fastp report
General
fastp version:0.23.1 (https://github.com/OpenGene/fastp)
sequencing:paired end (150 cycles + 150 cycles)
mean length before filtering:150bp, 150bp
mean length after filtering:143bp, 143bp
duplication rate:23.351446%
Insert size peak:263
Before filtering
total reads:41.284004 M
total bases:6.192601 G
Q20 bases:6.071929 G (98.051364%)
Q30 bases:5.856157 G (94.567003%)
GC content:49.811298%
After filtering
total reads:41.039208 M
total bases:5.893403 G
Q20 bases:5.804048 G (98.483828%)
Q30 bases:5.604985 G (95.106098%)
GC content:49.701469%
Filtering result
reads passed filters:41.039208 M (99.407044%)
reads with low quality:193.836000 K (0.469518%)
reads with too many N:27.410000 K (0.066394%)
reads too short:23.550000 K (0.057044%)
Adapter or bad ligation of read1
The input has little adapter percentage (~0.961975%), probably it's trimmed before.
SequenceOccurrences
A13513
AG16277
AGA17259
AGAT15872
AGATC15967
AGATCG16840
AGATCGG15035
AGATCGGA14245
AGATCGGAA13526
AGATCGGAAG13630
AGATCGGAAGA12868
AGATCGGAAGAG13693
AGATCGGAAGAGC13518
AGATCGGAAGAGCA14283
AGATCGGAAGAGCAC15113
AGATCGGAAGAGCACA14792
AGATCGGAAGAGCACAC12819
AGATCGGAAGAGCACACG12352
AGATCGGAAGAGCACACGT11663
AGATCGGAAGAGCACACGTC11647
AGATCGGAAGAGCACACGTCT11822
AGATCGGAAGAGCACACGTCTG12380
AGATCGGAAGAGCACACGTCTGA12648
AGATCGGAAGAGCACACGTCTGAA12512
AGATCGGAAGAGCACACGTCTGAAC12749
AGATCGGAAGAGCACACGTCTGAACT11899
AGATCGGAAGAGCACACGTCTGAACTC11854
AGATCGGAAGAGCACACGTCTGAACTCC11300
AGATCGGAAGAGCACACGTCTGAACTCCA10417
AGATCGGAAGAGCACACGTCTGAACTCCAG10135
AGATCGGAAGAGCACACGTCTGAACTCCAGT9909
AGATCGGAAGAGCACACGTCTGAACTCCAGTC10572
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA10997
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC11785
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACC10717
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCG10614
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGT9724
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTG10462
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGT11667
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGTC10252
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGTCA9256
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGTCAAT11613
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGTCAATG10192
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGTCAATGA34057
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGTCAATGAT11587
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGTCAATGATCTCGTATGCCG9724
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGTCAATGATCTCGTATGCCGTCTTCTGCTTGAAAA11087
other adapter sequences273267
Adapter or bad ligation of read2
SequenceOccurrences
A16326
AG15955
AGA16722
AGAT15740
AGATC16040
AGATCG19327
AGATCGG15099
AGATCGGA14621
AGATCGGAA12690
AGATCGGAAG12924
AGATCGGAAGA12696
AGATCGGAAGAG15521
AGATCGGAAGAGC13872
AGATCGGAAGAGCG14361
AGATCGGAAGAGCGT18359
AGATCGGAAGAGCGTC13095
AGATCGGAAGAGCGTCG17467
AGATCGGAAGAGCGTCGT12981
AGATCGGAAGAGCGTCGTG11451
AGATCGGAAGAGCGTCGTGT9266
AGATCGGAAGAGCGTCGTGTA9445
AGATCGGAAGAGCGTCGTGTAG11888
AGATCGGAAGAGCGTCGTGTAGG17343
AGATCGGAAGAGCGTCGTGTAGGG14071
AGATCGGAAGAGCGTCGTGTAGGGA12466
AGATCGGAAGAGCGTCGTGTAGGGAA9652
AGATCGGAAGAGCGTCGTGTAGGGAAAGA9560
AGATCGGAAGAGCGTCGTGTAGGGAAAGAG11248
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGT10011
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG11828
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT10176
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTT12435
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTC10696
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCG11438
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCGA9247
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCGAC9336
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCGACTTCAGGTG10381
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCGACTTCAGGTGT9100
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCGACTTCAGGTGTAGATCTCGGT10101
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCGACTTCAGGTGTAGATCTCGGTGGTCGC12640
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCGACTTCAGGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAA13888
other adapter sequences361576
This estimation is based on paired-end overlap analysis, and there are 59.900742% reads found not overlapped.
The nonoverlapped read pairs may have insert size <30 or >270, or contain too much sequencing errors to be detected as overlapped.
Value of each position will be shown on mouse over.
Value of each position will be shown on mouse over.
Darker background means larger counts. The count will be shown on mouse over.
AAATACAGTATTTCTGCACTCCCGGAGTGCGG
AAAAAAAAAAAATAAAACAAAAGAAATAAAATTAAATCAAATGAAACAAAACTAAACCAAACGAAAGAAAAGTAAAGCAAAGG
AATAATAAAATATAATACAATAGAATTAAATTTAATTCAATTGAATCAAATCTAATCCAATCGAATGAAATGTAATGCAATGG
AACAACAAAACATAACACAACAGAACTAAACTTAACTCAACTGAACCAAACCTAACCCAACCGAACGAAACGTAACGCAACGG
AAGAAGAAAAGATAAGACAAGAGAAGTAAAGTTAAGTCAAGTGAAGCAAAGCTAAGCCAAGCGAAGGAAAGGTAAGGCAAGGG
ATAATAAAATAATATAACATAAGATATAATATTATATCATATGATACAATACTATACCATACGATAGAATAGTATAGCATAGG
ATTATTAAATTATATTACATTAGATTTAATTTTATTTCATTTGATTCAATTCTATTCCATTCGATTGAATTGTATTGCATTGG
ATCATCAAATCATATCACATCAGATCTAATCTTATCTCATCTGATCCAATCCTATCCCATCCGATCGAATCGTATCGCATCGG
ATGATGAAATGATATGACATGAGATGTAATGTTATGTCATGTGATGCAATGCTATGCCATGCGATGGAATGGTATGGCATGGG
ACAACAAAACAATACAACACAAGACATAACATTACATCACATGACACAACACTACACCACACGACAGAACAGTACAGCACAGG
ACTACTAAACTATACTACACTAGACTTAACTTTACTTCACTTGACTCAACTCTACTCCACTCGACTGAACTGTACTGCACTGG
ACCACCAAACCATACCACACCAGACCTAACCTTACCTCACCTGACCCAACCCTACCCCACCCGACCGAACCGTACCGCACCGG
ACGACGAAACGATACGACACGAGACGTAACGTTACGTCACGTGACGCAACGCTACGCCACGCGACGGAACGGTACGGCACGGG
AGAAGAAAAGAATAGAACAGAAGAGATAAGATTAGATCAGATGAGACAAGACTAGACCAGACGAGAGAAGAGTAGAGCAGAGG
AGTAGTAAAGTATAGTACAGTAGAGTTAAGTTTAGTTCAGTTGAGTCAAGTCTAGTCCAGTCGAGTGAAGTGTAGTGCAGTGG
AGCAGCAAAGCATAGCACAGCAGAGCTAAGCTTAGCTCAGCTGAGCCAAGCCTAGCCCAGCCGAGCGAAGCGTAGCGCAGCGG
AGGAGGAAAGGATAGGACAGGAGAGGTAAGGTTAGGTCAGGTGAGGCAAGGCTAGGCCAGGCGAGGGAAGGGTAGGGCAGGGG
TAATAAAATAAATTAAACTAAAGTAATATAATTTAATCTAATGTAACATAACTTAACCTAACGTAAGATAAGTTAAGCTAAGG
TATTATAATATATTATACTATAGTATTATATTTTATTCTATTGTATCATATCTTATCCTATCGTATGATATGTTATGCTATGG
TACTACAATACATTACACTACAGTACTATACTTTACTCTACTGTACCATACCTTACCCTACCGTACGATACGTTACGCTACGG
TAGTAGAATAGATTAGACTAGAGTAGTATAGTTTAGTCTAGTGTAGCATAGCTTAGCCTAGCGTAGGATAGGTTAGGCTAGGG
TTATTAAATTAATTTAACTTAAGTTATATTATTTTATCTTATGTTACATTACTTTACCTTACGTTAGATTAGTTTAGCTTAGG
TTTTTTAATTTATTTTACTTTAGTTTTATTTTTTTTTCTTTTGTTTCATTTCTTTTCCTTTCGTTTGATTTGTTTTGCTTTGG
TTCTTCAATTCATTTCACTTCAGTTCTATTCTTTTCTCTTCTGTTCCATTCCTTTCCCTTCCGTTCGATTCGTTTCGCTTCGG
TTGTTGAATTGATTTGACTTGAGTTGTATTGTTTTGTCTTGTGTTGCATTGCTTTGCCTTGCGTTGGATTGGTTTGGCTTGGG
TCATCAAATCAATTCAACTCAAGTCATATCATTTCATCTCATGTCACATCACTTCACCTCACGTCAGATCAGTTCAGCTCAGG
TCTTCTAATCTATTCTACTCTAGTCTTATCTTTTCTTCTCTTGTCTCATCTCTTCTCCTCTCGTCTGATCTGTTCTGCTCTGG
TCCTCCAATCCATTCCACTCCAGTCCTATCCTTTCCTCTCCTGTCCCATCCCTTCCCCTCCCGTCCGATCCGTTCCGCTCCGG
TCGTCGAATCGATTCGACTCGAGTCGTATCGTTTCGTCTCGTGTCGCATCGCTTCGCCTCGCGTCGGATCGGTTCGGCTCGGG
TGATGAAATGAATTGAACTGAAGTGATATGATTTGATCTGATGTGACATGACTTGACCTGACGTGAGATGAGTTGAGCTGAGG
TGTTGTAATGTATTGTACTGTAGTGTTATGTTTTGTTCTGTTGTGTCATGTCTTGTCCTGTCGTGTGATGTGTTGTGCTGTGG
TGCTGCAATGCATTGCACTGCAGTGCTATGCTTTGCTCTGCTGTGCCATGCCTTGCCCTGCCGTGCGATGCGTTGCGCTGCGG
TGGTGGAATGGATTGGACTGGAGTGGTATGGTTTGGTCTGGTGTGGCATGGCTTGGCCTGGCGTGGGATGGGTTGGGCTGGGG
CAACAAAACAAATCAAACCAAAGCAATACAATTCAATCCAATGCAACACAACTCAACCCAACGCAAGACAAGTCAAGCCAAGG
CATCATAACATATCATACCATAGCATTACATTTCATTCCATTGCATCACATCTCATCCCATCGCATGACATGTCATGCCATGG
CACCACAACACATCACACCACAGCACTACACTTCACTCCACTGCACCACACCTCACCCCACCGCACGACACGTCACGCCACGG
CAGCAGAACAGATCAGACCAGAGCAGTACAGTTCAGTCCAGTGCAGCACAGCTCAGCCCAGCGCAGGACAGGTCAGGCCAGGG
CTACTAAACTAATCTAACCTAAGCTATACTATTCTATCCTATGCTACACTACTCTACCCTACGCTAGACTAGTCTAGCCTAGG
CTTCTTAACTTATCTTACCTTAGCTTTACTTTTCTTTCCTTTGCTTCACTTCTCTTCCCTTCGCTTGACTTGTCTTGCCTTGG
CTCCTCAACTCATCTCACCTCAGCTCTACTCTTCTCTCCTCTGCTCCACTCCTCTCCCCTCCGCTCGACTCGTCTCGCCTCGG
CTGCTGAACTGATCTGACCTGAGCTGTACTGTTCTGTCCTGTGCTGCACTGCTCTGCCCTGCGCTGGACTGGTCTGGCCTGGG
CCACCAAACCAATCCAACCCAAGCCATACCATTCCATCCCATGCCACACCACTCCACCCCACGCCAGACCAGTCCAGCCCAGG
CCTCCTAACCTATCCTACCCTAGCCTTACCTTTCCTTCCCTTGCCTCACCTCTCCTCCCCTCGCCTGACCTGTCCTGCCCTGG
CCCCCCAACCCATCCCACCCCAGCCCTACCCTTCCCTCCCCTGCCCCACCCCTCCCCCCCCCGCCCGACCCGTCCCGCCCCGG
CCGCCGAACCGATCCGACCCGAGCCGTACCGTTCCGTCCCGTGCCGCACCGCTCCGCCCCGCGCCGGACCGGTCCGGCCCGGG
CGACGAAACGAATCGAACCGAAGCGATACGATTCGATCCGATGCGACACGACTCGACCCGACGCGAGACGAGTCGAGCCGAGG
CGTCGTAACGTATCGTACCGTAGCGTTACGTTTCGTTCCGTTGCGTCACGTCTCGTCCCGTCGCGTGACGTGTCGTGCCGTGG
CGCCGCAACGCATCGCACCGCAGCGCTACGCTTCGCTCCGCTGCGCCACGCCTCGCCCCGCCGCGCGACGCGTCGCGCCGCGG
CGGCGGAACGGATCGGACCGGAGCGGTACGGTTCGGTCCGGTGCGGCACGGCTCGGCCCGGCGCGGGACGGGTCGGGCCGGGG
GAAGAAAAGAAATGAAACGAAAGGAATAGAATTGAATCGAATGGAACAGAACTGAACCGAACGGAAGAGAAGTGAAGCGAAGG
GATGATAAGATATGATACGATAGGATTAGATTTGATTCGATTGGATCAGATCTGATCCGATCGGATGAGATGTGATGCGATGG
GACGACAAGACATGACACGACAGGACTAGACTTGACTCGACTGGACCAGACCTGACCCGACCGGACGAGACGTGACGCGACGG
GAGGAGAAGAGATGAGACGAGAGGAGTAGAGTTGAGTCGAGTGGAGCAGAGCTGAGCCGAGCGGAGGAGAGGTGAGGCGAGGG
GTAGTAAAGTAATGTAACGTAAGGTATAGTATTGTATCGTATGGTACAGTACTGTACCGTACGGTAGAGTAGTGTAGCGTAGG
GTTGTTAAGTTATGTTACGTTAGGTTTAGTTTTGTTTCGTTTGGTTCAGTTCTGTTCCGTTCGGTTGAGTTGTGTTGCGTTGG
GTCGTCAAGTCATGTCACGTCAGGTCTAGTCTTGTCTCGTCTGGTCCAGTCCTGTCCCGTCCGGTCGAGTCGTGTCGCGTCGG
GTGGTGAAGTGATGTGACGTGAGGTGTAGTGTTGTGTCGTGTGGTGCAGTGCTGTGCCGTGCGGTGGAGTGGTGTGGCGTGGG
GCAGCAAAGCAATGCAACGCAAGGCATAGCATTGCATCGCATGGCACAGCACTGCACCGCACGGCAGAGCAGTGCAGCGCAGG
GCTGCTAAGCTATGCTACGCTAGGCTTAGCTTTGCTTCGCTTGGCTCAGCTCTGCTCCGCTCGGCTGAGCTGTGCTGCGCTGG
GCCGCCAAGCCATGCCACGCCAGGCCTAGCCTTGCCTCGCCTGGCCCAGCCCTGCCCCGCCCGGCCGAGCCGTGCCGCGCCGG
GCGGCGAAGCGATGCGACGCGAGGCGTAGCGTTGCGTCGCGTGGCGCAGCGCTGCGCCGCGCGGCGGAGCGGTGCGGCGCGGG
GGAGGAAAGGAATGGAACGGAAGGGATAGGATTGGATCGGATGGGACAGGACTGGACCGGACGGGAGAGGAGTGGAGCGGAGG
GGTGGTAAGGTATGGTACGGTAGGGTTAGGTTTGGTTCGGTTGGGTCAGGTCTGGTCCGGTCGGGTGAGGTGTGGTGCGGTGG
GGCGGCAAGGCATGGCACGGCAGGGCTAGGCTTGGCTCGGCTGGGCCAGGCCTGGCCCGGCCGGGCGAGGCGTGGCGCGGCGG
GGGGGGAAGGGATGGGACGGGAGGGGTAGGGTTGGGTCGGGTGGGGCAGGGCTGGGCCGGGCGGGGGAGGGGTGGGGCGGGGG
Sampling rate: 1 / 20
overrepresented sequencecount (% of bases)distribution: cycle 1 ~ cycle 150
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA206 (0.005322%)
AAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCA44 (0.002842%)
AAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATG99 (0.006395%)
AAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTC451 (0.029132%)
AAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAA17 (0.001098%)
AAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAA20 (0.001292%)
AAAACGCCTAATCAACAACCGTCTCCATTCTTTCCAACACTGACTAGTTAAACTTATTATCAAACAAATAATGCTAATCCACACACCAAAAGGACGAACA19 (0.001227%)
AAAAGACTTCCAACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGG9 (0.000581%)
AAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGA64 (0.004134%)
AAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTT14 (0.001338%)
AAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGG26 (0.001679%)
AAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGG4 (0.000258%)
AAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTC42 (0.002713%)
AAAAGGCCCTAACATTGTTGGTCCATACGGCATTTTACAACCATTTGCAGACGCCATAAAATTATTTATAAAAGAACCAATACGCCCTTTAACAACCTCT3 (0.000194%)
AAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTAT25 (0.001615%)
AAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAA17 (0.001098%)
AAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTC34 (0.002196%)
AAAATCTTAGGGTACATACAACTACGAAAAGGCCCTAACATTGTTGGTCCATACGGCATTTTACAACCATTTGCAGACGCCATAAAATTATTTATAAAAG21 (0.001356%)
AAAATGACTCCCTCCATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCT42 (0.002713%)
AAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCATGGGCTAGATTTCCGGCTAGA5 (0.000323%)
AAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCA23 (0.001486%)
AAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATCCTAATCATATTCTTAATT15 (0.000969%)
AAACACCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATC270 (0.017440%)
AAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGC21 (0.001356%)
AAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAA13 (0.000840%)
AAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAAC8 (0.000517%)
AAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGG13 (0.000840%)
AAACTCTTCATTCTCCTAAGGTGGGCCAGCCTGGTGCTGCTGGTCCAGTGTCCCCCATGTGCCCAGGGAGGATCAGACACTTCAAAATCTAGGCTTGATT5 (0.000323%)
AAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTC30 (0.001938%)
AAACTGGGACACTCTGGGTTCAACCGTTAGTCAGCTGCAGGAACGGCTGGGCCCATTGACTCGGGACTTCTGGGATAACCTGGAGAAAGAAACAGATTGG58 (0.003746%)
AAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTG17 (0.001098%)
AAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTG36 (0.002325%)
AAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAAC52 (0.003359%)
AAAGACTTCCAACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGGC4 (0.000258%)
AAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGG45 (0.002907%)
AAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATT39 (0.002519%)
AAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGAC13 (0.000840%)
AAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGC59 (0.003811%)
AAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGT16 (0.001033%)
AAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCC79 (0.005103%)
AAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACT20 (0.001292%)
AAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGA6 (0.000388%)
AAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGC3 (0.000194%)
AAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCA13 (0.000840%)
AAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACA35 (0.002261%)
AAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGA16 (0.001033%)
AAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGA4 (0.000258%)
AAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCT215 (0.013888%)
AAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTT19 (0.001227%)
AAAGGCCCTAACATTGTTGGTCCATACGGCATTTTACAACCATTTGCAGACGCCATAAAATTATTTATAAAAGAACCAATACGCCCTTTAACAACCTCTA7 (0.000452%)
AAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGT33 (0.002132%)
AAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACT19 (0.001227%)
AAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCA10 (0.000646%)
AAAGTCACAGAAATATTTTCCATTGTGTACATGGGTTCTTGGCTGTGTTTTTCCTTCTCCATCTCTATGAGGAGACAGTCAGTCACATCCCGGGGGCAGT3 (0.000194%)
AAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATT5 (0.000323%)
AAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGT9 (0.000581%)
AAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAAC14 (0.000904%)
AAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTT249 (0.016084%)
AAATACTTTGACACCGGTAGGAATTGCGATAATTATAGTGGCTGATGTAAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCT198 (0.012789%)
AAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTT62 (0.004005%)
AAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTA11 (0.000711%)
AAATCAAAAGACTTCCAACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACT3 (0.000194%)
AAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCT15 (0.000969%)
AAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGATCAAAGAAA8 (0.000517%)
AAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAG3 (0.000194%)
AAATGACTCCCTCCATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTC31 (0.002002%)
AAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCC9 (0.000581%)
AAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTT10 (0.000646%)
AAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGA40 (0.002584%)
AAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCATGGGCTAGATTTCCGGCTAGAG3 (0.000194%)
AAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGACGAGTCCACCACGGTGAAGGTG4 (0.000258%)
AAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGT19 (0.001227%)
AAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTG14 (0.000904%)
AAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAG19 (0.001227%)
AAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGT4 (0.000258%)
AACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAA16 (0.001033%)
AACAAACGTAACCTCATATAGTTTTCTAATTAGTTTAACCAGCCTAACACTTCTATGACAAACCGACGAAAATTATAAAAACTTTTCAAATATATTCTCC6 (0.000388%)
AACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATT7 (0.000452%)
AACAACCGTCTCCATTCTTTCCAACACTGACTAGTTAAACTTATTATCAAACAAATAATGCTAATCCACACACCAAAAGGACGAACATGAACCCTAATAA3 (0.000194%)
AACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGG6 (0.000388%)
AACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAAC9 (0.000581%)
AACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACA4 (0.000258%)
AACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGG6 (0.000388%)
AACACCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCT4 (0.000258%)
AACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTCCTCA3 (0.000194%)
AACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGG344 (0.022220%)
AACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATT15 (0.000969%)
AACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCT5 (0.000323%)
AACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAAC14 (0.000904%)
AACAGATTGGGTGAGACAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGAT282 (0.018215%)
AACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATCCTAATCATATTCTTAATTCTCATAACC4 (0.000258%)
AACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCT16 (0.001033%)
AACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGA9 (0.000581%)
AACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGC21 (0.001356%)
AACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACT12 (0.000775%)
AACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATT13 (0.000840%)
AACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGA4 (0.000258%)
AACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATG16 (0.001033%)
AACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCA11 (0.000711%)
AACCGTCTCCATTCTTTCCAACACTGACTAGTTAAACTTATTATCAAACAAATAATGCTAATCCACACACCAAAAGGACGAACATGAACCCTAATAATTG3 (0.000194%)
AACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTC3 (0.000194%)
AACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTG3 (0.000194%)
AACCTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGAT43 (0.002778%)
AACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCG7 (0.000452%)
AACGCAAAATCTTAGGGTACATACAACTACGAAAAGGCCCTAACATTGTTGGTCCATACGGCATTTTACAACCATTTGCAGACGCCATAAAATTATTTAT3 (0.000194%)
AACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGG10 (0.000646%)
AACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTA3 (0.000194%)
AACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGAT4 (0.000258%)
AACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCA5 (0.000323%)
AACTGGGACACTCTGGGTTCAACCGTTAGTCAGCTGCAGGAACGGCTGGGCCCATTGACTCGGGACTTCTGGGATAACCTGGAGAAAGAAACAGATTGGG3 (0.000194%)
AACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACAC9 (0.000581%)
AACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGGCTGTACCTTGG3 (0.000194%)
AACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGT3 (0.000194%)
AACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAA5 (0.000323%)
AAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTG27 (0.001744%)
AAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGA12 (0.000775%)
AAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGC14 (0.000904%)
AAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGT37 (0.002390%)
AAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCA14 (0.000904%)
AAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTG22 (0.001421%)
AAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGG22 (0.001421%)
AAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCA34 (0.002196%)
AAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAA4 (0.000258%)
AAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGC69 (0.004457%)
AAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGA9 (0.000581%)
AAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCC30 (0.001938%)
AAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGC45 (0.002907%)
AAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCA18 (0.001163%)
AAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCC9 (0.000581%)
AAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACT8 (0.000517%)
AAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGA12 (0.000775%)
AAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACC8 (0.000517%)
AAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTA8 (0.000517%)
AAGACTTCCAACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGGCT16 (0.001033%)
AAGAGCACACGTCTGAACTCCAGTCACCGTGTCAATGATC8 (0.000207%)
AAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGC8 (0.000517%)
AAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCAT3 (0.000194%)
AAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGT22 (0.001421%)
AAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCTGTAGGAGTATGGGCTGAGCAGGGCTGCGATGGTGT5 (0.000323%)
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGT3806 (0.098337%)
AAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCT533 (0.034428%)
AAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTT9 (0.000581%)
AAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACA9 (0.000581%)
AAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTG6 (0.000388%)
AAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATG10 (0.000646%)
AAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCC52 (0.003359%)
AAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGT792 (0.051158%)
AAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCA8 (0.000517%)
AAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGA3 (0.000194%)
AAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTT16 (0.001033%)
AAGCCCTACTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGG7 (0.000452%)
AAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTG4 (0.000258%)
AAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTG5 (0.000323%)
AAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCA4 (0.000258%)
AAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAG17 (0.001098%)
AAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGACTCTCTGCGCACACAGCTAGCGCCCC3 (0.000194%)
AAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAG18 (0.001163%)
AAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCA5 (0.000323%)
AAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAA7 (0.000452%)
AAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTG50 (0.003230%)
AAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGC7 (0.000452%)
AAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTC3 (0.000194%)
AAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGC26 (0.001679%)
AAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCA32 (0.002067%)
AAGGATTCCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCC30 (0.001938%)
AAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAG197 (0.012725%)
AAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGC24 (0.001550%)
AAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTC5 (0.000323%)
AAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTG19 (0.001227%)
AAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTT27 (0.001744%)
AAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGT25 (0.001615%)
AAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTG9 (0.000581%)
AAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGAT5 (0.000323%)
AAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCAT12 (0.000775%)
AAGGGCCACCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTG261 (0.016859%)
AAGGGCTATTAGTGTTAGTTCTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAATAATTATGTATATTGAG3 (0.000194%)
AAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGA5 (0.000323%)
AAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGG7 (0.000452%)
AAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTG21 (0.002008%)
AAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCC4 (0.000258%)
AAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGT3 (0.000194%)
AAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAG4 (0.000258%)
AAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAG6 (0.000388%)
AAGTCACACACAGCATCAGGATCTGTTGGCCAATGAGGCTTTTCCCTCTGCTGTTTCCTCACGCTGGGGGAAAGGGGAAAGCTGGGATCTCTGCCCAGTC3 (0.000194%)
AAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCA48 (0.003100%)
AAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACT12 (0.000775%)
AAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCA16 (0.001033%)
AAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAG10 (0.000646%)
AAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAG8 (0.000517%)
AATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGGAGTAGTAAGTAACTACATGTGAAATA12 (0.000775%)
AATAATTCCAAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGA17 (0.001098%)
AATACTTTGACACCGGTAGGAATTGCGATAATTATAGTGGCTGATGTAAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTC18 (0.001163%)
AATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAA9 (0.000581%)
AATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTT3 (0.000194%)
AATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAA7 (0.000452%)
AATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTG4 (0.000258%)
AATATGCCTTGGTTCAAGGGATGGAAAGTCACCCGCAAAGATGGCAGTGCCAGTGGCACCACGCTGCTGGAAGCTTTGGATTGTATCCTACCACCAACTC61 (0.003940%)
AATCAACAACCGTCTCCATTCTTTCCAACACTGACTAGTTAAACTTATTATCAAACAAATAATGCTAATCCACACACCAAAAGGACGAACATGAACCCTA8 (0.000517%)
AATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTG5 (0.000323%)
AATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGT5 (0.000323%)
AATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGC8 (0.000517%)
AATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTC6 (0.000388%)
AATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAA8 (0.000517%)
AATGACTCCCTCCATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCC21 (0.001356%)
AATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGG17 (0.001098%)
AATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGG9 (0.000581%)
AATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCT5 (0.000323%)
AATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCAT16 (0.001033%)
AATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGACGAGTCCACCACGGTGAAGGTGCCCATGATGACCCTCTCGGGAAT3 (0.000194%)
AATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTG6 (0.000388%)
AATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTGTGATCT4 (0.000258%)
AATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAA4 (0.000258%)
AATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGGCCCAAGGAGGAGGATT3 (0.000194%)
AATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTT6 (0.000388%)
AATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTT4 (0.000258%)
AATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGC3 (0.000194%)
AATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAG11 (0.000711%)
AATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCATGGGCTAGATTTCCGGCTAGAGG14 (0.000904%)
AATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACA5 (0.000323%)
AATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAAT16 (0.001033%)
AATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTT21 (0.001356%)
AATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATA4 (0.000258%)
AATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGTCAGAAAT3 (0.000194%)
AATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGA3 (0.000194%)
AATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGT8 (0.000517%)
AATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTT73 (0.004715%)
AATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTAT12 (0.000775%)
ACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAG8 (0.000517%)
ACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCA4 (0.000258%)
ACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTA3 (0.000194%)
ACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGT10 (0.000646%)
ACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCA10 (0.000646%)
ACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTT5 (0.000323%)
ACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGA10 (0.000646%)
ACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGG3 (0.000194%)
ACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTT22 (0.001421%)
ACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGC3 (0.000194%)
ACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACT6 (0.000388%)
ACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGT6 (0.000388%)
ACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAG10 (0.000646%)
ACACACACACACACACACACACACACACACACACACACAC292 (0.007544%)
ACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTT3 (0.000194%)
ACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGC8 (0.000517%)
ACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCT3 (0.000194%)
ACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTG10 (0.000646%)
ACACCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTT4 (0.000258%)
ACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCA3 (0.000194%)
ACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTG9 (0.000581%)
ACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCT3 (0.000194%)
ACACTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCTCCAGCGCAGGTCTGGCTTTCTCGCCAAGTGTCTTCAGGT3 (0.000194%)
ACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAG4 (0.000258%)
ACAGAAGTCTCACGACTCAATAGCTGGAGTTGGTTGGTCCTCAGGGTTAGAATCCCAGAAGCCGGTGAACTTGTCAGTAAACTTGCTCCAGTAGCCTTTC3 (0.000194%)
ACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACC3 (0.000194%)
ACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTC4 (0.000258%)
ACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCA7 (0.000452%)
ACAGCGTAGTAGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGCCACGGGCTTCAGGTTGTTCGGAGTCAGGCCGGCATCGTACACCCAAC3 (0.000194%)
ACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATCCTAATCATAT3 (0.000194%)
ACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATA644 (0.041598%)
ACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTA4 (0.000258%)
ACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTG196 (0.012660%)
ACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAA11 (0.000711%)
ACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTC3 (0.000194%)
ACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCT4 (0.000258%)
ACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAA3 (0.000194%)
ACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAG5 (0.000323%)
ACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGACGAGTCCACCACGGTGAAGGTGCCCAT3 (0.000194%)
ACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCA4 (0.000258%)
ACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCT14 (0.000904%)
ACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCA3 (0.000194%)
ACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTC5 (0.000323%)
ACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCT31 (0.002002%)
ACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCC20 (0.001292%)
ACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGTCAGA3 (0.000194%)
ACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTA3 (0.000194%)
ACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTC10 (0.000646%)
ACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGG4 (0.000258%)
ACCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACT5 (0.000323%)
ACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCA20 (0.001292%)
ACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGA12 (0.000775%)
ACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATG4 (0.000258%)
ACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACT3 (0.000194%)
ACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACAT7 (0.000452%)
ACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGA12 (0.000775%)
ACCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTAT4 (0.000258%)
ACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCA5 (0.000323%)
ACCCCCTCCCCGCCCCCAGCTTCAGTGGTGGCTATGTCCTGTCTGCCAAAACCTTACTTCCCCGAATCAAGCCTAGATTTTGAAGTGTCTGATCCTCCCT6 (0.000388%)
ACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGG5 (0.000323%)
ACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAA19 (0.001227%)
ACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGA16 (0.001033%)
ACCGGTAGGAATTGCGATAATTATAGTGGCTGATGTAAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAG3 (0.000194%)
ACCGTCTCCATTCTTTCCAACACTGACTAGTTAAACTTATTATCAAACAAATAATGCTAATCCACACACCAAAAGGACGAACATGAACCCTAATAATTGT9 (0.000581%)
ACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCT22 (0.001421%)
ACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGT5 (0.000323%)
ACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGG9 (0.000581%)
ACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATG6 (0.000388%)
ACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAAT3 (0.000194%)
ACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCT14 (0.000904%)
ACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACC7 (0.000452%)
ACCTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATT7 (0.000452%)
ACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACA3 (0.000194%)
ACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGT20 (0.001292%)
ACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGA13 (0.000840%)
ACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATG12 (0.000775%)
ACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGG10 (0.000646%)
ACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCC3 (0.000194%)
ACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATT26 (0.001679%)
ACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTTGTGGAAAGTGCAGGCTTCCAGGAGTCGTGAGGTTGAGCACT30 (0.001938%)
ACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTG3 (0.000194%)
ACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCA10 (0.000646%)
ACGTAACCTCATATAGTTTTCTAATTAGTTTAACCAGCCTAACACTTCTATGACAAACCGACGAAAATTATAAAAACTTTTCAAATATATTCTCCTCAGA5 (0.000323%)
ACGTCTGAACTCCAGTCACCGTGTCAATGATCTCGTATGC6 (0.000155%)
ACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTT3 (0.000194%)
ACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCG5 (0.000323%)
ACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCC3 (0.000194%)
ACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGT5 (0.000323%)
ACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATT6 (0.000388%)
ACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAAC14 (0.000904%)
ACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAG7 (0.000452%)
ACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAA8 (0.000517%)
ACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGC6 (0.000388%)
ACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTC6 (0.000388%)
ACTCAAGCTTCTAAGTCACACACAGCATCAGGATCTGTTGGCCAATGAGGCTTTTCCCTCTGCTGTTTCCTCACGCTGGGGGAAAGGGGAAAGCTGGGAT45 (0.002907%)
ACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTG9 (0.000581%)
ACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAA15 (0.000969%)
ACTCCCTCCATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGA5 (0.000323%)
ACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTT4 (0.000258%)
ACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCA3 (0.000194%)
ACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCT11 (0.000711%)
ACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTC3 (0.000194%)
ACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCT1178 (0.076091%)
ACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCAT11 (0.000711%)
ACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGT9 (0.000581%)
ACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAA4 (0.000258%)
ACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCA8 (0.000517%)
ACTGGATCTGCACAGGGGACACAACTGCCCGAGAAGAAACTGGACACAGCTTTCTCAAGAGGACTGCGGGGCTCCGACAGCTTACAGAAGAGCAAGCCAA11 (0.000711%)
ACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACT3 (0.000194%)
ACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAA3 (0.000194%)
ACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTG4 (0.000258%)
ACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTC5 (0.000323%)
ACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGAT4 (0.000258%)
ACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGT18 (0.001163%)
ACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTG4 (0.000258%)
ACTTCCTCATGTTACCGACAGATTGCATGTACTCCGCTCCTAAGTATTTTTCAGGTGTGGTACCCTCTGGAAGTTTAACGAAACATTTGGTGTCATCCCT6 (0.000388%)
ACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGAC10 (0.000646%)
ACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTG6 (0.000388%)
ACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTA5 (0.000323%)
ACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTG4 (0.000258%)
ACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTC5 (0.000323%)
ACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTC5 (0.000323%)
ACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTG11 (0.000711%)
AGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGT28 (0.001809%)
AGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACT9 (0.000581%)
AGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAG28 (0.001809%)
AGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAA44 (0.002842%)
AGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCC9 (0.000581%)
AGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATC12 (0.000775%)
AGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTG68 (0.004392%)
AGAACGCAAAATCTTAGGGTACATACAACTACGAAAAGGCCCTAACATTGTTGGTCCATACGGCATTTTACAACCATTTGCAGACGCCATAAAATTATTT11 (0.000711%)
AGAACGCTCAGAAGAATCCTGCAAAGAAAAATACTTCCGAGACGATGAATAGAATTATACCATATCGTAGTCCTTTTTGTACAATAGGAGTGTGGTGGCC4 (0.000258%)
AGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCAT10 (0.000646%)
AGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTG11 (0.000711%)
AGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGT9 (0.000581%)
AGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGTCAGAAATCGTGCATGAAGGGAA6 (0.000388%)
AGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCAT52 (0.003359%)
AGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCT34 (0.002196%)
AGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGT23 (0.001486%)
AGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAA14 (0.000904%)
AGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGGAATGTTGATGATAGTAGTAGAGCTTCTATTATGAAGTTAGTTG151 (0.009754%)
AGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTTGTGGAAAGTGCAGGCTTCCAGGAGTC21 (0.001356%)
AGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGACTCTCTGCGCACACAGCTAGCGCC6 (0.000388%)
AGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCT13 (0.000840%)
AGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGT880 (0.056842%)
AGAAGTCTCACGACTCAATAGCTGGAGTTGGTTGGTCCTCAGGGTTAGAATCCCAGAAGCCGGTGAACTTGTCAGTAAACTTGCTCCAGTAGCCTTTCAG11 (0.000711%)
AGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGA14 (0.000904%)
AGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGG3 (0.000194%)
AGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAG10 (0.000646%)
AGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAA16 (0.001033%)
AGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCA10 (0.000646%)
AGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGATTAGGTGTATTAATA5 (0.000323%)
AGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGT13 (0.000840%)
AGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCT26 (0.001679%)
AGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACAAACCTGGGAGACTTTGCAATCAGCCTATACCGGGAGCTGGTCCATCAGTCC5 (0.000323%)
AGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAG5 (0.000323%)
AGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTT6 (0.000388%)
AGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCC20 (0.001292%)
AGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCC13 (0.000840%)
AGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCAC9 (0.000581%)
AGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGC37 (0.002390%)
AGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCC10 (0.000646%)
AGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAGGTC3 (0.000194%)
AGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAA48 (0.003100%)
AGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTCA3 (0.000194%)
AGACTATGTGTCCCAGTTTGAATCCTCCTCCTTGGGCCAACAGCTGAACCTGAATCTCCTGGAAAACTGGGACACTCTGGGTTCAACCGTTAGTCAGCTG5 (0.000323%)
AGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCA3 (0.000194%)
AGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTA25 (0.001615%)
AGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCT8 (0.000517%)
AGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAG10 (0.000646%)
AGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCG26 (0.001679%)
AGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTT6 (0.000388%)
AGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTC5 (0.000323%)
AGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGG16 (0.001033%)
AGAGACTATGTGTCCCAGTTTGAATCCTCCTCCTTGGGCCAACAGCTGAACCTGAATCTCCTGGAAAACTGGGACACTCTGGGTTCAACCGTTAGTCAGC4 (0.000258%)
AGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTG33 (0.002132%)
AGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAA6 (0.000388%)
AGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGT3 (0.000194%)
AGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGAT11 (0.000711%)
AGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAA3 (0.000194%)
AGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCA11 (0.000711%)
AGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCA9 (0.000581%)
AGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCAT5 (0.000323%)
AGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATG7 (0.000452%)
AGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCC3 (0.000194%)
AGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGG9 (0.000581%)
AGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGG6 (0.000388%)
AGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGG5 (0.000323%)
AGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCA6 (0.000388%)
AGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATG17 (0.001098%)
AGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTG25 (0.001615%)
AGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGT13 (0.000840%)
AGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGG36 (0.002325%)
AGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAG9 (0.000581%)
AGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCG21 (0.001356%)
AGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCTGTAGGAGTATGGGCTGAGCAGGGCTGCGATGGTGTA3 (0.000194%)
AGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAA5 (0.000323%)
AGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTG36 (0.002325%)
AGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTAC6 (0.000388%)
AGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAA6 (0.000388%)
AGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGC4 (0.000258%)
AGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCT4 (0.000258%)
AGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCT12 (0.000775%)
AGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCA38 (0.002455%)
AGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTG13 (0.000840%)
AGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGC8 (0.000517%)
AGCACACGTCTGAACTCCAGTCACCGTGTCAATGATCTCG6 (0.000155%)
AGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCT18 (0.001163%)
AGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGC8 (0.000517%)
AGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACA5 (0.000323%)
AGCACTTCCTCATGTTACCGACAGATTGCATGTACTCCGCTCCTAAGTATTTTTCAGGTGTGGTACCCTCTGGAAGTTTAACGAAACATTTGGTGTCATC9 (0.000581%)
AGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTG5 (0.000323%)
AGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATA4 (0.000258%)
AGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTA15 (0.000969%)
AGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTT14 (0.000904%)
AGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGAC17 (0.001098%)
AGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGG19 (0.001227%)
AGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGAC9 (0.000581%)
AGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGA8 (0.000517%)
AGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAG5 (0.000323%)
AGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGG4 (0.000258%)
AGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGG8 (0.000517%)
AGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGC10 (0.000646%)
AGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGG4 (0.000258%)
AGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAG4 (0.000258%)
AGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAG15 (0.000969%)
AGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTG16 (0.001033%)
AGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTGTATGTGGATGCGGTCAAAGACAGCG5 (0.000323%)
AGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCG26 (0.001679%)
AGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTA12 (0.000775%)
AGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTAT3 (0.000194%)
AGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATC3 (0.000194%)
AGCCCTACTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGGT3 (0.000194%)
AGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGT4 (0.000258%)
AGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCA15 (0.000969%)
AGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCA3 (0.000194%)
AGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGA9 (0.000581%)
AGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGC12 (0.000775%)
AGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGA3 (0.000194%)
AGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTA8 (0.000517%)
AGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAG4 (0.000258%)
AGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCA4 (0.000258%)
AGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATG4 (0.000258%)
AGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTG17 (0.001098%)
AGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAA3 (0.000194%)
AGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCT5 (0.000323%)
AGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCG7 (0.000452%)
AGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCA18 (0.001163%)
AGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCAT9 (0.000581%)
AGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGAC6 (0.000388%)
AGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAG9 (0.000581%)
AGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGA12 (0.000775%)
AGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCT9 (0.000581%)
AGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAAC17 (0.001098%)
AGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTA5 (0.000323%)
AGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAA19 (0.001227%)
AGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGG50 (0.003230%)
AGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCT7 (0.000452%)
AGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTG4 (0.000258%)
AGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCAT11 (0.000711%)
AGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACT9 (0.000581%)
AGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTT18 (0.001163%)
AGGAATTGCGATAATTATAGTGGCTGATGTAAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGA4 (0.000258%)
AGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCC6 (0.000388%)
AGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCG4 (0.000258%)
AGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACAAACCTGGGAGACTTTGCAATCAGCCTATACCGGGAGCTGGTCCA3 (0.000194%)
AGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCA6 (0.000388%)
AGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAA5 (0.000323%)
AGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGA9 (0.000581%)
AGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCAT12 (0.000775%)
AGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCG3 (0.000194%)
AGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCAC34 (0.002196%)
AGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACAAACCTGGGAGACTTTGCAATCAGCCTATACCGGGA4 (0.000258%)
AGGATTCCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCC4 (0.000258%)
AGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCA4 (0.000258%)
AGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATA8 (0.000517%)
AGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTC5 (0.000323%)
AGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCT19 (0.001227%)
AGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTT9 (0.000581%)
AGGCCACTGGATCTGCACAGGGGACACAACTGCCCGAGAAGAAACTGGACACAGCTTTCTCAAGAGGACTGCGGGGCTCCGACAGCTTACAGAAGAGCAA3 (0.000194%)
AGGCCATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGAC14 (0.000904%)
AGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACT14 (0.000904%)
AGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACG7 (0.000452%)
AGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAG12 (0.000775%)
AGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGT5 (0.000323%)
AGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGA5 (0.000323%)
AGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGC5 (0.000323%)
AGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGC7 (0.000452%)
AGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTC4 (0.000258%)
AGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAA3 (0.000194%)
AGGCTGGCCCACCTTAGGAGAATGAAGAGTTTCTCCCGAGGCCGACTCCACCGAGGCCACAGGAGAGAAGGCGTGGCGTAGGTCGTGGTAAGTTCGGTGG3 (0.000194%)
AGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGC3 (0.000194%)
AGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGA3 (0.000194%)
AGGGACCTGGCACATTACGTGGATGTCCTTGATGCTTCGAGGTGGCCCGCCAGGTGCTCAGGAGAACGTGGTCTTCAACTTCTCCTTCACTTTGCCAAAT3 (0.000194%)
AGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTGTATGTGGATGCGGTCAAAGAC4 (0.000258%)
AGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATT4 (0.000258%)
AGGGCCACCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGG5 (0.000323%)
AGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGT4 (0.000258%)
AGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCA3 (0.000194%)
AGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTT9 (0.000581%)
AGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATA6 (0.000388%)
AGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAG5 (0.000323%)
AGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGC5 (0.000323%)
AGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGG11 (0.000711%)
AGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGC3 (0.000194%)
AGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGA3 (0.000194%)
AGGTTATCCCAGAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCA3 (0.000194%)
AGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCG3 (0.000194%)
AGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGATTAGGTGTATTAATAAGTGTCCTG4 (0.000258%)
AGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCC9 (0.000581%)
AGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGT10 (0.000646%)
AGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGCCACGGGCTTCAGGTTGTTCGGAGTCAGGCCGGCATCGTACACCCAACCCCCATCCAA3 (0.000194%)
AGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTT3 (0.000194%)
AGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTG10 (0.000646%)
AGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGG3 (0.000194%)
AGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGC10 (0.000646%)
AGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGGCCCAAGGAGGAG3 (0.000194%)
AGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTC3 (0.000194%)
AGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGG6 (0.000388%)
AGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCT4 (0.000258%)
AGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATAT6 (0.000388%)
AGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAG11 (0.000711%)
AGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGG8 (0.000517%)
AGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAAT4 (0.000258%)
AGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACT3 (0.000194%)
AGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCAC5 (0.000323%)
AGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACT21 (0.001356%)
AGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAG3 (0.000194%)
AGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCA4 (0.000258%)
AGTGTCTGTGAAAGTGCCCACCATGTCTGCACACACTTCCCAGTTGCTCAGAAGACGGACTCGTCCCTTGGCTGTGGCGCTCATATGACCCTTCTCGTCC113 (0.007299%)
AGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAA7 (0.000452%)
AGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGG4 (0.000258%)
AGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTT3 (0.000194%)
AGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAA32 (0.002067%)
AGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAG4 (0.000258%)
AGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTG4 (0.000258%)
AGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGT6 (0.000388%)
AGTTTGTGTCGGAAGCCTGTAATTACGGCTCCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTA3 (0.000194%)
ATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCA16 (0.001033%)
ATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAA7 (0.000452%)
ATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGATTTAGTCGGCCTGGGATGGCATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGAC190 (0.012273%)
ATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAAT3 (0.000194%)
ATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCATGGGCTA4 (0.000258%)
ATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCA12 (0.000775%)
ATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCA13 (0.000840%)
ATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGGAGTAGTAAGTAACTACATGTGA15 (0.000969%)
ATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACT11 (0.000711%)
ATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTG5 (0.000323%)
ATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATT253 (0.016342%)
ATACTTTGACACCGGTAGGAATTGCGATAATTATAGTGGCTGATGTAAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCA9 (0.000581%)
ATAGAACGCTCAGAAGAATCCTGCAAAGAAAAATACTTCCGAGACGATGAATAGAATTATACCATATCGTAGTCCTTTTTGTACAATAGGAGTGTGGTGG8 (0.000517%)
ATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTG9 (0.000581%)
ATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCAC3 (0.000194%)
ATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCAT5 (0.000323%)
ATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAA4 (0.000258%)
ATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTG6 (0.000388%)
ATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGG6 (0.000388%)
ATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCA9 (0.000581%)
ATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGAT27 (0.001744%)
ATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTT9 (0.000581%)
ATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTG17 (0.001098%)
ATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCACCCAGCGCAGGTAAT5 (0.000323%)
ATAGTTATGGCCAAGGTACAGCCTGTAGTCCATCCTTGGGGGGACCCTTAACAGCCCAAAGGCAGAATCTTTAAACAGCAGGTCTTTCCCAAGAGGAGAG4 (0.000258%)
ATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCT4 (0.000258%)
ATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTC25 (0.001615%)
ATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAG6 (0.000388%)
ATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAG4 (0.000258%)
ATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAATAATTATGTATATTGAGTATATACCTGTAATAATAATGTTAATTCCTATAAGAATAATGGTAAAGT6 (0.000388%)
ATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTT8 (0.000517%)
ATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCA14 (0.000904%)
ATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCT7 (0.000452%)
ATCAACAACCGTCTCCATTCTTTCCAACACTGACTAGTTAAACTTATTATCAAACAAATAATGCTAATCCACACACCAAAAGGACGAACATGAACCCTAA3 (0.000194%)
ATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGA17 (0.001098%)
ATCAAGCCCTACTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTA234 (0.015115%)
ATCAAGTTGCCAACTGGCAAAGACCTCTGTGGTCAGAGTACCACACAAGCCATGGACCAGTATACATTTGAACTAAGCAGAAGGACTCAAGTTCCAGAAG3 (0.000194%)
ATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGC15 (0.000969%)
ATCACACTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCTCCAGCGCAGGTCTGGCTTTCTCGCCAAGTGTCTTCA433 (0.027969%)
ATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTG262 (0.016923%)
ATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGAT7 (0.000452%)
ATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGC8 (0.000517%)
ATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCC11 (0.000711%)
ATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCACCCAGCGCAGGTAATCCCAGAAGCGGT5 (0.000323%)
ATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCC8 (0.000517%)
ATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGG32 (0.002067%)
ATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAA3 (0.000194%)
ATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAA8 (0.000517%)
ATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTC7 (0.000452%)
ATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCT7 (0.000452%)
ATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCT5 (0.000323%)
ATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAAT116 (0.007493%)
ATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGC10 (0.000646%)
ATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGAC4 (0.000258%)
ATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCA3 (0.000194%)
ATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCA39 (0.002519%)
ATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCG19 (0.001227%)
ATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGA12 (0.000775%)
ATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGTCAA17 (0.000439%)
ATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGG19 (0.001227%)
ATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATT16 (0.001033%)
ATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCC4 (0.000258%)
ATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAA11 (0.000711%)
ATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTAT9 (0.000581%)
ATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACT6 (0.000388%)
ATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGC17 (0.001098%)
ATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTG12 (0.000775%)
ATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGT5 (0.000323%)
ATCTGCACAGGGGACACAACTGCCCGAGAAGAAACTGGACACAGCTTTCTCAAGAGGACTGCGGGGCTCCGACAGCTTACAGAAGAGCAAGCCAATGGGG3 (0.000194%)
ATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCA5 (0.000323%)
ATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGT5 (0.000323%)
ATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAAT10 (0.000646%)
ATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCG3 (0.000194%)
ATCTTAGGGTACATACAACTACGAAAAGGCCCTAACATTGTTGGTCCATACGGCATTTTACAACCATTTGCAGACGCCATAAAATTATTTATAAAAGAAC3 (0.000194%)
ATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAG6 (0.000388%)
ATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCA5 (0.000323%)
ATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGC7 (0.000452%)
ATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACAC6 (0.000388%)
ATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAAC14 (0.000904%)
ATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAG10 (0.000646%)
ATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAA7 (0.000452%)
ATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGT4 (0.000258%)
ATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAA54 (0.003488%)
ATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGA6 (0.000388%)
ATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAA4 (0.000258%)
ATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCA14 (0.000904%)
ATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGG181 (0.011691%)
ATGACTCCCTCCATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCC12 (0.000775%)
ATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATA15 (0.000969%)
ATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTG6 (0.000388%)
ATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCG17 (0.001098%)
ATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGG10 (0.000646%)
ATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGA6 (0.000388%)
ATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTC5 (0.000323%)
ATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGA10 (0.000646%)
ATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCA4 (0.000258%)
ATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTT4 (0.000258%)
ATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACAT4 (0.000258%)
ATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGA4 (0.000258%)
ATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGA9 (0.000581%)
ATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGG3 (0.000194%)
ATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCA4 (0.000258%)
ATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATAT6 (0.000388%)
ATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGT3 (0.000194%)
ATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTAC8 (0.000517%)
ATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTT8 (0.000517%)
ATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAA7 (0.000452%)
ATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAG18 (0.001163%)
ATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTT13 (0.000840%)
ATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATA4 (0.000258%)
ATGGAGGAACAGGCACATCTGCAACACAGAAGTCTCACGACTCAATAGCTGGAGTTGGTTGGTCCTCAGGGTTAGAATCCCAGAAGCCGGTGAACTTGTC3 (0.000194%)
ATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACC3 (0.000194%)
ATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCC3 (0.000194%)
ATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGG5 (0.000323%)
ATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAA14 (0.000904%)
ATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCA4 (0.000258%)
ATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTA4 (0.000258%)
ATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGT5 (0.000323%)
ATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGC19 (0.001227%)
ATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGA13 (0.000840%)
ATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGAT3 (0.000194%)
ATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAAT5 (0.000323%)
ATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTC9 (0.000581%)
ATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCAC12 (0.000775%)
ATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGT6 (0.000388%)
ATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAATAATTATGTATATTGAGTATATACCTGTAATAATAATGTTAATTCCTATAAGAATAATGGTAAAGTTT3 (0.000194%)
ATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGA7 (0.000452%)
ATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTG4 (0.000258%)
ATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGC6 (0.000388%)
ATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCT20 (0.001292%)
ATGTGCACCATTGCAGCACGCTGTCCAGCTGGGTGCTGCTGATGGATTATGCAGGCAATGCCACTGCTGTCTTCCTTCTGCCCGATGATGGGAAGATGCA207 (0.013371%)
ATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTT4 (0.000258%)
ATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGG3 (0.000194%)
ATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGA17 (0.001098%)
ATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCC3 (0.000194%)
ATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGA3 (0.000194%)
ATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATG3 (0.000194%)
ATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTATCCTAATTT3 (0.000194%)
ATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATCCTAATCATATTCTTAATTCTCATAACCCTAGTA16 (0.001033%)
ATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCATGGGCTAGATTTCCGGCTAGAGGT17 (0.001098%)
ATTACAACTGTACCCTTGGGGATGACATATCCTCGGAACACGGTGTCTCGGGTTGCTTCGTGGGGCAGGTTGGAAGGGACGAGGTTGATGAATCTCTGAA4 (0.000258%)
ATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCG6 (0.000388%)
ATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAA3 (0.000194%)
ATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGACGAGTCCACCACGGTGAAGGTGCC3 (0.000194%)
ATTACGTGGATGTCCTTGATGCTTCGAGGTGGCCCGCCAGGTGCTCAGGAGAACGTGGTCTTCAACTTCTCCTTCACTTTGCCAAATGCCTCTGAGAACC3 (0.000194%)
ATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGT15 (0.000969%)
ATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTC14 (0.000904%)
ATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATA18 (0.001163%)
ATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTG8 (0.000517%)
ATTAGTGTTAGTTCTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAATAATTATGTATATTGAGTATATAC7 (0.000452%)
ATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCC51 (0.003294%)
ATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATC20 (0.001292%)
ATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGTCAGAAATCGTGCATGAAGGGAAGAAAATCAAACTC4 (0.000258%)
ATTCCAAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGATCAA3 (0.000194%)
ATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTC4 (0.000258%)
ATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCT13 (0.000840%)
ATTCCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCAT23 (0.001486%)
ATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGAT20 (0.001292%)
ATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGT12 (0.000775%)
ATTCTCCTAAGGTGGGCCAGCCTGGTGCTGCTGGTCCAGTGTCCCCCATGTGCCCAGGGAGGATCAGACACTTCAAAATCTAGGCTTGATTCGGGGAAGT6 (0.000388%)
ATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGAT4 (0.000258%)
ATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCA5 (0.000323%)
ATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGACGAGTCCACCACGGTGAAGGTGCCCATGA5 (0.000323%)
ATTCTTCTGAGCGTTCTATCATTCTAGCCTCGTACCAACACATGATCTAGGAGGCTGCTGACCTCCAACAGGAATTTCACCACTTAACCCTCTAGAAGTC3 (0.000194%)
ATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGA16 (0.001033%)
ATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGG7 (0.000452%)
ATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGT27 (0.001744%)
ATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGAC16 (0.001033%)
ATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAG16 (0.001033%)
ATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAA13 (0.000840%)
ATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACA34 (0.002196%)
ATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTT9 (0.000581%)
ATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTG6 (0.000388%)
ATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGATTAGGTGTATTAATAAGT3 (0.000194%)
ATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCA32 (0.002067%)
ATTTACGTCTCGACAAATGTGTGTTACTGATGAAAAGGCTGTTATTGTATCTGATGTGTAGTGTATGGCTAAGAAAAGACCTGTAATGATTTGGACTATT5 (0.000323%)
ATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCT283 (0.018280%)
ATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAA31 (0.002002%)
ATTTCAGTAAAGTCTTCAGCTAGTGGCAGAACGTTCTCCAGGTTAGCAGTTGGCACTTTTTGGGCTAGTTTTATGAGATGGCTCAGCCTTGATTTTTCCT20 (0.001292%)
ATTTCCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAA302 (0.019507%)
ATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAA10 (0.000646%)
ATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCT20 (0.001292%)
ATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGA29 (0.001873%)
ATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGT31 (0.002002%)
ATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTG12 (0.000775%)
ATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTG48 (0.003100%)
ATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGT9 (0.000581%)
ATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTAC10 (0.000646%)
ATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATC13 (0.000840%)
ATTTTCTCTAAGGATTCCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGG29 (0.001873%)
ATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACT45 (0.002907%)
ATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTA44 (0.002842%)
CAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTC36 (0.002325%)
CAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCA25 (0.001615%)
CAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATT148 (0.014148%)
CAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACG32 (0.002067%)
CAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGT26 (0.001679%)
CAAAATCTTAGGGTACATACAACTACGAAAAGGCCCTAACATTGTTGGTCCATACGGCATTTTACAACCATTTGCAGACGCCATAAAATTATTTATAAAA35 (0.002261%)
CAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAA5 (0.000323%)
CAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTT98 (0.006330%)
CAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAA67 (0.004328%)
CAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTG21 (0.001356%)
CAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTAT47 (0.003036%)
CAAAGGCAAATCAAAAGACTTCCAACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGG6 (0.000388%)
CAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACG151 (0.009754%)
CAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCC5 (0.000323%)
CAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTG4 (0.000258%)
CAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCT26 (0.001679%)
CAAATCAAAAGACTTCCAACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGAC4 (0.000258%)
CAAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGATCAAAGAA8 (0.000517%)
CAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTAC13 (0.000840%)
CAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTA8 (0.000517%)
CAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTT23 (0.001486%)
CAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTG60 (0.003876%)
CAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAG14 (0.000904%)
CAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGT227 (0.014663%)
CAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCA6 (0.000388%)
CAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAAT11 (0.000711%)
CAACAACCGTCTCCATTCTTTCCAACACTGACTAGTTAAACTTATTATCAAACAAATAATGCTAATCCACACACCAAAAGGACGAACATGAACCCTAATA20 (0.001292%)
CAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAA12 (0.000775%)
CAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGAC6 (0.000388%)
CAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAG13 (0.000840%)
CAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTCCTC29 (0.001873%)
CAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTC27 (0.001744%)
CAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCAT44 (0.002842%)
CAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATC18 (0.001163%)
CAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCA12 (0.000775%)
CAACAGCTGAACCTGAATCTCCTGGAAAACTGGGACACTCTGGGTTCAACCGTTAGTCAGCTGCAGGAACGGCTGGGCCCATTGACTCGGGACTTCTGGG145 (0.009366%)
CAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCC31 (0.002002%)
CAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAG9 (0.000581%)
CAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTGT322 (0.020799%)
CAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTG56 (0.003617%)
CAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGAT35 (0.002261%)
CAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTG11 (0.000711%)
CAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAA8 (0.000517%)
CAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTA19 (0.001227%)
CAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAA35 (0.002261%)
CAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTT6 (0.000388%)
CAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGC9 (0.000581%)
CAACCGTCTCCATTCTTTCCAACACTGACTAGTTAAACTTATTATCAAACAAATAATGCTAATCCACACACCAAAAGGACGAACATGAACCCTAATAATT22 (0.001421%)
CAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGT5 (0.000323%)
CAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCC32 (0.002067%)
CAACTACGAAAAGGCCCTAACATTGTTGGTCCATACGGCATTTTACAACCATTTGCAGACGCCATAAAATTATTTATAAAAGAACCAATACGCCCTTTAA6 (0.000388%)
CAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTC20 (0.001292%)
CAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGA388 (0.025062%)
CAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTC30 (0.001938%)
CAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTG17 (0.001098%)
CAACTGTACCCTTGGGGATGACATATCCTCGGAACACGGTGTCTCGGGTTGCTTCGTGGGGCAGGTTGGAAGGGACGAGGTTGATGAATCTCTGAATCTC7 (0.000452%)
CAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACA21 (0.001356%)
CAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTC27 (0.001744%)
CAACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGGCTGTACCTTG8 (0.000517%)
CAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGG55 (0.003553%)
CAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGT8 (0.000517%)
CAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGC160 (0.010335%)
CAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTT140 (0.009043%)
CAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGC119 (0.007687%)
CAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCTGTAGGAGTATGGGCTGAGCAGGGCTGCGATGGTG329 (0.021251%)
CAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGC5 (0.000323%)
CAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTC72 (0.004651%)
CAAGCCCTACTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATG3 (0.000194%)
CAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGT4 (0.000258%)
CAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCG31 (0.002002%)
CAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTG12 (0.000775%)
CAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCC149 (0.009624%)
CAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTG8 (0.000517%)
CAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACT36 (0.002325%)
CAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAA3 (0.000194%)
CAAGGTACAGCCTGTAGTCCATCCTTGGGGGGACCCTTAACAGCCCAAAGGCAGAATCTTTAAACAGCAGGTCTTTCCCAAGAGGAGAGCTGAACAGTTG9 (0.000581%)
CAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGG375 (0.024222%)
CAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTG6 (0.000388%)
CAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGC100 (0.006459%)
CAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTC23 (0.001486%)
CAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCA12 (0.000775%)
CAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAA28 (0.001809%)
CAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAG41 (0.002648%)
CAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTT68 (0.004392%)
CAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTC11 (0.000711%)
CAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGG11 (0.000711%)
CAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCA6 (0.000388%)
CAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCT7 (0.000452%)
CAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGGCCCAAGGAGGAGGAT3 (0.000194%)
CAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTT8 (0.000517%)
CAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGTCAGAAA5 (0.000323%)
CAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTA28 (0.001809%)
CACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTC24 (0.001550%)
CACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACT16 (0.001033%)
CACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTG14 (0.000904%)
CACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCAT3 (0.000194%)
CACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCT612 (0.039531%)
CACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGG28 (0.001809%)
CACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTC3 (0.000194%)
CACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGA7 (0.000452%)
CACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAG49 (0.003165%)
CACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTC20 (0.001292%)
CACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCAC15 (0.000969%)
CACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTT120 (0.007751%)
CACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCT11 (0.000711%)
CACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGC7 (0.000452%)
CACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCG14 (0.000904%)
CACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTT16 (0.001033%)
CACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCC10 (0.000646%)
CACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAA7 (0.000452%)
CACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACA71 (0.004586%)
CACAGAAGTCTCACGACTCAATAGCTGGAGTTGGTTGGTCCTCAGGGTTAGAATCCCAGAAGCCGGTGAACTTGTCAGTAAACTTGCTCCAGTAGCCTTT4 (0.000258%)
CACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAG36 (0.002325%)
CACAGCCACAGCGTAGTAGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGCCACGGGCTTCAGGTTGTTCGGAGTCAGGCCGGCATCGTAC6 (0.000388%)
CACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAA34 (0.002196%)
CACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATA16 (0.001033%)
CACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAA7 (0.000452%)
CACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAAT5 (0.000323%)
CACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTC15 (0.000969%)
CACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGG11 (0.000711%)
CACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTC9 (0.000581%)
CACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGC34 (0.002196%)
CACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACC10 (0.000646%)
CACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCG4 (0.000258%)
CACCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCAC24 (0.001550%)
CACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCC5 (0.000323%)
CACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACA3 (0.000194%)
CACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTAT13 (0.000840%)
CACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACG22 (0.001421%)
CACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTAC8 (0.000517%)
CACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACA18 (0.001163%)
CACCCAACCCCCATCCAAGGTCATAGCATCGGCTTCACTTGCAGAAATGGCCTTGATGCAATCCGGATAGGAGGTTTTCTTCACACAGGCAAGCCGGGGG5 (0.000323%)
CACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAG11 (0.000711%)
CACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTAT3 (0.000194%)
CACCCCCTCCCCGCCCCCAGCTTCAGTGGTGGCTATGTCCTGTCTGCCAAAACCTTACTTCCCCGAATCAAGCCTAGATTTTGAAGTGTCTGATCCTCCC159 (0.010270%)
CACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACG8 (0.000517%)
CACCCTTCAGGATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCA308 (0.019895%)
CACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAG9 (0.000581%)
CACCGGTAGGAATTGCGATAATTATAGTGGCTGATGTAAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAA6 (0.000388%)
CACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCA7 (0.000452%)
CACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTG3 (0.000194%)
CACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCG9 (0.000581%)
CACCTCCTCTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATA5 (0.000323%)
CACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAA8 (0.000517%)
CACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTC19 (0.001227%)
CACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCG8 (0.000517%)
CACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCC5 (0.000323%)
CACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTG7 (0.000452%)
CACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATCCTAA6 (0.000388%)
CACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAG23 (0.001486%)
CACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTG49 (0.003165%)
CACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGC13 (0.000840%)
CACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAA17 (0.001098%)
CACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTT10 (0.000646%)
CACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGC67 (0.004328%)
CACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTGTATGTGGATGCGGTCAAAGACAGCGGCAGAGACTATG5 (0.000323%)
CACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTT7 (0.000452%)
CACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGC31 (0.002002%)
CACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTC7 (0.000452%)
CACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTAT517 (0.033395%)
CACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAG25 (0.001615%)
CACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTG4 (0.000258%)
CACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCT4 (0.000258%)
CACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTT4 (0.000258%)
CACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACA13 (0.000840%)
CACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTT4 (0.000258%)
CACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTC6 (0.000388%)
CACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCATTATCTTCTATCT8 (0.000517%)
CACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAG5 (0.000323%)
CACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCAT9 (0.000581%)
CACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACAC11 (0.000711%)
CACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATA7 (0.000452%)
CACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTG4 (0.000258%)
CACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGT10 (0.000646%)
CACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCT7 (0.000452%)
CACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGC3 (0.000194%)
CACTTCCTCATGTTACCGACAGATTGCATGTACTCCGCTCCTAAGTATTTTTCAGGTGTGGTACCCTCTGGAAGTTTAACGAAACATTTGGTGTCATCCC9 (0.000581%)
CACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGA4 (0.000258%)
CACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGT12 (0.000775%)
CACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGC10 (0.000646%)
CACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGAT4 (0.000258%)
CACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTT5 (0.000323%)
CAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAG13 (0.000840%)
CAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGAC58 (0.003746%)
CAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAAT89 (0.005749%)
CAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGT28 (0.001809%)
CAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGC14 (0.000904%)
CAGAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGGC16 (0.001033%)
CAGAAGTCTCACGACTCAATAGCTGGAGTTGGTTGGTCCTCAGGGTTAGAATCCCAGAAGCCGGTGAACTTGTCAGTAAACTTGCTCCAGTAGCCTTTCA13 (0.000840%)
CAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAG10 (0.000646%)
CAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTG38 (0.002455%)
CAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACC20 (0.001292%)
CAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGG118 (0.007622%)
CAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACAAACCTGGGAGACTTTGCAATCAGCCTATACCGGGAGCTGGTCCATCAGTC25 (0.001615%)
CAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGT47 (0.003036%)
CAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCG107 (0.006911%)
CAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCG102 (0.006589%)
CAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAGGT19 (0.001227%)
CAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGC48 (0.003100%)
CAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTC8 (0.000517%)
CAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGC41 (0.002648%)
CAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATT56 (0.003617%)
CAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCT19 (0.001227%)
CAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAG20 (0.001292%)
CAGAGACTATGTGTCCCAGTTTGAATCCTCCTCCTTGGGCCAACAGCTGAACCTGAATCTCCTGGAAAACTGGGACACTCTGGGTTCAACCGTTAGTCAG91 (0.005878%)
CAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCT106 (0.006847%)
CAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGA115 (0.007428%)
CAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGG10 (0.000646%)
CAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGTCAGAAATCGTGC6 (0.000388%)
CAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCA9 (0.000581%)
CAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTAT238 (0.015373%)
CAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGC33 (0.002132%)
CAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCG18 (0.001163%)
CAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGG59 (0.003811%)
CAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCC10 (0.000646%)
CAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGG22 (0.001421%)
CAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCA34 (0.002196%)
CAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTC22 (0.001421%)
CAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGT4547 (0.117482%)
CAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTA8 (0.000517%)
CAGATTGGGTGAGACAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGT4 (0.000258%)
CAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGC64 (0.004134%)
CAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTT35 (0.002261%)
CAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATG28 (0.001809%)
CAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCT19 (0.001227%)
CAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCT8 (0.000517%)
CAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAG13 (0.000840%)
CAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTG50 (0.003230%)
CAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGA61 (0.003940%)
CAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAG53 (0.003423%)
CAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGA6 (0.000388%)
CAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTG8 (0.000517%)
CAGCCACAGCGTAGTAGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGCCACGGGCTTCAGGTTGTTCGGAGTCAGGCCGGCATCGTACAC7 (0.000452%)
CAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATC15 (0.000969%)
CAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCC23 (0.001486%)
CAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGG15 (0.000969%)
CAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAG4 (0.000258%)
CAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGC17 (0.001098%)
CAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATG15 (0.000969%)
CAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTG5 (0.000323%)
CAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCT14 (0.000904%)
CAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCC61 (0.003940%)
CAGCCTGTAGTCCATCCTTGGGGGGACCCTTAACAGCCCAAAGGCAGAATCTTTAAACAGCAGGTCTTTCCCAAGAGGAGAGCTGAACAGTTGGAAGTCT4 (0.000258%)
CAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCA20 (0.001292%)
CAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCC16 (0.001033%)
CAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCC27 (0.001744%)
CAGCGTAGTAGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGCCACGGGCTTCAGGTTGTTCGGAGTCAGGCCGGCATCGTACACCCAACC15 (0.000969%)
CAGCTATCAAGTTGCCAACTGGCAAAGACCTCTGTGGTCAGAGTACCACACAAGCCATGGACCAGTATACATTTGAACTAAGCAGAAGGACTCAAGTTCC13 (0.000840%)
CAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGG3 (0.000194%)
CAGCTGCCTCACAGAACAGTTTGCCAGCGGGGTGGGGTCCAAAGCATGGCAAGTGGTCTCCAGTGTGTCAACTTCCATCTCATACACCACTCCGAAGGGC5 (0.000323%)
CAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTA12 (0.000775%)
CAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATG36 (0.002325%)
CAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTC29 (0.001873%)
CAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACAAACCTGGGAGACTTTGCAATC11 (0.000711%)
CAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCA13 (0.000840%)
CAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGC29 (0.001873%)
CAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCA28 (0.001809%)
CAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAAC26 (0.001679%)
CAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGT61 (0.003940%)
CAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCA8 (0.000517%)
CAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGC9 (0.000581%)
CAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCC8 (0.000517%)
CAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAA3 (0.000194%)
CAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTT12 (0.000775%)
CAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATCCTAATCATATT4 (0.000258%)
CAGGATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGAC14 (0.000904%)
CAGGATTCTTCTGAGCGTTCTATCATTCTAGCCTCGTACCAACACATGATCTAGGAGGCTGCTGACCTCCAACAGGAATTTCACCACTTAACCCTCTAGA174 (0.011239%)
CAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCC45 (0.002907%)
CAGGCACATCTGCAACACAGAAGTCTCACGACTCAATAGCTGGAGTTGGTTGGTCCTCAGGGTTAGAATCCCAGAAGCCGGTGAACTTGTCAGTAAACTT9 (0.000581%)
CAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGAT19 (0.001227%)
CAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGT14 (0.000904%)
CAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTT98 (0.006330%)
CAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATAC10 (0.000646%)
CAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAA17 (0.001098%)
CAGGCTGGCCCACCTTAGGAGAATGAAGAGTTTCTCCCGAGGCCGACTCCACCGAGGCCACAGGAGAGAAGGCGTGGCGTAGGTCGTGGTAAGTTCGGTG218 (0.014081%)
CAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGG9 (0.000581%)
CAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAG25 (0.001615%)
CAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTGTATGTGGATGCGGTCAAAGACAGCGGCA3 (0.000194%)
CAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCT16 (0.001033%)
CAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTGTATGTGGATGCGGTCAAAGA11 (0.000711%)
CAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACA151 (0.009754%)
CAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACA8 (0.000517%)
CAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGC5 (0.000323%)
CAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTT15 (0.000969%)
CAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCT17 (0.001098%)
CAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGA16 (0.001033%)
CAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGG5 (0.000323%)
CAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGG39 (0.002519%)
CAGGTTAGCAGTTGGCACTTTTTGGGCTAGTTTTATGAGATGGCTCAGCCTTGATTTTTCCTTTCCATATGCAGCATATTGTGAGCAGACTCTGTTTGAC4 (0.000258%)
CAGGTTATCCCAGAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTC4 (0.000258%)
CAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCAT3 (0.000194%)
CAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGC13 (0.000840%)
CAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATT5 (0.000323%)
CAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGG5 (0.000323%)
CAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACT8 (0.000517%)
CAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTG6 (0.000388%)
CAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACT22 (0.001421%)
CAGTCAGCTGCCTCACAGAACAGTTTGCCAGCGGGGTGGGGTCCAAAGCATGGCAAGTGGTCTCCAGTGTGTCAACTTCCATCTCATACACCACTCCGAA5 (0.000323%)
CAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTC10 (0.000646%)
CAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAA4 (0.000258%)
CAGTGACATAGTTATGGCCAAGGTACAGCCTGTAGTCCATCCTTGGGGGGACCCTTAACAGCCCAAAGGCAGAATCTTTAAACAGCAGGTCTTTCCCAAG5 (0.000323%)
CAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAAC4 (0.000258%)
CAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGA37 (0.002390%)
CAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGC3 (0.000194%)
CAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAA3 (0.000194%)
CAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCA6 (0.000388%)
CAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGT3 (0.000194%)
CAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGC18 (0.001163%)
CAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTGTGATCTGCATTCCATCCTGTC5 (0.000323%)
CAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCA11 (0.000711%)
CAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAA7 (0.000452%)
CATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGA8 (0.000517%)
CATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGC4 (0.000258%)
CATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGGAGTAGTAAGTAACTACATGTG3 (0.000194%)
CATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACAC5 (0.000323%)
CATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCT5 (0.000323%)
CATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATT4 (0.000258%)
CATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTG3 (0.000194%)
CATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGA21 (0.001356%)
CATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGC10 (0.000646%)
CATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGT15 (0.000969%)
CATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCT17 (0.001098%)
CATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTC9 (0.000581%)
CATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAG5 (0.000323%)
CATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCC4 (0.000258%)
CATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCACCCAGCGCAGGTAATCCCAGAAGCGG3 (0.000194%)
CATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGC6 (0.000388%)
CATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGG9 (0.000581%)
CATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGT12 (0.000775%)
CATCCTCAAAACGCCTAATCAACAACCGTCTCCATTCTTTCCAACACTGACTAGTTAAACTTATTATCAAACAAATAATGCTAATCCACACACCAAAAGG4 (0.000258%)
CATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATG6 (0.000388%)
CATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGA7 (0.000452%)
CATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTC7 (0.000452%)
CATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAG10 (0.000646%)
CATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAAT38 (0.002455%)
CATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTAC4 (0.000258%)
CATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAG7 (0.000452%)
CATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAA17 (0.001098%)
CATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACA14 (0.000904%)
CATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTG24 (0.001550%)
CATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTG19 (0.001227%)
CATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACAT13 (0.000840%)
CATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAG18 (0.001163%)
CATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTC6 (0.000388%)
CATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCT6 (0.000388%)
CATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACA3 (0.000194%)
CATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATA8 (0.000517%)
CATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAG5 (0.000323%)
CATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTA20 (0.001292%)
CATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTT4 (0.000258%)
CATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAA32 (0.002067%)
CATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCT15 (0.000969%)
CATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACAC3 (0.000194%)
CATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGC10 (0.000646%)
CATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTG6 (0.000388%)
CATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACA7 (0.000452%)
CATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCG5 (0.000323%)
CATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCA12 (0.000775%)
CATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTG15 (0.000969%)
CATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTGTGTT9 (0.000581%)
CATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCG6 (0.000388%)
CATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTT8 (0.000517%)
CATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAAT4 (0.000258%)
CATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTG16 (0.001033%)
CATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGTCAGAAATCGTGCATGAAGGGAAGAAAATCAAACT5 (0.000323%)
CATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGC5 (0.000323%)
CATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGA8 (0.000517%)
CATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAG4 (0.000258%)
CATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTC8 (0.000517%)
CATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAG5 (0.000323%)
CATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGA13 (0.000840%)
CATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGAC15 (0.000969%)
CATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTT8 (0.000517%)
CATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAA5 (0.000323%)
CATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCC4 (0.000258%)
CATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCAC5 (0.000323%)
CCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCT429 (0.027710%)
CCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCAC17 (0.001098%)
CCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCT14 (0.000904%)
CCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCT5 (0.000323%)
CCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTC19 (0.001227%)
CCAAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGATCAAAGA21 (0.001356%)
CCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAA11 (0.000711%)
CCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCAT8 (0.000517%)
CCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCA13 (0.000840%)
CCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGA6 (0.000388%)
CCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTT7 (0.000452%)
CCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCG22 (0.001421%)
CCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGT16 (0.001033%)
CCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCT12 (0.000775%)
CCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCG30 (0.001938%)
CCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGC31 (0.002002%)
CCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGAC11 (0.000711%)
CCAAGGTACAGCCTGTAGTCCATCCTTGGGGGGACCCTTAACAGCCCAAAGGCAGAATCTTTAAACAGCAGGTCTTTCCCAAGAGGAGAGCTGAACAGTT6 (0.000388%)
CCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTT12 (0.000775%)
CCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCC5 (0.000323%)
CCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAA31 (0.002002%)
CCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAG48 (0.003100%)
CCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGC9 (0.000581%)
CCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTG14 (0.000904%)
CCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGA9 (0.000581%)
CCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAA3 (0.000194%)
CCACAGCGTAGTAGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGCCACGGGCTTCAGGTTGTTCGGAGTCAGGCCGGCATCGTACACCCA8 (0.000517%)
CCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTC3 (0.000194%)
CCACCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCA5 (0.000323%)
CCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTC13 (0.000840%)
CCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGAC9 (0.000581%)
CCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTA5 (0.000323%)
CCACCGCGTGCTCAGTCAGCTGCCTCACAGAACAGTTTGCCAGCGGGGTGGGGTCCAAAGCATGGCAAGTGGTCTCCAGTGTGTCAACTTCCATCTCATA5 (0.000323%)
CCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGC13 (0.000840%)
CCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTA14 (0.000904%)
CCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGC4 (0.000258%)
CCACCTTAGGAGAATGAAGAGTTTCTCCCGAGGCCGACTCCACCGAGGCCACAGGAGAGAAGGCGTGGCGTAGGTCGTGGTAAGTTCGGTGGTCTGAAAG3 (0.000194%)
CCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCT7 (0.000452%)
CCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACA5 (0.000323%)
CCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCA10 (0.000646%)
CCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAA9 (0.000581%)
CCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGC9 (0.000581%)
CCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGT15 (0.000969%)
CCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATA6 (0.000388%)
