGCCCACTCCTGACTCCGTTCAACGATACCAACGTGGTCCACACCGTCAACACTGCCCTGGCTGCCTTCAAC4 (0.000263%)
AGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCC4 (0.000263%)
AGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCC4 (0.000263%)
AGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCC12 (0.000790%)
AGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGG3 (0.000197%)
AGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGG608 (0.040008%)
AGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGG3 (0.000197%)
AGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACA11 (0.000724%)
AGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCA7 (0.000461%)
AGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATG8 (0.000526%)
AGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGT11 (0.000724%)
AGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTG20 (0.001316%)
AGATAAGTAGGTTGGCTACTAGGATTCAGTACAAAATTTGTGTGATTGGGCGGAATATTAGGCTTCGTTGCTTTGAGGTATGAAGGAAAGGTATTAGGGC13 (0.000855%)
AGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAA7 (0.000461%)
AGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAA4 (0.000263%)
AGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGT11 (0.000724%)
AGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGG35 (0.002303%)
AGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAG13 (0.000855%)
AGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGC3 (0.000197%)
AGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAG19 (0.001250%)
AGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCG29 (0.001908%)
AGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAAACCCTCAACAGACCAGACAG9 (0.000592%)
AGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCA10 (0.000658%)
AGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGC11 (0.000724%)
AGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCT5 (0.000329%)
AGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAA5 (0.000329%)
AGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGA6 (0.000395%)
AGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCC20 (0.001316%)
AGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTAC9 (0.000592%)
AGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAA12 (0.000790%)
AGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCT5 (0.000329%)
AGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCA3 (0.000197%)
AGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTG16 (0.001053%)
AGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGA17 (0.001119%)
AGCAACAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTT4 (0.000263%)
AGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCT21 (0.001382%)
AGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTG8 (0.000526%)
AGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTG10 (0.000658%)
AGCACACGTCTGAACTCCAGTCACAACTTCCGTCATCTCG10 (0.000263%)
AGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCT19 (0.001250%)
AGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGC8 (0.000526%)
AGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTG5 (0.000329%)
AGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTA18 (0.001184%)
AGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTT14 (0.000921%)
AGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGT3 (0.000197%)
AGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCA11 (0.000724%)
AGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGAC4 (0.000263%)
AGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATA3 (0.000197%)
AGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGG23 (0.001513%)
AGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGAC18 (0.001184%)
AGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTG20 (0.001316%)
AGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGA3 (0.000197%)
AGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGG3 (0.000197%)
AGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCT6 (0.000395%)
AGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGG5 (0.000329%)
AGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTG14 (0.000921%)
AGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACA3 (0.000197%)
AGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAG24 (0.001579%)
AGCCAATGCCAACGCAGTAGGTCCCGTACCCACAGCGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGA5 (0.000329%)
AGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGA8 (0.000526%)
AGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTG10 (0.000658%)
AGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCG44 (0.002895%)
AGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTAT6 (0.000395%)
AGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCA4 (0.000263%)
AGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATC4 (0.000263%)
AGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTTGTGGAAAGTGCAGGCTTCCAGGAGTCGTG4 (0.000263%)
AGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCC5 (0.000329%)
AGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGT4 (0.000263%)
AGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTC3 (0.000197%)
AGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCA5 (0.000329%)
AGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCA6 (0.000395%)
AGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGC15 (0.000987%)
AGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCC13 (0.000855%)
AGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTA4 (0.000263%)
AGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAG3 (0.000197%)
AGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCA5 (0.000329%)
AGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATT3 (0.000197%)
AGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATG4 (0.000263%)
AGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACT17 (0.001119%)
AGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGA9 (0.000592%)
AGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACA11 (0.000724%)
AGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTG12 (0.000790%)
AGCGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAA7 (0.000461%)
AGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCT4 (0.000263%)
AGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCG6 (0.000395%)
AGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGAG5 (0.000329%)
AGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCA17 (0.001119%)
AGCTAATCTAGCTCTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATTCTTATAGGA12 (0.000790%)
AGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACA11 (0.000724%)
AGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCAT6 (0.000395%)
AGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGAC7 (0.000461%)
AGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAG10 (0.000658%)
AGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCAC3 (0.000197%)
AGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAG11 (0.000724%)
AGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCC3 (0.000197%)
AGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGAT4 (0.000263%)
AGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCT3 (0.000197%)
AGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGC4 (0.000263%)
AGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCT8 (0.000526%)
AGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAG5 (0.000329%)
AGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCT5 (0.000329%)
AGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTG6 (0.000395%)
AGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCAT7 (0.000461%)
AGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACT14 (0.000921%)
AGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTT21 (0.001382%)
AGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTG26 (0.001711%)
AGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCT4 (0.000263%)
AGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGC10 (0.000658%)
AGGAGACCCAGACAACTACATACCAGCTAATCCACTAAACACCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCA164 (0.010792%)
AGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGACTCTCTGCG3 (0.000197%)
AGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAA3 (0.000197%)
AGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTC4 (0.000263%)
AGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGA3 (0.000197%)
AGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAG4 (0.000263%)
AGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCC12 (0.000790%)
AGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCAT15 (0.000987%)
AGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCG3 (0.000197%)
AGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACT5 (0.000329%)
AGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCAC48 (0.003159%)
AGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAAT19 (0.001250%)
AGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCC6 (0.000395%)
AGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCA5 (0.000329%)
AGGCACAGCAGCGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCA5 (0.000329%)
AGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATA11 (0.000724%)
AGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTC9 (0.000592%)
AGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCT14 (0.000921%)
AGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTT6 (0.000395%)
AGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGA6 (0.000395%)
AGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACT11 (0.000724%)
AGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACG4 (0.000263%)
AGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACCC3 (0.000197%)
AGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAG16 (0.001053%)
AGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGT4 (0.000263%)
AGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACA3 (0.000197%)
AGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGA12 (0.000790%)
AGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCA3 (0.000197%)
AGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTC11 (0.000724%)
AGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTC5 (0.000329%)
AGGCTCTCGCGCATCTGTTCGCTGTGGGGCGCTAGCTGTGTGCGCAGAGAGTCTACGTGTGTGCGCATGCGGTCGCGAAATTCCTCAGCCACAGGGGACA3 (0.000197%)
AGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAA4 (0.000263%)
AGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGT3 (0.000197%)
AGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGT6 (0.000395%)
AGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATT4 (0.000263%)
AGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTTGTGGAAAGT4 (0.000263%)
AGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAAACCCTCAACAGACCAGACAGTGAGCTGCA15 (0.000987%)
AGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTC5 (0.000329%)
AGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTT7 (0.000461%)
AGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTGAGAAAAAAAGACATGAAGACT3 (0.000197%)
AGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCA16 (0.001053%)
AGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGG4 (0.000263%)
AGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAG8 (0.000526%)
AGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGT5 (0.000329%)
AGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCA8 (0.000526%)
AGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGG10 (0.000658%)
AGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACA4 (0.000263%)
AGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGA6 (0.000395%)
AGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTT7 (0.000461%)
AGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTA3 (0.000197%)
AGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCT3 (0.000197%)
AGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTC10 (0.000658%)
AGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCA3 (0.000197%)
AGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAA3 (0.000197%)
AGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCT3 (0.000197%)
AGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATC3 (0.000197%)
AGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCA16 (0.001053%)
AGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCG5 (0.000329%)
AGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCC10 (0.000658%)
AGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGT12 (0.000790%)
AGTAGGGCTTGATTTATGTGGTTTCGTTTACCTTCTATAAGGCTATGATGAGCTCATGTAATTGAAACACCTGATGCTAGAAGTACTGAAGTATTAAGTA3 (0.000197%)
AGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTAGGGTTCATGTTCGTCCTTTTGGT10 (0.000658%)
AGTAGGTTGGCTACTAGGATTCAGTACAAAATTTGTGTGATTGGGCGGAATATTAGGCTTCGTTGCTTTGAGGTATGAAGGAAAGGTATTAGGGCTAAAA5 (0.000329%)
AGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTA4 (0.000263%)
AGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGC4 (0.000263%)
AGTCACTTCCCCCAAATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGC4 (0.000263%)
AGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACG7 (0.000461%)
AGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTC3 (0.000197%)
AGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTTCACAGGC7 (0.000461%)
AGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTG3 (0.000197%)
AGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGG7 (0.000461%)
AGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTC4 (0.000263%)
AGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCT4 (0.000263%)
AGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTC5 (0.000329%)
AGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAA69 (0.004540%)
AGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATG4 (0.000263%)
AGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTA4 (0.000263%)
AGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAG8 (0.000526%)
AGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAA3 (0.000197%)
AGTGGGTAACCTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTA21 (0.001382%)
AGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCA5 (0.000329%)
AGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAA4 (0.000263%)
AGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTG5 (0.000329%)
AGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTAT3 (0.000197%)
AGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTG7 (0.000461%)
AGTGTGTTCTTCAAATATTATAAAAAGGAAAGGGTGGTCGAAGCGCAGGATAGGGGGCATAGACATAGGAACGGCTTCAAAGACTGTAGCTGCTGCAGCT110 (0.007238%)
AGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCT4 (0.000263%)
AGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTC4 (0.000263%)
AGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATT6 (0.000395%)
AGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAA5 (0.000329%)
AGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGG9 (0.000592%)
AGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAAC3 (0.000197%)
AGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGCTTC6 (0.000395%)
AGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTT6 (0.000395%)
AGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAA44 (0.002895%)
AGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTT390 (0.025663%)
AGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCA5 (0.000329%)
AGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTT4 (0.000263%)
AGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGT5 (0.000329%)
AGTTTGTGTCGGAAGCCTGTAATTACGGCTCCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTA5 (0.000329%)
ATAAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCATGGGCTAGATTTCCGGCTA3 (0.000197%)
ATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCA16 (0.001053%)
ATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGA18 (0.001184%)
ATAAAGTACAAGCTGGAACCATTGGAAGAACATGTGTTGGGGCCAAGAGACTTGTCCAAACACAGGGCCCCATCAACTTTCTCATGGGGCCAGGAAACCT3 (0.000197%)
ATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGC9 (0.000592%)
ATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAA13 (0.000855%)
ATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTA7 (0.000461%)
ATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCA26 (0.001711%)
ATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACA19 (0.001250%)
ATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCATGGGCTA3 (0.000197%)
ATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCA7 (0.000461%)
ATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGGAATGTTGA3 (0.000197%)
ATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCA14 (0.000921%)
ATACAAGCACAATAGATGCACAAGAAGTTGAAACCATTTGAACTATTCTACCAGCTGTAATCCTTATCATAATTGCTCTCCCCTCTCTACGCATTCTATA4 (0.000263%)
ATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTC25 (0.001645%)
ATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAG9 (0.000592%)
ATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAA7 (0.000461%)
ATACGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAA3 (0.000197%)
ATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGC3 (0.000197%)
ATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATT6 (0.000395%)
ATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATT5 (0.000329%)
ATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACAC8 (0.000526%)
ATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGC21 (0.001382%)
ATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTA10 (0.000658%)
ATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAAC7 (0.000461%)
ATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCT3 (0.000197%)
ATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCAT6 (0.000395%)
ATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTG9 (0.000592%)
ATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGG12 (0.000790%)
ATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCA7 (0.000461%)
ATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTT6 (0.000395%)
ATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTG8 (0.000526%)
ATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCT4 (0.000263%)
ATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTAGGGTTCATGTTCG3 (0.000197%)
ATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTC26 (0.001711%)
ATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGA3 (0.000197%)
ATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAAGTTGAAACCATTTGAACTATTCTACCAGCTGTAATCCT4 (0.000263%)
ATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCC11 (0.000724%)
ATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAG5 (0.000329%)
ATATGATTAGGGAAACAATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTTTGATAATAAGTTTAACTAGTCAGTGTTGGAA5 (0.000329%)
ATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAA6 (0.000395%)
ATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTT10 (0.000658%)
ATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCT7 (0.000461%)
ATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCAT42 (0.002764%)
ATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAA4 (0.000263%)
ATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGT7 (0.000461%)
ATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCC4 (0.000263%)
ATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCA12 (0.000790%)
ATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAAT11 (0.000724%)
ATCAAGTCTTCCTTGCCATTGTTTTTTCGAGCCACAACAGCATGAGAAGGGATCCGAGCCAGGTAGCAATCCTCATACTGATCCACTGGCTTGCGGGTAT6 (0.000395%)
ATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTC3 (0.000197%)
ATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCG28 (0.001842%)
ATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGC11 (0.000724%)
ATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAG12 (0.000790%)
ATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACA4 (0.000263%)
ATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCA8 (0.000526%)
ATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTG43 (0.002830%)
ATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGAT9 (0.000592%)
ATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGC13 (0.000855%)
ATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCC10 (0.000658%)
ATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTA5 (0.000329%)
ATCAGCCTATACCGGGAGCTGGTCCATCAGTCCAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGA276 (0.018162%)
ATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCA29 (0.001908%)
ATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGG51 (0.003356%)
ATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCA3 (0.000197%)
ATCAGTCCAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGAT3 (0.000197%)
ATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCAGAACGACTCGG9 (0.000592%)
ATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAA9 (0.000592%)
ATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACC4 (0.000263%)
ATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCAC5 (0.000329%)
ATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTT18 (0.001184%)
ATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGG4 (0.000263%)
ATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGG26 (0.001711%)
ATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTA9 (0.000592%)
ATCCCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTA6 (0.000395%)
ATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGG5 (0.000329%)
ATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAA11 (0.000724%)
ATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAA8 (0.000526%)
ATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGATCCAATAATTACATGGAGTCCATGGAATCC8 (0.000526%)
ATCCTATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAA6 (0.000395%)
ATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCT7 (0.000461%)
ATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCT19 (0.001250%)
ATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGAC3 (0.000197%)
ATCGATGGTCAGCACAGCCTTATGCACAGCCTTGCTGAGCTTCAGGGGAGCATTCTCCTCTGTGATTCCAGAGAGGTCAGCCCCATTGTTGAAGATCCGG3 (0.000197%)
ATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTA7 (0.000461%)
ATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCA34 (0.002237%)
ATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATG17 (0.001119%)
ATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCG11 (0.000724%)
ATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATAC11 (0.000724%)
ATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTCCG14 (0.000368%)
ATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATT19 (0.001250%)
ATCGTGAAGCACGATGTCAAGGGATGAGTTGGATAAAACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCT3 (0.000197%)
ATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAA6 (0.000395%)
ATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTAT8 (0.000526%)
ATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACT8 (0.000526%)
ATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGT19 (0.001250%)
ATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTT3 (0.000197%)
ATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGC16 (0.001053%)
ATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGT3 (0.000197%)
ATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACT3 (0.000197%)
ATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTG8 (0.000526%)
ATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCA6 (0.000395%)
ATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTG11 (0.000724%)
ATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGA3 (0.000197%)
ATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATA10 (0.000658%)
ATCTGCTTCTCCTTCTCTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAG407 (0.026782%)
ATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAAT9 (0.000592%)
ATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCG5 (0.000329%)
ATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAG4 (0.000263%)
ATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTA16 (0.001053%)
ATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCA10 (0.000658%)
ATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGAGTCGGTTGCGTA3 (0.000197%)
ATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGC7 (0.000461%)
ATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACAC4 (0.000263%)
ATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAAC18 (0.001184%)
ATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAA5 (0.000329%)
ATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAA6 (0.000395%)
ATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACC8 (0.000526%)
ATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAA48 (0.003159%)
ATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGA8 (0.000526%)
ATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAA8 (0.000526%)
ATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACG3 (0.000197%)
ATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGG44 (0.002895%)
ATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCA4 (0.000263%)
ATGACTCCCTCCATCTCATGGAGTCTGCTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCC3 (0.000197%)
ATGACTCCCTCCATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCC10 (0.000658%)
ATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGC6 (0.000395%)
ATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATA18 (0.001184%)
ATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTG8 (0.000526%)
ATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCG12 (0.000790%)
ATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTCAGACAT4 (0.000263%)
ATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGA6 (0.000395%)
ATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAA5 (0.000329%)
ATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTC5 (0.000329%)
ATGATTAGGGAAACAATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTTTGATAATAAGTTTAACTAGTCAGTGTTGGAAAG3 (0.000197%)
ATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGA7 (0.000461%)
ATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCA6 (0.000395%)
ATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGG4 (0.000263%)
ATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTT4 (0.000263%)
ATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTAT5 (0.000329%)
ATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTG6 (0.000395%)
ATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGA12 (0.000790%)
ATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGG3 (0.000197%)
ATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCT3 (0.000197%)
ATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCA3 (0.000197%)
ATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTAC5 (0.000329%)
ATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATT4 (0.000263%)
ATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAA3 (0.000197%)
ATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCA7 (0.000461%)
ATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAG15 (0.000987%)
ATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTT9 (0.000592%)
ATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATA16 (0.001053%)
ATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAG7 (0.000461%)
ATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCT11 (0.000724%)
ATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGT4 (0.000263%)
ATGGAGGACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGG9 (0.000592%)
ATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACC3 (0.000197%)
ATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTG9 (0.000592%)
ATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCA5 (0.000329%)
ATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGG29 (0.001908%)
ATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCT26 (0.001711%)
ATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCC6 (0.000395%)
ATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGG8 (0.000526%)
ATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCC8 (0.000526%)
ATGGCATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCAGAACGA6 (0.000395%)
ATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAA14 (0.000921%)
ATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGA10 (0.000658%)
ATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCAC4 (0.000263%)
ATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGT11 (0.000724%)
ATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCA3 (0.000197%)
ATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAG3 (0.000197%)
ATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTC5 (0.000329%)
ATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCAC21 (0.001382%)
ATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGA10 (0.000658%)
ATGTATCGTGAAGCACGATGTCAAGGGATGAGTTGGATAAAACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTAT144 (0.009476%)
ATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTG5 (0.000329%)
ATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGC6 (0.000395%)
ATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCT15 (0.000987%)
ATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGT5 (0.000329%)
ATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTT21 (0.001382%)
ATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCA4 (0.000263%)
ATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACA3 (0.000197%)
ATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGG3 (0.000197%)
ATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGA8 (0.000526%)
ATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCAT3 (0.000197%)
ATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTG14 (0.000921%)
ATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAAT66 (0.004343%)
ATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGG4 (0.000263%)
ATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGC4 (0.000263%)
ATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTC9 (0.000592%)
ATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGT17 (0.001119%)
ATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTC11 (0.000724%)
ATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTG5 (0.000329%)
ATTAGTGTTAGTTCTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAATAATTATGTATATTGAGTATATAC13 (0.000855%)
ATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGGTTCTACATTCTTCATGG4 (0.000263%)
ATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAA9 (0.000592%)
ATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAAC4 (0.000263%)
ATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAGCAGCTGACACCCCTTGT3 (0.000197%)
ATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCC40 (0.002632%)
ATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTC16 (0.001053%)
ATTCAGGTTAAGATAAGTAGGTTGGCTACTAGGATTCAGTACAAAATTTGTGTGATTGGGCGGAATATTAGGCTTCGTTGCTTTGAGGTATGAAGGAAAG13 (0.000855%)
ATTCAGTACAAAATTTGTGTGATTGGGCGGAATATTAGGCTTCGTTGCTTTGAGGTATGAAGGAAAGGTATTAGGGCTAAAATTAGGATAGATAAGATTA9 (0.000592%)
ATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATC24 (0.001579%)
ATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACC4 (0.000263%)
ATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACC6 (0.000395%)
ATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAG4 (0.000263%)
ATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCT13 (0.000855%)
ATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAAT11 (0.000724%)
ATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGAT20 (0.001316%)
ATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCT3 (0.000197%)
ATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATA12 (0.000790%)
ATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGACAAGTCCACCACGGTGAAGGTGCCCATGATGATGCTCTCGGGCATGCTTGATGTGCAC7 (0.000461%)
ATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGA5 (0.000329%)
ATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACAC22 (0.001448%)
ATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGC11 (0.000724%)
ATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATT14 (0.000921%)
ATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGA9 (0.000592%)
ATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAAC7 (0.000461%)
ATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGA3 (0.000197%)
ATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATG4 (0.000263%)
ATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCAT22 (0.001448%)
ATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCAC12 (0.000790%)
ATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGA13 (0.000855%)
ATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGC9 (0.000592%)
ATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGAC10 (0.000658%)
ATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGAT14 (0.000921%)
ATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACA46 (0.003027%)
ATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTT9 (0.000592%)
ATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTG4 (0.000263%)
ATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTA3 (0.000197%)
ATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAG12 (0.000790%)
ATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTT23 (0.001513%)
ATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGA61 (0.004014%)
ATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATT11 (0.000724%)
ATTTAGTCGGCCTGGGATGGCATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGT51 (0.003356%)
ATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTC77 (0.005067%)
ATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAA25 (0.001645%)
ATTTCAACTAAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACG480 (0.031586%)
ATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTT35 (0.002303%)
ATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCAC4 (0.000263%)
ATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACT33 (0.002172%)
ATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAA11 (0.000724%)
ATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCA3 (0.000197%)
ATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCA13 (0.000855%)
ATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCT52 (0.003422%)
ATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGA25 (0.001645%)
ATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGT25 (0.001645%)
ATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGA3 (0.000197%)
ATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTG16 (0.001053%)
ATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTG42 (0.002764%)
ATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAAT23 (0.001513%)
ATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTTTGATAATAAGTTTA15 (0.000987%)
ATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGT15 (0.000987%)
ATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTAC14 (0.000921%)
ATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAA19 (0.001250%)
ATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTA3 (0.000197%)
ATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATC13 (0.000855%)
ATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCC6 (0.000395%)
ATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACT41 (0.002698%)
ATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTA60 (0.003948%)
CAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTC25 (0.001645%)
CAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGAC31 (0.002040%)
CAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCA20 (0.001316%)
CAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGA9 (0.000592%)
CAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTA112 (0.007370%)
CAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACG18 (0.001184%)
CAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGT30 (0.001974%)
CAAAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTC7 (0.000461%)
CAAAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAA21 (0.001382%)
CAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGT58 (0.003817%)
CAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGA21 (0.001382%)
CAAACAGTGGCTACCCTCTGGCTTGCAGACTGGCACCTTCAACTGCGTATTAGTTCCTCGTACCCATCACCAGGGACTCCACAGTACTCTTTGCATTCCT62 (0.004080%)
CAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCAT18 (0.001184%)
CAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAG30 (0.001974%)
CAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTGAGAAAAAAAGACATGAAGACTCAGGAC9 (0.000592%)
CAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAA3 (0.000197%)
CAAACTCCATGAAGCTTCATAGGAGCAACAATACTAATAATCGCACATGGCCTCACATCATCACTCCTATTCTGCCTAGCAAACTCCAACTACGAACGGA6 (0.000395%)
CAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCT18 (0.001184%)
CAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAAT5 (0.000329%)
CAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTG28 (0.001842%)
CAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAGCAGCTGACACCCCTTGTCAGGTCA4 (0.000263%)
CAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACG156 (0.010265%)
CAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGT6 (0.000395%)
CAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTG25 (0.001645%)
CAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGA10 (0.000658%)
CAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAA10 (0.000658%)
CAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCT16 (0.001053%)
CAAATCAAAAGACTTCCAACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGAC3 (0.000197%)
CAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCC43 (0.002830%)
CAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGATCCAATAATTACATGGAGTCCATGGAA25 (0.001645%)
CAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGACAAGTCCACCACGGTGAAGGTGCCCATGATGATGCTCTCGGGC3 (0.000197%)
CAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTT17 (0.001119%)
CAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTG64 (0.004211%)
CAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAG13 (0.000855%)
CAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCA12 (0.000790%)
CAACAATGACCTGAAGCTGGTGGAGAAGTTTCTGGAAGAGGCCAAGAACCATTATCAGGCAGAAGTCTTCTCTGTCAACTTTGCAGAGTCAGAGGAGGCC14 (0.000921%)
CAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGAC10 (0.000658%)
CAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAG10 (0.000658%)
CAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTCCTC31 (0.002040%)
CAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTC15 (0.000987%)
CAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAG3 (0.000197%)
CAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCAT48 (0.003159%)
CAACAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCC13 (0.000855%)
CAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCC33 (0.002172%)
CAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAG15 (0.000987%)
CAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTGT7 (0.000461%)
CAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTG46 (0.003027%)
CAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGAT25 (0.001645%)
CAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTA16 (0.001053%)
CAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTT9 (0.000592%)
CAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGC9 (0.000592%)
CAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCC29 (0.001908%)
CAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCT17 (0.001119%)
CAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTC31 (0.002040%)
CAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTG20 (0.001316%)
CAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAA14 (0.000921%)
CAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTC34 (0.002237%)
CAACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGGCTGTACCTTG13 (0.000855%)
CAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAAT11 (0.000724%)
CAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGG48 (0.003159%)
CAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATG137 (0.009015%)
CAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGT13 (0.000855%)
CAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGC159 (0.010463%)
CAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTT64 (0.004211%)
CAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGC122 (0.008028%)
CAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGG231 (0.015201%)
CAAGACGGTCCAGGATGCGCTAAGTAGCGTGCAGGAGTCCGATATAGCTGTGGTGGCCAGGGGCTGGATGGACAATCACTTCAGATCCCTGAAAGGCTAC7 (0.000461%)
CAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATAC30 (0.001974%)
CAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGC7 (0.000461%)
CAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTC72 (0.004738%)
CAAGCCCTACTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATG8 (0.000526%)
CAAGCCTCCAAGACGGTCCAGGATGCGCTAAGTAGCGTGCAGGAGTCCGATATAGCTGTGGTGGCCAGGGGCTGGATGGACAATCACTTCAGATCCCTGA136 (0.008949%)
CAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCG14 (0.000921%)
CAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATA59 (0.003882%)
CAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGG58 (0.003817%)
CAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGA9 (0.000592%)
CAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCC6 (0.000395%)
CAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCC154 (0.010134%)
CAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTA14 (0.000921%)
CAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTG7 (0.000461%)
CAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACT41 (0.002698%)
CAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTT8 (0.000526%)
CAAGGGATGAGTTGGATAAAACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATT23 (0.001513%)
CAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTG96 (0.006317%)
CAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAG49 (0.003224%)
CAAGTCTCAGCAACAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTT524 (0.034481%)
CAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCCGGAT4 (0.000263%)
CAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGC205 (0.013490%)
CAAGTCTTCCTTGCCATTGTTTTTTCGAGCCACAACAGCATGAGAAGGGATCCGAGCCAGGTAGCAATCCTCATACTGATCCACTGGCTTGCGGGTATTG7 (0.000461%)
CAAGTGAGCTTTTTAGTTTGTGTCGGAAGCCTGTAATTACGGCTCCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGT5 (0.000329%)
CAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCA25 (0.001645%)
CAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAA16 (0.001053%)
CAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGCT42 (0.002764%)
CAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTAT5 (0.000329%)
CAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACAC7 (0.000461%)
CAATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCT18 (0.001184%)
CAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAG43 (0.002830%)
CAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTT67 (0.004409%)
CAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCAT16 (0.001053%)
CAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTC5 (0.000329%)
CAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCT6 (0.000395%)
CAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGG12 (0.000790%)
CAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCA9 (0.000592%)
CAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCT9 (0.000592%)
CAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGATTTAGTCGGCC5 (0.000329%)
CAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTT5 (0.000329%)
CAATTCAGGTTAAGATAAGTAGGTTGGCTACTAGGATTCAGTACAAAATTTGTGTGATTGGGCGGAATATTAGGCTTCGTTGCTTTGAGGTATGAAGGAA3 (0.000197%)
CAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGTCAGAAA3 (0.000197%)
CAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTG29 (0.001908%)
CAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTG4 (0.000263%)
CAATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCT37 (0.002435%)
CAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTA17 (0.001119%)
CACAAAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTC4 (0.000263%)
CACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTC10 (0.000658%)
CACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTC27 (0.001777%)
CACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACT27 (0.001777%)
CACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTG11 (0.000724%)
CACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGC6 (0.000395%)
CACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTA10 (0.000658%)
CACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCT63 (0.004146%)
CACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGG32 (0.002106%)
CACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAG17 (0.001119%)
CACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCAC5 (0.000329%)
CACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGA11 (0.000724%)
CACACACACACACACACACACACACACACACACACACACA97 (0.002553%)
CACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTC13 (0.000855%)
CACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCAC16 (0.001053%)
CACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTT124 (0.008160%)
CACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCT13 (0.000855%)
CACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTT18 (0.001184%)
CACACGTCTGAACTCCAGTCACAACTTCCGTCATCTCGTA10 (0.000263%)
CACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAA10 (0.000658%)
CACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACG18 (0.001184%)
CACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTC52 (0.003422%)
CACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACA98 (0.006449%)
CACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAG17 (0.001119%)
CACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCC12 (0.000790%)
CACAGCAGCGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAG3 (0.000197%)
CACAGCCTTATGCACAGCCTTGCTGAGCTTCAGGGGAGCATTCTCCTCTGTGATTCCAGAGAGGTCAGCCCCATTGTTGAAGATCCGGGTGATGCCCAGT11 (0.000724%)
CACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTC14 (0.000921%)
CACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGAT519 (0.034152%)
CACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAA30 (0.001974%)
CACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTA48 (0.003159%)
CACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATA60 (0.003948%)
CACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCA12 (0.000790%)
CACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGGA8 (0.000526%)
CACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTC17 (0.001119%)
CACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGG11 (0.000724%)
CACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTC5 (0.000329%)
CACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATG4 (0.000263%)
CACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACC6 (0.000395%)
CACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCC7 (0.000461%)
CACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTG16 (0.001053%)
CACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACA7 (0.000461%)
CACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGG19 (0.001250%)
CACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGGTTCTACATTCTTCATGGCTACTGGATTCCATGGACTC8 (0.000526%)
CACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTAT7 (0.000461%)
CACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACG16 (0.001053%)
CACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTAC8 (0.000526%)
CACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACA21 (0.001382%)
CACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAG5 (0.000329%)
CACCCCGCTGGCAAACTGTTCTGTGAGGCAGCTGACTGAGCACGCGGTGGAGGGAGACTGTGACTTCCACATCCTGAAACAAGACGGCCAGTTCAGGGTG3 (0.000197%)
CACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATA4 (0.000263%)
CACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACG8 (0.000526%)
CACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCA8 (0.000526%)
CACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTG3 (0.000197%)
CACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCG15 (0.000987%)
CACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCG7 (0.000461%)
CACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTAT6 (0.000395%)
CACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCC7 (0.000461%)
CACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTGAGAA5 (0.000329%)
CACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACA11 (0.000724%)
CACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTG11 (0.000724%)
CACGATGTCAAGGGATGAGTTGGATAAAACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCAT24 (0.001579%)
CACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTG58 (0.003817%)
CACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAAACCCTCAACAGACCA281 (0.018491%)
CACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGC13 (0.000855%)
CACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAA13 (0.000855%)
CACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTT10 (0.000658%)
CACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGC75 (0.004935%)
CACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTT14 (0.000921%)
CACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGC19 (0.001250%)
CACGTTGGTATCGTTGAACGGAGTCAGGAGTGGGCACCGTGGGCACAACTTACGAACGTCCTCTGCAGAGTCTGGGGTGGAATGACACTGGGTGTGCATC3 (0.000197%)
CACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTC9 (0.000592%)
CACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCCCAAATCATTATAC3 (0.000197%)
CACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAG20 (0.001316%)
CACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTG4 (0.000263%)
CACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACA24 (0.001579%)
CACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTT4 (0.000263%)
CACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGC5 (0.000329%)
CACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTC3 (0.000197%)
CACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATAT10 (0.000658%)
CACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAA10 (0.000658%)
CACTGATGGAGGACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAA20 (0.001316%)
CACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCAT7 (0.000461%)
CACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCA9 (0.000592%)
CACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACAC14 (0.000921%)
CACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCA5 (0.000329%)
CACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTG7 (0.000461%)
CACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGT12 (0.000790%)
CACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCT8 (0.000526%)
CACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGC5 (0.000329%)
CACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCAT7 (0.000461%)
CACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCA14 (0.000921%)
CACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGT12 (0.000790%)
CACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATG5 (0.000329%)
CACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGAT10 (0.000658%)
CACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTT14 (0.000921%)
CACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGG3 (0.000197%)
CAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGAC71 (0.004672%)
CAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAA87 (0.005725%)
CAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGT44 (0.002895%)
CAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGC19 (0.001250%)
CAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTG27 (0.001777%)
CAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAG11 (0.000724%)
CAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGG149 (0.009805%)
CAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGT51 (0.003356%)
CAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCG154 (0.010134%)
CAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCG118 (0.007765%)
CAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACC12 (0.000790%)
CAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAGGT11 (0.000724%)
CAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCC18 (0.001184%)
CAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCA13 (0.000855%)
CAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTC9 (0.000592%)
CAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGC46 (0.003027%)
CAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATT55 (0.003619%)
CAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGA8 (0.000526%)
CAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTG48 (0.003159%)
CAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCT125 (0.008225%)
CAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGA80 (0.005264%)
CAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAGCAGC12 (0.000790%)
CAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGTCAGAAATCGTGC3 (0.000197%)
CAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCAT10 (0.000658%)
CAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGC14 (0.000921%)
CAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGC30 (0.001974%)
CAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCG12 (0.000790%)
CAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAAC9 (0.000592%)
CAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCC21 (0.001382%)
CAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGG17 (0.001119%)
CAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCA22 (0.001448%)
CAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTC24 (0.001579%)
CAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAAACCCTCAACAGACCAGACA5 (0.000329%)
CAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGC8 (0.000526%)
CAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTT4790 (0.126079%)
CAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGC25 (0.001645%)
CAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTA4 (0.000263%)
CAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCC5 (0.000329%)
CAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTG36 (0.002369%)
CAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATT25 (0.001645%)
CAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGG9 (0.000592%)
CAGCAACAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACT69 (0.004540%)
CAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTT28 (0.001842%)
CAGCACAGCCTTATGCACAGCCTTGCTGAGCTTCAGGGGAGCATTCTCCTCTGTGATTCCAGAGAGGTCAGCCCCATTGTTGAAGATCCGGGTGATGCCC3 (0.000197%)
CAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATG27 (0.001777%)
CAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCT29 (0.001908%)
CAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCT9 (0.000592%)
CAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAG20 (0.001316%)
CAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGC29 (0.001908%)
CAGCAGCGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTG13 (0.000855%)
CAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTG61 (0.004014%)
CAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGA49 (0.003224%)
CAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAG68 (0.004475%)
CAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGA8 (0.000526%)
CAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTG12 (0.000790%)
CAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGAC27 (0.001777%)
CAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATG6 (0.000395%)
CAGCCAGGCGCTGGGCCAGGCTCTCGCGCATCTGTTCGCTGTGGGGCGCTAGCTGTGTGCGCAGAGAGTCTACGTGTGTGCGCATGCGGTCGCGAAATTC11 (0.000724%)
CAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATC19 (0.001250%)
CAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGC13 (0.000855%)
CAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCA8 (0.000526%)
CAGCCCTGCTGTAGACGTGGCTGTAAAAGTGTTCAAAAAGACCTCTGAGGGATCCTGGGAGCCCTTTGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTG16 (0.001053%)
CAGCCTATACCGGGAGCTGGTCCATCAGTCCAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGC6 (0.000395%)
CAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGC27 (0.001777%)
CAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATG16 (0.001053%)
CAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGC34 (0.002237%)
CAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCT16 (0.001053%)
CAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCC490 (0.032244%)
CAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTC5 (0.000329%)
CAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAG56 (0.003685%)
CAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCC20 (0.001316%)
CAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCC29 (0.001908%)
CAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTG9 (0.000592%)
CAGCTCATGGACAATGAGGTGTTGATGGCCTTTACCTCCTATGCAACGATCATTCTTACCAAGATGATGTTCATGAGCTCTGCGACCGCATTCCAGAGGA134 (0.008818%)
CAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGG310 (0.020399%)
CAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTA16 (0.001053%)
CAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACC14 (0.000921%)
CAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCC11 (0.000724%)
CAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATG40 (0.002632%)
CAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTC36 (0.002369%)
CAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCA6 (0.000395%)
CAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGC30 (0.001974%)
CAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCA35 (0.002303%)
CAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAAC32 (0.002106%)
CAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGT58 (0.003817%)
CAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGACTCTCTGC3 (0.000197%)
CAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAA10 (0.000658%)
CAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTT20 (0.001316%)
CAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCC56 (0.003685%)
CAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGA6 (0.000395%)
CAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGAT15 (0.000987%)
CAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGT10 (0.000658%)
CAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTT104 (0.006844%)
CAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTCCTCACATAGTTGTGCAA3 (0.000197%)
CAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATAC14 (0.000921%)
CAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAG3 (0.000197%)
CAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACC13 (0.000855%)
CAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAA20 (0.001316%)
CAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTAC6 (0.000395%)
CAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTG41 (0.002698%)
CAGGCGCTGGGCCAGGCTCTCGCGCATCTGTTCGCTGTGGGGCGCTAGCTGTGTGCGCAGAGAGTCTACGTGTGTGCGCATGCGGTCGCGAAATTCCTCA5 (0.000329%)
CAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCT4 (0.000263%)
CAGGCTCTCGCGCATCTGTTCGCTGTGGGGCGCTAGCTGTGTGCGCAGAGAGTCTACGTGTGTGCGCATGCGGTCGCGAAATTCCTCAGCCACAGGGGAC12 (0.000790%)
CAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGG9 (0.000592%)
CAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCT6 (0.000395%)
CAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGG71 (0.004672%)
CAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACA132 (0.008686%)
CAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACA9 (0.000592%)
CAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGT9 (0.000592%)
CAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGC15 (0.000987%)
CAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTT7 (0.000461%)
CAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCT15 (0.000987%)
CAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGC17 (0.001119%)
CAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGA14 (0.000921%)
CAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGATGACGAGACGTAAT3 (0.000197%)
CAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAAC35 (0.002303%)
CAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGG48 (0.003159%)
CAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCT17 (0.001119%)
CAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTC30 (0.001974%)
CAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGC7 (0.000461%)
CAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGG967 (0.063632%)
CAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGATCCAATAA3 (0.000197%)
CAGTCACTTCCCCCAAATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGG4 (0.000263%)
CAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACT23 (0.001513%)
CAGTCCAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCC3 (0.000197%)
CAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTT5 (0.000329%)
CAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTC12 (0.000790%)
CAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGA37 (0.002435%)
CAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAA10 (0.000658%)
CAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCA4 (0.000263%)
CAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGT4 (0.000263%)
CAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGC13 (0.000855%)
CAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCC16 (0.001053%)
CAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGAT7 (0.000461%)
CAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCA10 (0.000658%)
CAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAA3 (0.000197%)
CAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCACCCAGCGCAGGTAATCCCAGAAGCGGTTCAGGGCCTGC4 (0.000263%)
CAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAA9 (0.000592%)
CAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACT7 (0.000461%)
CAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATC5 (0.000329%)
CAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTG6 (0.000395%)
CAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCAGAACGACTCGGTT3 (0.000197%)
CATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGG10 (0.000658%)
CATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGC5 (0.000329%)
CATACAAGCACAATAGATGCACAAGAAGTTGAAACCATTTGAACTATTCTACCAGCTGTAATCCTTATCATAATTGCTCTCCCCTCTCTACGCATTCTAT82 (0.005396%)
CATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGGAAT4 (0.000263%)
CATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACAT3 (0.000197%)
CATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGA4 (0.000263%)
CATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGC8 (0.000526%)
CATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGT6 (0.000395%)
CATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCT21 (0.001382%)
CATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACA5 (0.000329%)
CATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGC3 (0.000197%)
CATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGC12 (0.000790%)
CATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAA5 (0.000329%)
CATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGG4 (0.000263%)
CATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCC7 (0.000461%)
CATCAGTCCAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGA157 (0.010331%)
CATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCAGAACGACTCG3 (0.000197%)
CATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGC3 (0.000197%)
CATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGG3 (0.000197%)
CATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGG12 (0.000790%)
CATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGA4 (0.000263%)
CATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTC3 (0.000197%)
CATCGATGGTCAGCACAGCCTTATGCACAGCCTTGCTGAGCTTCAGGGGAGCATTCTCCTCTGTGATTCCAGAGAGGTCAGCCCCATTGTTGAAGATCCG3 (0.000197%)
CATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAAT44 (0.002895%)
CATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAG38 (0.002501%)
CATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAG7 (0.000461%)
CATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAG4 (0.000263%)
CATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAAC3 (0.000197%)
CATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAA3 (0.000197%)
CATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGC6 (0.000395%)
CATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAA20 (0.001316%)
CATCTTCCCATCTTCGGGCAGGAGGAAGACAGCACTGGCGTTGCCCGCGTAATCCATCAGCAGCACCCAGCTGGACAGTATGCTGCAATGGTGCACATCA5 (0.000329%)
CATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTC4 (0.000263%)
CATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACA17 (0.001119%)
CATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTG22 (0.001448%)
CATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTG15 (0.000987%)
CATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGG14 (0.000921%)
CATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACAT13 (0.000855%)
CATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAG17 (0.001119%)
CATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTC5 (0.000329%)
CATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCT5 (0.000329%)
CATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTC16 (0.001053%)
CATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATA11 (0.000724%)
CATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAG9 (0.000592%)
CATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCCCAAATCATTATACCGATGGGCGAT4 (0.000263%)
CATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTA22 (0.001448%)
CATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAA40 (0.002632%)
CATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCT10 (0.000658%)
CATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACAC3 (0.000197%)
CATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAA8 (0.000526%)
CATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGC9 (0.000592%)
CATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAG794 (0.052248%)
CATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCC5 (0.000329%)
CATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACA12 (0.000790%)
CATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCA8 (0.000526%)
CATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTG24 (0.001579%)
CATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTGTGTT14 (0.000921%)
CATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGC6 (0.000395%)
CATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTT6 (0.000395%)
CATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGC11 (0.000724%)
CATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAAT8 (0.000526%)
CATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGAC12 (0.000790%)
CATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTG13 (0.000855%)
CATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCA4 (0.000263%)
CATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGT7 (0.000461%)
CATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAA11 (0.000724%)
CATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAG15 (0.000987%)
CATTATAGCCAACAAGCAGGTCTCTAAATCTATCCAGGCAAGCCAGAAAATGCCCAGGGGGGTAGAGATGGCGGGATAGGAGGTATAAGGGTAGGGAAAT31 (0.002040%)
CATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAAC5 (0.000329%)
CATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGC5 (0.000329%)
CATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGA12 (0.000790%)
CATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACA11 (0.000724%)
CATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGG4 (0.000263%)
CATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCA20 (0.001316%)
CATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCA9 (0.000592%)
CATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGA16 (0.001053%)
CATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGA5 (0.000329%)
CATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGAC19 (0.001250%)
CATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTT6 (0.000395%)
CATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCG6 (0.000395%)
CATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAA4 (0.000263%)
CATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCAC49 (0.003224%)
CATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCAC10 (0.000658%)
CCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCT6 (0.000395%)
CCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCAC16 (0.001053%)
CCAAAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGA593 (0.039021%)
CCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAG29 (0.001908%)
CCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCA17 (0.001119%)
CCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTGAGAAAAAAAGACATGAAGACTCAGGA6 (0.000395%)
CCAAACTCCATGAAGCTTCATAGGAGCAACAATACTAATAATCGCACATGGCCTCACATCATCACTCCTATTCTGCCTAGCAAACTCCAACTACGAACGG60 (0.003948%)
CCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCT4 (0.000263%)
CCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAA10 (0.000658%)
CCAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGA16 (0.001053%)
CCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCA17 (0.001119%)
CCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGA4 (0.000263%)
CCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTT6 (0.000395%)
CCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGT14 (0.000921%)
CCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAA9 (0.000592%)
CCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCT10 (0.000658%)
CCAAGACGGTCCAGGATGCGCTAAGTAGCGTGCAGGAGTCCGATATAGCTGTGGTGGCCAGGGGCTGGATGGACAATCACTTCAGATCCCTGAAAGGCTA3 (0.000197%)
CCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTTGTGGAAAGTGCAGGCTTCCAG3 (0.000197%)
CCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCG37 (0.002435%)
CCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAG24 (0.001579%)
CCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGC26 (0.001711%)
CCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGAC12 (0.000790%)
CCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGA16 (0.001053%)
CCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCC4 (0.000263%)
CCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGC12 (0.000790%)
CCAATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGC7 (0.000461%)
CCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAA19 (0.001250%)
CCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCA25 (0.001645%)
CCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCC5 (0.000329%)
CCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAG43 (0.002830%)
CCAATTCAGGTTAAGATAAGTAGGTTGGCTACTAGGATTCAGTACAAAATTTGTGTGATTGGGCGGAATATTAGGCTTCGTTGCTTTGAGGTATGAAGGA5 (0.000329%)
CCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACT15 (0.000987%)
CCAATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTC14 (0.000921%)
CCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTG10 (0.000658%)
CCACACACCAAAAGGACGAACATGAACCCTAATAATTGTTTCCCTAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACA191 (0.012568%)
CCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTC5 (0.000329%)
CCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATG3 (0.000197%)
CCACCATGAACTTCTCCGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGG27 (0.001777%)
CCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGAC8 (0.000526%)
CCACCCCGCTGGCAAACTGTTCTGTGAGGCAGCTGACTGAGCACGCGGTGGAGGGAGACTGTGACTTCCACATCCTGAAACAAGACGGCCAGTTCAGGGT6 (0.000395%)
CCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGC7 (0.000461%)
CCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCT15 (0.000987%)
CCACGTTGGTATCGTTGAACGGAGTCAGGAGTGGGCACCGTGGGCACAACTTACGAACGTCCTCTGCAGAGTCTGGGGTGGAATGACACTGGGTGTGCAT4 (0.000263%)
CCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCA11 (0.000724%)
CCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGC7 (0.000461%)
CCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAG6 (0.000395%)
CCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGT15 (0.000987%)
CCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATA10 (0.000658%)
CCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCC3 (0.000197%)
CCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCT9 (0.000592%)
CCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAG13 (0.000855%)
CCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGAT4 (0.000263%)
CCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGA51 (0.003356%)
CCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTG30 (0.001974%)
CCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTG3 (0.000197%)
CCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAG10 (0.000658%)
CCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGC8 (0.000526%)
CCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATG7 (0.000461%)
CCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATG14 (0.000921%)
CCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCT109 (0.007173%)
CCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCAT11 (0.000724%)
CCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATG3 (0.000197%)
CCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAG7 (0.000461%)
CCAGCCAATGCCAACGCAGTAGGTCCCGTACCCACAGCGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCAC7 (0.000461%)
CCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGT8 (0.000526%)
CCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCC11 (0.000724%)
CCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATG6 (0.000395%)
CCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTG4 (0.000263%)
CCAGGATGCGCTAAGTAGCGTGCAGGAGTCCGATATAGCTGTGGTGGCCAGGGGCTGGATGGACAATCACTTCAGATCCCTGAAAGGCTACTGGAGCAAG6 (0.000395%)
CCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCA11 (0.000724%)
CCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAAC11 (0.000724%)
CCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCT8 (0.000526%)
CCAGGCTCTCGCGCATCTGTTCGCTGTGGGGCGCTAGCTGTGTGCGCAGAGAGTCTACGTGTGTGCGCATGCGGTCGCGAAATTCCTCAGCCACAGGGGA7 (0.000461%)
CCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGC499 (0.032836%)
CCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCAC8 (0.000526%)
CCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTT9 (0.000592%)
CCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCCGGATCAGCCATGA3 (0.000197%)
CCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAG7 (0.000461%)
CCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGC4 (0.000263%)
CCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGA11 (0.000724%)
CCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGC8 (0.000526%)
CCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACA14 (0.000921%)
CCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGC27 (0.001777%)
CCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTG3 (0.000197%)
CCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACAC4 (0.000263%)
CCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAG30 (0.001974%)
CCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAA4 (0.000263%)
CCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCCGGATCAGCCATGACCTCTCAGATTCGTCAGAA3 (0.000197%)
CCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGG4 (0.000263%)
CCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATA17 (0.001119%)
CCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGA33 (0.002172%)
CCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGC13 (0.000855%)
CCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTTGTGGAAAGTGCAGGCTTCCAGGAGTCGTGAGG3 (0.000197%)
CCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCT10 (0.000658%)
CCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCG4 (0.000263%)
CCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAA14 (0.000921%)
CCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTAC6 (0.000395%)
CCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGC11 (0.000724%)
CCCAAATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAG11 (0.000724%)
CCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAG21 (0.001382%)
CCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGT11 (0.000724%)
CCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTG103 (0.006778%)
CCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGA48 (0.003159%)
CCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACA13 (0.000855%)
CCCAATTCAGGTTAAGATAAGTAGGTTGGCTACTAGGATTCAGTACAAAATTTGTGTGATTGGGCGGAATATTAGGCTTCGTTGCTTTGAGGTATGAAGG17 (0.001119%)
CCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCAT215 (0.014148%)
CCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAA10 (0.000658%)
CCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTC3 (0.000197%)
CCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGC6 (0.000395%)
CCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGA20 (0.001316%)
CCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAG6 (0.000395%)
CCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGT22 (0.001448%)
CCCAGATCAAGTCTTCCTTGCCATTGTTTTTTCGAGCCACAACAGCATGAGAAGGGATCCGAGCCAGGTAGCAATCCTCATACTGATCCACTGGCTTGCG262 (0.017240%)
CCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCG10 (0.000658%)
CCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCC8 (0.000526%)
CCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACAAACCTGGGAGACTTTGCAA10 (0.000658%)
CCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCAT14 (0.000921%)
CCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAA4 (0.000263%)
CCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAA17 (0.001119%)
CCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAA3 (0.000197%)
CCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAG12 (0.000790%)
CCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAG3 (0.000197%)
CCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATG12 (0.000790%)
CCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCT10 (0.000658%)
CCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGAC33 (0.002172%)
CCCCAATTCAGGTTAAGATAAGTAGGTTGGCTACTAGGATTCAGTACAAAATTTGTGTGATTGGGCGGAATATTAGGCTTCGTTGCTTTGAGGTATGAAG195 (0.012832%)
CCCCACCCCGCTGGCAAACTGTTCTGTGAGGCAGCTGACTGAGCACGCGGTGGAGGGAGACTGTGACTTCCACATCCTGAAACAAGACGGCCAGTTCAGG9 (0.000592%)
CCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGG4 (0.000263%)
CCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACA9 (0.000592%)
CCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAA13 (0.000855%)
CCCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAAC5 (0.000329%)
CCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTAT3 (0.000197%)
CCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGC38 (0.002501%)
CCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTA30 (0.001974%)
CCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAG35 (0.002303%)
CCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACCCCAT8 (0.000526%)
CCCGTGGCGGCGGAGTTTTATGGATCAGTGGAACATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGC9 (0.000592%)
CCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCC4 (0.000263%)
CCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACA11 (0.000724%)
CCCTCCATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGG3 (0.000197%)
CCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCC3 (0.000197%)
CCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGA4 (0.000263%)
CCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGC10 (0.000658%)
CCCTGCTGTAGACGTGGCTGTAAAAGTGTTCAAAAAGACCTCTGAGGGATCCTGGGAGCCCTTTGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCAC8 (0.000526%)
CCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATT3 (0.000197%)
CCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATT10 (0.000658%)
CCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCC4 (0.000263%)
CCCTTCTCCACAAAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCA7 (0.000461%)
CCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGATCCAATAATTACATGGAGTCCATGGAATCCAG36 (0.002369%)
CCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGA10 (0.000658%)
CCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTT263 (0.017306%)
CCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCAC105 (0.006909%)
CCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCG47 (0.003093%)
CCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAG17 (0.001119%)
CCGAGAACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCC57 (0.003751%)
CCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAG12 (0.000790%)
CCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAA11 (0.000724%)
CCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCT9 (0.000592%)
CCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGA22 (0.001448%)
CCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACC6 (0.000395%)
CCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGAT28 (0.001842%)
CCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGT11 (0.000724%)
CCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTAC24 (0.001579%)
CCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAA9 (0.000592%)
CCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGA63 (0.004146%)
CCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTAC20 (0.001316%)
CCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACC334 (0.021978%)
CCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGC24 (0.001579%)
CCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACCCCATC10 (0.000658%)
CCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGT4 (0.000263%)
CCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGA192 (0.012634%)
CCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTT29 (0.001908%)
CCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGG5 (0.000329%)
CCGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGG165 (0.010858%)
CCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCT15 (0.000987%)
CCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTAC32 (0.002106%)
CCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGC7 (0.000461%)
CCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAA30 (0.001974%)
CCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGAC9 (0.000592%)
CCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGC9 (0.000592%)
CCGTGGCGGCGGAGTTTTATGGATCAGTGGAACATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCT4 (0.000263%)
CCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGT7 (0.000461%)
CCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTG11 (0.000724%)
CCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACA3 (0.000197%)
CCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTC5 (0.000329%)
CCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATT3 (0.000197%)
CCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCC5 (0.000329%)
CCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTAT5 (0.000329%)
CCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCA35 (0.002303%)
CCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAAACCCTCAACAGACCAGACAGTGAG9 (0.000592%)
CCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCA12 (0.000790%)
CCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGC7 (0.000461%)
CCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTG14 (0.000921%)
CCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTTTGATAA4 (0.000263%)
CCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCT4 (0.000263%)
CCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAA7 (0.000461%)
CCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTT9 (0.000877%)
CCTATACCGGGAGCTGGTCCATCAGTCCAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAG4 (0.000263%)
CCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCC12 (0.000790%)
CCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCA38 (0.002501%)
CCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTT5 (0.000329%)
CCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAG21 (0.001382%)
CCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACA33 (0.002172%)
CCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTC13 (0.000855%)
CCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTTGTGGA4 (0.000263%)
CCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTG11 (0.000724%)
CCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGC71 (0.004672%)
CCTCCATCTCATGGAGTCTGCTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGA3 (0.000197%)
CCTCCATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGA11 (0.000724%)
CCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATC35 (0.002303%)
CCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTG9 (0.000592%)
CCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTG4 (0.000263%)
CCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCG9 (0.000592%)
CCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAA16 (0.001053%)
CCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGC3 (0.000197%)
CCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGGTCATTGTTGAC5 (0.000329%)
CCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAA29 (0.001908%)
CCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGA8 (0.000526%)
CCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGC9 (0.000592%)
CCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCG5 (0.000329%)
CCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTC10 (0.000658%)
CCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCC4 (0.000263%)
CCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAA7 (0.000461%)
CCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAG3 (0.000197%)
CCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCA6 (0.000395%)
CCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACAT23 (0.001513%)
CCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCAT4 (0.000263%)
CCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTAT5 (0.000329%)
CCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCT129 (0.008489%)
CCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTA13 (0.000855%)
CCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCA3 (0.000197%)
CCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGA426 (0.028032%)
CCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCA28 (0.001842%)
CCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATG4 (0.000263%)
CCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTC8 (0.000526%)
CCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCCCAAATCATT3 (0.000197%)
CCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGA13 (0.000855%)
CCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAA5 (0.000329%)
CCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCT3 (0.000197%)
CCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGT3 (0.000197%)
CCTGCTGTAGACGTGGCTGTAAAAGTGTTCAAAAAGACCTCTGAGGGATCCTGGGAGCCCTTTGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCACG3 (0.000197%)
CCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTC77 (0.005067%)
CCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTG4 (0.000263%)
CCTGGACCTGGTCAGACAGCGTCTGCACCCAGCGCAGGTAATCCCAGAAGCGGTTCAGGGCCTGCTCCCAGGGTTGGTTGCTTTGCCACTCGAGCTGATC11 (0.000724%)
CCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACAT27 (0.001777%)
CCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGG4 (0.000263%)
CCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGT8 (0.000526%)
CCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTC66 (0.004343%)
CCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTT4 (0.000263%)
CCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTG19 (0.001250%)
CCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAG25 (0.001645%)
CCTGGGTCTGTGCGCAGGTGGAAGTTGACATTGAGGTTGTCCCCCGGCTTGAGCTCCATTCGTGACACTGACAAGTGTAGGTAGTTGTTGGAGTTGTGCA4 (0.000263%)
CCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACAAACCTGGGAGAC3 (0.000197%)
CCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTT12 (0.000790%)
CCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGT12 (0.000790%)
CCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAG32 (0.002106%)
CCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTG4 (0.000263%)
CCTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGT5 (0.000329%)
CCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACAAAC10 (0.000658%)
CCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTT6 (0.000395%)
CCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTT7 (0.000461%)
CCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTT15 (0.000987%)
CCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTA3 (0.000197%)
CCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCC6 (0.000395%)
CCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAG5 (0.000329%)
CCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGA49 (0.003224%)
CCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGC25 (0.001645%)
CCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCA7 (0.000461%)
CCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGA6 (0.000395%)
CCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGATGA3 (0.000197%)
CCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTA4 (0.000263%)
CCTTGACTTTTTCCCCAGTCATGGTCTCCAGTTCGCACTCCTCCCCCAGGGTGAACTCATTGCGGACCACTTTGGGTCCATAGGTGATGGTGAGTTTGAT3 (0.000197%)
CCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGC5 (0.000329%)
CCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCA74 (0.004869%)
CCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACT5 (0.000329%)
CCTTGGCCTGGCTCTGAATCTCTGAGGTCTTGGCCTTCTCCATCAAATCTTTGCCATAATCAGTCATGCTCTGAAAGTATTGAGTGAACAGGCTCTGCAT6 (0.000395%)
CCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAG3 (0.000197%)
CCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAAC27 (0.001777%)
CCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAA9 (0.000592%)
CCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGA4 (0.000263%)
CCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGAC4 (0.000263%)
CCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAG4 (0.000263%)
CCTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTT102 (0.006712%)
CCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACT5 (0.000329%)
CCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAAT6 (0.000395%)
CGAACATGAACCCTAATAATTGTTTCCCTAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTAT159 (0.010463%)
CGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAA3 (0.000197%)
CGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACC11 (0.000724%)
CGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAG160 (0.010529%)
CGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGATCCAATAATTACATGGAGTCCATGGAATCCAGT9 (0.000592%)
CGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCA5 (0.000329%)
CGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGAT6 (0.000395%)
CGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAG3 (0.000197%)
CGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTA3 (0.000197%)
CGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACA28 (0.001842%)
CGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCT25 (0.001645%)
CGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCT165 (0.010858%)
CGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGC20 (0.001316%)
CGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGC4 (0.000263%)
CGACTGCCTTGACTTTTTCCCCAGTCATGGTCTCCAGTTCGCACTCCTCCCCCAGGGTGAACTCATTGCGGACCACTTTGGGTCCATAGGTGATGGTGAG224 (0.014740%)
CGAGAACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCA49 (0.003224%)
CGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGA21 (0.001382%)
CGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGC51 (0.003356%)
CGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGA47 (0.003093%)
CGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAA29 (0.001908%)
CGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTG18 (0.001184%)
CGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCA34 (0.002237%)
CGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGAC12 (0.000790%)
CGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCC3 (0.000197%)
CGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAG6 (0.000395%)
CGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGAC54 (0.003553%)
CGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAG8 (0.000526%)
CGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACAC9 (0.000592%)
CGATGTCAAGGGATGAGTTGGATAAAACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTT30 (0.001974%)
CGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCA46 (0.003027%)
CGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGC7 (0.000461%)
CGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATG6 (0.000395%)
CGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATAC16 (0.001053%)
CGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATT19 (0.001250%)
CGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGG476 (0.031322%)
CGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGG54 (0.003553%)
CGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGC19 (0.001250%)
CGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCT32 (0.002106%)
CGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAAACCCTCAACAGACCAGA26 (0.001711%)
CGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAA40 (0.002632%)
CGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATG21 (0.001382%)
CGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTC16 (0.001053%)
CGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGAGTCGGTTGCGTAGATCCT5 (0.000329%)
CGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACT6 (0.000395%)
CGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAAC7 (0.000461%)
CGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGAGTCGGTTGC4 (0.000263%)
CGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAA19 (0.001250%)
CGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTG18 (0.001184%)
CGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACA47 (0.003093%)
CGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTAC16 (0.001053%)
CGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCC85 (0.005593%)
CGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAG6 (0.000395%)
CGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCA18 (0.001184%)
CGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCA10 (0.000658%)
CGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCC9 (0.000592%)
CGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCT17 (0.001119%)
CGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTA28 (0.001842%)
CGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGC8 (0.000526%)
CGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGC9 (0.000592%)
CGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCG27 (0.001777%)
CGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTG3 (0.000197%)
CGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATAC6 (0.000395%)
CGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCT4 (0.000263%)
CGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTA4 (0.000263%)
CGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGAT260 (0.017109%)
CGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCG27 (0.001777%)
CGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCAC22 (0.001448%)
CGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCG25 (0.001645%)
CGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGACTCTCTGCGCACACAGCT7 (0.000461%)
CGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGACTCTCTGCGCACACAG6 (0.000395%)
CGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCG22 (0.001448%)
CGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGC4 (0.000263%)
CGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAG11 (0.000724%)
CGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGC3 (0.000197%)
CGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTT7 (0.000461%)
CGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAG11 (0.000724%)
CGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGC3 (0.000197%)
CGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGG4 (0.000263%)
CGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCA28 (0.001842%)
CGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGAGTC7 (0.000461%)
CGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACC584 (0.038429%)
CGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAG46 (0.003027%)
CGGAAGAGCACACGTCTGAACTCCAGTCACAACTTCCGTC10 (0.000263%)
CGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGC43 (0.002830%)
CGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTT34 (0.002237%)
CGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCAT15 (0.000987%)
CGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGC9 (0.000592%)
CGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGT39 (0.002566%)
CGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAA11 (0.000724%)
CGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTC14 (0.000921%)
CGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGT17 (0.001119%)
CGGAGTTTTATGGATCAGTGGAACATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAA14 (0.000921%)
CGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGC51 (0.003356%)
CGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCC24 (0.001579%)
CGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGAC237 (0.015595%)
CGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGG22 (0.001448%)
CGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTC107 (0.007041%)
CGGCACTGATGGAGGACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGG63 (0.004146%)
CGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAA28 (0.001842%)
CGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTT46 (0.003027%)
CGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAG123 (0.008094%)
CGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCG13 (0.000855%)
CGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGA81 (0.005330%)
CGGCGGAGTTTTATGGATCAGTGGAACATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGG6 (0.000395%)
CGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGG562 (0.036981%)
CGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTA36 (0.002369%)
CGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAA227 (0.014937%)
CGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGATCCAATAATTACATGGAGTCC7 (0.000461%)
CGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAG36 (0.002369%)
CGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCCGGATCAGCCATGACCTCTCAGATTCGT4 (0.000263%)
CGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAAT43 (0.002830%)
CGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTG15 (0.000987%)
CGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGG8 (0.000526%)
CGGGCCTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTT71 (0.004672%)
CGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTT61 (0.004014%)
CGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAA28 (0.001842%)
CGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAG3 (0.000197%)
CGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGC11 (0.000724%)
CGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTA7 (0.000461%)
CGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTT5 (0.000329%)
CGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACA14 (0.000921%)
CGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGAT4 (0.000263%)
CGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCT6 (0.000395%)
CGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAG6 (0.000395%)
CGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTC9 (0.000592%)
CGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAAC3 (0.000197%)
CGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATAC6 (0.000395%)
CGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAA7 (0.000461%)
CGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAA6 (0.000395%)
CGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGC7 (0.000461%)
CGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTG5 (0.000329%)
CGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATC78 (0.005133%)
CGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCAC3 (0.000197%)
CGTGAAGCACGATGTCAAGGGATGAGTTGGATAAAACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGG11 (0.000724%)
CGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTG8 (0.000526%)
CGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCC19 (0.001250%)
CGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCC5 (0.000329%)
CGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATC9 (0.000592%)
CGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTG12 (0.000790%)
CGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGA34 (0.002237%)
CGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAATAATTATGTATATTGAGTATATACCTGTAATAATAATGT6 (0.000395%)
CGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGC34 (0.002237%)
CGTTGCCACCATGAACTTCTCCGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAG10 (0.000658%)
CGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGT8 (0.000526%)
CTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAA14 (0.000921%)
CTAAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCT21 (0.001382%)
CTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAAT13 (0.000855%)
CTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGATGACGAG20 (0.001316%)
CTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAG5 (0.000329%)
CTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGA13 (0.000855%)
CTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCA26 (0.001711%)
CTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTT37 (0.002435%)
CTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCG22 (0.001448%)
CTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAA86 (0.005659%)
CTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATA7 (0.000461%)
CTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAAG5 (0.000329%)
CTAATCTAGCTCTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATTCTTATAGGAAT9 (0.000592%)
CTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGGTTCTACAT5 (0.000329%)
CTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCCCAAATCATTATACCG5 (0.000329%)
CTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGT8 (0.000526%)
CTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTC5 (0.000329%)
CTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGAT15 (0.000987%)
CTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTC11 (0.000724%)
CTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGG27 (0.001777%)
CTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCC7 (0.000461%)
CTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATTCTTATAGGAATTAACATTATTA65 (0.004277%)
CTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATT6 (0.000395%)
CTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAG3 (0.000197%)
CTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGA42 (0.002764%)
CTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTT7 (0.000461%)
CTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAG5 (0.000329%)
CTACTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGGTTCTA3 (0.000197%)
CTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTCCGATTAT5 (0.000329%)
CTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGAT6 (0.000395%)
CTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACC66 (0.004343%)
CTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCC4 (0.000263%)
CTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTC151 (0.009936%)
CTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGATTAGGTGTATTAA15 (0.000987%)
CTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAAACCCTCAACAGACCAGACAGTGAGC9 (0.000592%)
CTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCAC14 (0.000921%)
CTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTA15 (0.000987%)
CTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCA8 (0.000526%)
CTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGC4 (0.000263%)
CTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGGTTCTACATTCTTCATGGCTACTG4 (0.000263%)
CTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTTTGATAAT6 (0.000395%)
CTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGA55 (0.003619%)
CTAGGATTCAGTACAAAATTTGTGTGATTGGGCGGAATATTAGGCTTCGTTGCTTTGAGGTATGAAGGAAAGGTATTAGGGCTAAAATTAGGATAGATAA15 (0.000987%)
CTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCC15 (0.000987%)
CTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGC16 (0.001053%)
CTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTAC18 (0.001184%)
CTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTT3 (0.000197%)
CTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAG10 (0.000658%)
CTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTTCACAG3 (0.000197%)
CTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCT80 (0.005264%)
CTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTC32 (0.002106%)
CTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTT8 (0.000526%)
CTATACCGGGAGCTGGTCCATCAGTCCAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGG9 (0.000592%)
CTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACC20 (0.001316%)
CTATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGT4 (0.000263%)
CTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAAGTTGAAACCATTTGAACTATTCTACCAGCTGTAATC6 (0.000395%)
CTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGT6 (0.000395%)
CTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCC14 (0.000921%)
CTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCC14 (0.000921%)
CTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGG15 (0.000987%)
CTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGC9 (0.000592%)
CTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTCAGAC6 (0.000395%)
CTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTT32 (0.002106%)
CTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCA14 (0.000921%)
CTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAG43 (0.002830%)
CTATGGCCGAGAACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCC7 (0.000461%)
CTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAA23 (0.001513%)
CTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCT3 (0.000197%)
CTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAA271 (0.017833%)
CTATTAGTGTTAGTTCTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAATAATTATGTATATTGAGTATAT3 (0.000197%)
CTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAAC5 (0.000329%)
CTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTCCGATTATTAG4 (0.000263%)
CTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCA3 (0.000197%)
CTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTAT4 (0.000263%)
CTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAG13 (0.000855%)
CTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTCC8 (0.000526%)
CTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACCCCATCATCA8 (0.000526%)
CTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTTG6 (0.000395%)
CTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGAC17 (0.001119%)
CTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGC7 (0.000461%)
CTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGT10 (0.000658%)
CTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTA47 (0.003093%)
CTCACTCTTACCACCTGTGGTGGACACCACACAAGGCAAAGTCCTGGGGAAGTATATCAGCTTAGAAGGATTTGAACAGCCTGTGGCCGTCTTCCTGGGA8 (0.000526%)
CTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAAC25 (0.001645%)
CTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTG41 (0.002698%)
CTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCT56 (0.003685%)
CTCAGCAACAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACA29 (0.001908%)
CTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAG8 (0.000526%)
CTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAG12 (0.000790%)
CTCAGCCAGGCGCTGGGCCAGGCTCTCGCGCATCTGTTCGCTGTGGGGCGCTAGCTGTGTGCGCAGAGAGTCTACGTGTGTGCGCATGCGGTCGCGAAAT22 (0.001448%)
CTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCA115 (0.007567%)
CTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACA161 (0.010594%)
CTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTCCTCACATAGTTGTGC7 (0.000461%)
CTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTTGTGGAA12 (0.000790%)
CTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTC178 (0.011713%)
CTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGT63 (0.004146%)
CTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCC17 (0.001119%)
CTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCT7 (0.000461%)
CTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATC38 (0.002501%)
CTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACA54 (0.003553%)
CTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCC93 (0.006120%)
CTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACT25 (0.001645%)
CTCATGGAGTCTGCTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCC3 (0.000197%)
CTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCATGGTTCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCC282 (0.018557%)
CTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCC8 (0.000526%)
CTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAA21 (0.001382%)
CTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTAT11 (0.000724%)
CTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTC10 (0.000658%)
CTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGG9 (0.000592%)
CTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATG3 (0.000197%)
CTCCAAGACGGTCCAGGATGCGCTAAGTAGCGTGCAGGAGTCCGATATAGCTGTGGTGGCCAGGGGCTGGATGGACAATCACTTCAGATCCCTGAAAGGC8 (0.000526%)
CTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGG43 (0.002830%)
CTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTG153 (0.010068%)
CTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCAT68 (0.004475%)
CTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCC36 (0.002369%)
CTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCC12 (0.000790%)
CTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGC33 (0.002172%)
CTCCATCTCATGGAGTCTGCTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGAT5 (0.000329%)
CTCCATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGAT24 (0.001579%)
CTCCATGAAGCTTCATAGGAGCAACAATACTAATAATCGCACATGGCCTCACATCATCACTCCTATTCTGCCTAGCAAACTCCAACTACGAACGGATCCA10 (0.000658%)
CTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCG11 (0.000724%)
CTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACA3 (0.000197%)
CTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGG50 (0.003290%)
CTCCCTCCATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAA12 (0.000790%)
CTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACT15 (0.000987%)
CTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTAT4 (0.000263%)
CTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGC24 (0.001579%)
CTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGC11 (0.000724%)
CTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAG6 (0.000395%)
CTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGA24 (0.001579%)
CTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAG61 (0.004014%)
CTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAAC49 (0.003224%)
CTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCC24 (0.001579%)
CTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAAC85 (0.005593%)
CTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGC8 (0.000526%)
CTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCT5 (0.000329%)
CTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGA47 (0.003093%)
CTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGAT6 (0.000395%)
CTCCTTCTCTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAG9 (0.000592%)
CTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTA8 (0.000526%)
CTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCT22 (0.001448%)
CTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCT55 (0.003619%)
CTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAAT17 (0.001119%)
CTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGC26 (0.001711%)
CTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGC37 (0.002435%)
CTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGC40 (0.002632%)
CTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGG76 (0.005001%)
CTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCG14 (0.000921%)
CTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCT12 (0.000790%)
CTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCT7 (0.000461%)
CTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCT75 (0.004935%)
CTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAA26 (0.001711%)
CTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAATAATTATGTATATTGAGTATATACCTGTAATAATAAT26 (0.001711%)
CTCGTTGCCACCATGAACTTCTCCGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCC233 (0.015332%)
CTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGT51 (0.003356%)
CTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTG3 (0.000197%)
CTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCA11 (0.000724%)
CTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAAGTTGAAACCATTTGAACTATTCTACCAGCTGTAA202 (0.013292%)
CTCTATGGCCGAGAACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTAT13 (0.000855%)
CTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGC33 (0.002172%)
CTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACT20 (0.001316%)
CTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGAT20 (0.001316%)
CTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAA335 (0.022044%)
CTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGGTCATTGTTGACAAAG12 (0.000790%)
CTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAA21 (0.001382%)
CTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGG30 (0.001974%)
CTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAA12 (0.000790%)
CTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAG77 (0.005067%)
CTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTC6 (0.000395%)
CTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAA10 (0.000658%)
CTCTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGC5 (0.000329%)
CTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGT14 (0.000921%)
CTCTGGCTTGCAGACTGGCACCTTCAACTGCGTATTAGTTCCTCGTACCCATCACCAGGGACTCCACAGTACTCTTTGCATTCCTTCTCAGAGTAGAATT4 (0.000263%)
CTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCAC8 (0.000526%)
CTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTGTATGT9 (0.000592%)
CTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTT23 (0.001513%)
CTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTG9 (0.000592%)
CTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTC25 (0.001645%)
CTCTTCCTGGACCTGGTCAGACAGCGTCTGCACCCAGCGCAGGTAATCCCAGAAGCGGTTCAGGGCCTGCTCCCAGGGTTGGTTGCTTTGCCACTCGAGC3 (0.000197%)
CTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATT28 (0.001842%)
CTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACAC6 (0.000395%)
CTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCA13 (0.000855%)
CTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATC3 (0.000197%)
CTCTTTGTCAACAATGACCTGAAGCTGGTGGAGAAGTTTCTGGAAGAGGCCAAGAACCATTATCAGGCAGAAGTCTTCTCTGTCAACTTTGCAGAGTCAG228 (0.015003%)
CTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATG16 (0.001053%)
CTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATC3 (0.000197%)
CTGAAAATGACTCCCTCCATCTCATGGAGTCTGCTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACA125 (0.008225%)
CTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTG159 (0.010463%)
CTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCA33 (0.002172%)
CTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTAC15 (0.000987%)
CTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTA35 (0.002303%)
CTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCT76 (0.005001%)
CTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGT4 (0.000263%)
CTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCT12 (0.000790%)
CTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTA65 (0.004277%)
CTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATC22 (0.001448%)
CTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGGTCATTGTTGACAAAGAG3 (0.000197%)
CTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGA43 (0.002830%)
CTGAGAAGCCCCCTCAAATTCATTCGACTAGGGTTGTTCCAATATATGGGATGGCTGATAGGAGGTTTGTAATAACTGTGGCACCTCAGAATGATATTTG4 (0.000263%)
CTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAG8 (0.000526%)
CTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCC87 (0.005725%)
CTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTC118 (0.007765%)
CTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGT26 (0.001711%)
CTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGG51 (0.003356%)
CTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGA60 (0.003948%)
CTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATA85 (0.005593%)
CTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGA33 (0.002172%)
CTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTGAGAAAAAAAGACATGAAG7 (0.000461%)
CTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGAC23 (0.001513%)
CTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACT78 (0.005133%)
CTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGT11 (0.000724%)
CTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGA47 (0.003093%)
CTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTG45 (0.002961%)
CTGATGGAGGACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAG5 (0.000329%)
CTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCAC15 (0.000987%)
CTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAGCAGCTGACACCCCT6 (0.000395%)
CTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGA24 (0.001579%)
CTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCT11 (0.000724%)
CTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGG25 (0.001645%)
CTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCG12 (0.000790%)
CTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATG131 (0.008620%)
CTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATA17 (0.001119%)
CTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACT12 (0.000790%)
CTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCC6 (0.000395%)
CTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGT769 (0.050603%)
CTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCCCAAATCATTA4 (0.000263%)
CTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTG13 (0.000855%)
CTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGACTCTC3 (0.000197%)
CTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTG9 (0.000592%)
CTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGG3 (0.000197%)
CTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAAACCCTCAACAGACCAGACAGTGAGCTGCAGCTGA14 (0.000921%)
CTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCC41 (0.002698%)
CTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAA10 (0.000658%)
CTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAA4 (0.000263%)
CTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCA40 (0.002632%)
CTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAG23 (0.001513%)
CTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATC10 (0.000658%)
CTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTG27 (0.001777%)
CTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCA10 (0.000658%)
CTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATT40 (0.002632%)
CTGCCTTGACTTTTTCCCCAGTCATGGTCTCCAGTTCGCACTCCTCCCCCAGGGTGAACTCATTGCGGACCACTTTGGGTCCATAGGTGATGGTGAGTTT3 (0.000197%)
CTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTC22 (0.001448%)
CTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTG67 (0.004409%)
CTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAG40 (0.002632%)
CTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGT3 (0.000197%)
CTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGAT44 (0.002895%)
CTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTA4 (0.000263%)
CTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGG638 (0.041983%)
CTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTC11 (0.000724%)
CTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCA49 (0.003224%)
CTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAG3 (0.000197%)
CTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTA8 (0.000526%)
CTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATG16 (0.001053%)
CTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGC9 (0.000592%)
CTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGA21 (0.001382%)
CTGCTGTAGACGTGGCTGTAAAAGTGTTCAAAAAGACCTCTGAGGGATCCTGGGAGCCCTTTGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCACGG7 (0.000461%)
CTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATA7 (0.000461%)
CTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTCC6 (0.000395%)
CTGCTTCTCCTTCTCTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCA10 (0.000658%)
CTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATG12 (0.000790%)
CTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCT4 (0.000263%)
CTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAA15 (0.000987%)
CTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGA27 (0.001777%)
CTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCG34 (0.002237%)
CTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGT102 (0.006712%)
CTGGACCTGGTCAGACAGCGTCTGCACCCAGCGCAGGTAATCCCAGAAGCGGTTCAGGGCCTGCTCCCAGGGTTGGTTGCTTTGCCACTCGAGCTGATCT9 (0.000592%)
CTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGC7 (0.000461%)
CTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTT18 (0.001184%)
CTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCT23 (0.001513%)
CTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATC17 (0.001119%)
CTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATAC7 (0.000461%)
CTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTCCTCACATA81 (0.005330%)
CTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTG17 (0.001119%)
CTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATC16 (0.001053%)
CTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCT14 (0.000921%)
CTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGC35 (0.002303%)
CTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGG54 (0.003553%)
CTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCG10 (0.000658%)
CTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTT17 (0.001119%)
CTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCC56 (0.003685%)
CTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTC35 (0.002303%)
CTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGC8 (0.000526%)
CTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATC10 (0.000658%)
CTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTTC6 (0.000395%)
CTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCT35 (0.002303%)
CTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGT8 (0.000526%)
CTGGCTTGCAGACTGGCACCTTCAACTGCGTATTAGTTCCTCGTACCCATCACCAGGGACTCCACAGTACTCTTTGCATTCCTTCTCAGAGTAGAATTTG7 (0.000461%)
CTGGGATGGCATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCAG37 (0.002435%)
CTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGT26 (0.001711%)
CTGGGCCAGGCTCTCGCGCATCTGTTCGCTGTGGGGCGCTAGCTGTGTGCGCAGAGAGTCTACGTGTGTGCGCATGCGGTCGCGAAATTCCTCAGCCACA58 (0.003817%)
CTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGAC46 (0.003027%)
CTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACAC3 (0.000197%)
CTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCA24 (0.001579%)
CTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCC22 (0.001448%)
CTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTG11 (0.000724%)
CTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGC25 (0.001645%)
CTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGA16 (0.001053%)
CTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTT70 (0.004606%)
CTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTG39 (0.002566%)
CTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATA5 (0.000329%)
CTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGAC6 (0.000395%)
CTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAG4 (0.000263%)
CTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACA39 (0.002566%)
CTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTG20 (0.001316%)
CTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACAAACCTGGGAGACT31 (0.002040%)
CTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTA75 (0.004935%)
CTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGT158 (0.010397%)
CTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTGTATGTGG11 (0.000724%)
CTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTC13 (0.000855%)
CTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTT72 (0.004738%)
CTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTAC5 (0.000329%)
CTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATG4 (0.000263%)
CTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAA5 (0.000329%)
CTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGC40 (0.002632%)
CTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGG10 (0.000658%)
CTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGG22 (0.001448%)
CTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATG16 (0.001053%)
CTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGC10 (0.000658%)
CTGTCTCATCGATGGTCAGCACAGCCTTATGCACAGCCTTGCTGAGCTTCAGGGGAGCATTCTCCTCTGTGATTCCAGAGAGGTCAGCCCCATTGTTGAA3 (0.000197%)
CTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGC15 (0.000987%)
CTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAG7 (0.000461%)
CTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAA14 (0.000921%)