CCACTGGATCTGCACAGGGGACACAACTGCCCGAGAAGAAACTGGACACAGCTTTCTCAAGAGGACTGCGGGGCTCCGACAGCTTACAGAAGAGCAAGCC3 (0.000194%)
CCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCT15 (0.000969%)
CCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAG20 (0.001292%)
CCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCG11 (0.000711%)
CCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCGG4 (0.000258%)
CCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGA41 (0.002648%)
CCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAA8 (0.000517%)
CCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTG26 (0.001679%)
CCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAG14 (0.000904%)
CCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGACTCTCTGCGCACACAGCTAGCG4 (0.000258%)
CCAGAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGG16 (0.001033%)
CCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGC4 (0.000258%)
CCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATG12 (0.000775%)
CCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGC7 (0.000452%)
CCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATG15 (0.000969%)
CCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTG10 (0.000646%)
CCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAG4 (0.000258%)
CCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTC8 (0.000517%)
CCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGT17 (0.001098%)
CCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGC14 (0.000904%)
CCAGCCTGGTGCTGCTGGTCCAGTGTCCCCCATGTGCCCAGGGAGGATCAGACACTTCAAAATCTAGGCTTGATTCGGGGAAGTAAGGTTTTGGCAGACA6 (0.000388%)
CCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGA297 (0.019184%)
CCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGC3 (0.000194%)
CCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCC7 (0.000452%)
CCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCCAATAA207 (0.013371%)
CCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTG4 (0.000258%)
CCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACAAACCTGGGAGACTTTGCAAT3 (0.000194%)
CCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATG7 (0.000452%)
CCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTG9 (0.000581%)
CCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCA8 (0.000517%)
CCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGC5 (0.000323%)
CCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCAC6 (0.000388%)
CCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTT13 (0.000840%)
CCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAG10 (0.000646%)
CCAGGTTATCCCAGAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTT8 (0.000517%)
CCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAAC18 (0.001163%)
CCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATT43 (0.002778%)
CCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAA3 (0.000194%)
CCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAG8 (0.000517%)
CCAGTGTCCCCCATGTGCCCAGGGAGGATCAGACACTTCAAAATCTAGGCTTGATTCGGGGAAGTAAGGTTTTGGCAGACAGGACATAGCCACCACTGAA7 (0.000452%)
CCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTGTGATCTGCATTCCATCCTGT11 (0.000711%)
CCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGC8 (0.000517%)
CCATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGG98 (0.006330%)
CCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAG21 (0.001356%)
CCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAA6 (0.000388%)
CCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATA16 (0.001033%)
CCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAAC4 (0.000258%)
CCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTT12 (0.000775%)
CCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCT9 (0.000581%)
CCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGA30 (0.001938%)
CCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGC18 (0.001163%)
CCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGC7 (0.000452%)
CCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCT7 (0.000452%)
CCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGGTTCTACATTCTTCAT3 (0.000194%)
CCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAAT3 (0.000194%)
CCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATC3 (0.000194%)
CCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGC8 (0.000517%)
CCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAG15 (0.000969%)
CCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGT8 (0.000517%)
CCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCT9 (0.000581%)
CCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTG77 (0.004974%)
CCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGA63 (0.004069%)
CCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACA17 (0.001098%)
CCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCT8 (0.000517%)
CCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATT320 (0.020670%)
CCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCAT28 (0.001809%)
CCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGC41 (0.002648%)
CCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCG7 (0.000452%)
CCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAG5 (0.000323%)
CCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGT17 (0.001098%)
CCCAGAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTG7 (0.000452%)
CCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGGCCCAAGGAGGAGGATTCAAACT7 (0.000452%)
CCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCG9 (0.000581%)
CCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTG25 (0.001615%)
CCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCC4 (0.000258%)
CCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCAT17 (0.001098%)
CCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAA5 (0.000323%)
CCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAA3 (0.000194%)
CCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAA8 (0.000517%)
CCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTATCCT8 (0.000517%)
CCCATCCTCAAAACGCCTAATCAACAACCGTCTCCATTCTTTCCAACACTGACTAGTTAAACTTATTATCAAACAAATAATGCTAATCCACACACCAAAA307 (0.019830%)
CCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAA17 (0.001098%)
CCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAA5 (0.000323%)
CCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAG5 (0.000323%)
CCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAG5 (0.000323%)
CCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATG16 (0.001033%)
CCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCT14 (0.000904%)
CCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGAC29 (0.001873%)
CCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATC9 (0.000581%)
CCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTT24 (0.001550%)
CCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACA8 (0.000517%)
CCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAA9 (0.000581%)
CCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAA4 (0.000258%)
CCCCTCCCCGCCCCCAGCTTCAGTGGTGGCTATGTCCTGTCTGCCAAAACCTTACTTCCCCGAATCAAGCCTAGATTTTGAAGTGTCTGATCCTCCCTGG5 (0.000323%)
CCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAA60 (0.003876%)
CCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTATCCTAATTTTAGCCC6 (0.000388%)
CCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGC48 (0.003100%)
CCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGGCCCAAGGA13 (0.000840%)
CCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAG26 (0.001679%)
CCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCTGCTGTAGACGTGGCTGTAAAAGTGTTCAAAA12 (0.000775%)
CCCTAACATTGTTGGTCCATACGGCATTTTACAACCATTTGCAGACGCCATAAAATTATTTATAAAAGAACCAATACGCCCTTTAACAACCTCTATATCC5 (0.000323%)
CCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACA7 (0.000452%)
CCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGA14 (0.000904%)
CCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGA3 (0.000194%)
CCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGC15 (0.000969%)
CCCTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGACGAGTCCACCACGGT3 (0.000194%)
CCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATT3 (0.000194%)
CCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATT11 (0.000711%)
CCCTTCTTTACCACAGCCACAGCGTAGTAGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGCCACGGGCTTCAGGTTGTTCGGAGTCAGGC8 (0.000517%)
CCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAG29 (0.001873%)
CCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTATCCTAATTTTAGCCCT4 (0.000258%)
CCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTT22 (0.001421%)
CCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCAC103 (0.006653%)
CCGACTCCACCGAGGCCACAGGAGAGAAGGCGTGGCGTAGGTCGTGGTAAGTTCGGTGGTCTGAAAGTCCTCGTGGAACCACCACAGGTCCCACCACCAC8 (0.000517%)
CCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCG53 (0.003423%)
CCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAG22 (0.001421%)
CCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAG23 (0.001486%)
CCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAA12 (0.000775%)
CCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCT14 (0.000904%)
CCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGA19 (0.001227%)
CCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGT4 (0.000258%)
CCGAGGCCGACTCCACCGAGGCCACAGGAGAGAAGGCGTGGCGTAGGTCGTGGTAAGTTCGGTGGTCTGAAAGTCCTCGTGGAACCACCACAGGTCCCAC5 (0.000323%)
CCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGGCCCAAGGAG9 (0.000581%)
CCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCT19 (0.001227%)
CCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGAT44 (0.002842%)
CCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGT9 (0.000581%)
CCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGA65 (0.004199%)
CCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGT6 (0.000388%)
CCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACC30 (0.001938%)
CCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGC25 (0.001615%)
CCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCC3 (0.000194%)
CCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGA31 (0.002002%)
CCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGT73 (0.004715%)
CCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTAC20 (0.001292%)
CCGGACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGG307 (0.019830%)
CCGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGG36 (0.002325%)
CCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAAC48 (0.003100%)
CCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCT31 (0.002002%)
CCGGTAGGAATTGCGATAATTATAGTGGCTGATGTAAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGC7 (0.000452%)
CCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAA42 (0.002713%)
CCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGA4 (0.000258%)
CCGTAATTTACGTCTCGACAAATGTGTGTTACTGATGAAAAGGCTGTTATTGTATCTGATGTGTAGTGTATGGCTAAGAAAAGACCTGTAATGATTTGGA7 (0.000452%)
CCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGG10 (0.000646%)
CCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTT3 (0.000194%)
CCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCACCCAGCGCAG5 (0.000323%)
CCGTCTCCATTCTTTCCAACACTGACTAGTTAAACTTATTATCAAACAAATAATGCTAATCCACACACCAAAAGGACGAACATGAACCCTAATAATTGTT7 (0.000452%)
CCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGT6 (0.000388%)
CCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTG10 (0.000646%)
CCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTC4 (0.000258%)
CCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAA8 (0.000517%)
CCTACTTCATGCCAGCTGCTGAACCACTTCAATTGCCAGCTATCAAGTTGCCAACTGGCAAAGACCTCTGTGGTCAGAGTACCACACAAGCCATGGACCA71 (0.004586%)
CCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTG5 (0.000323%)
CCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGATGGACCAGCTCCCGGTATAGGCTGATTG5 (0.000323%)
CCTAGGTCATAGTTTATGTTTCTGTTCTCATTAATGTAACTAGAACACTGGAAAAAGGAAAAAGAAAGACATATTAACCAAAGGCTGCAGTCACTTTTCA40 (0.002584%)
CCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCT7 (0.000452%)
CCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTT14 (0.000904%)
CCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGAC6 (0.000388%)
CCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCA3 (0.000194%)
CCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCA40 (0.002584%)
CCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTT4 (0.000258%)
CCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTT5 (0.000323%)
CCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAG23 (0.001486%)
CCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACA41 (0.002648%)
CCTCATGTTACCGACAGATTGCATGTACTCCGCTCCTAAGTATTTTTCAGGTGTGGTACCCTCTGGAAGTTTAACGAAACATTTGGTGTCATCCCTGAAC6 (0.000388%)
CCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATC3 (0.000194%)
CCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATC5 (0.000323%)
CCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTG9 (0.000581%)
CCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCACCCAGCGCAGGTAATCCCAGAA4 (0.000258%)
CCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTG9 (0.000581%)
CCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAA16 (0.001033%)
CCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGC3 (0.000194%)
CCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAA20 (0.001292%)
CCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGC14 (0.000904%)
CCTCGCTGGACTGGTATTTGTGTCTGAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGC11 (0.000711%)
CCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAG6 (0.000388%)
CCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCC3 (0.000194%)
CCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAA15 (0.000969%)
CCTCTGCCACTTTTAGTTGCTTACACCAAGAATTATCTCTCTATGGTTGGATCCTGCTGTACTTCTGCAAACCCAACTGTATGCTTTGTGAAGGAGAGAC3 (0.000194%)
CCTCTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTA3 (0.000194%)
CCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACAT19 (0.001227%)
CCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCT98 (0.006330%)
CCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACT16 (0.001033%)
CCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCT9 (0.000581%)
CCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCA6 (0.000388%)
CCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTGTGATCTGCATT3 (0.000194%)
CCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTT13 (0.000840%)
CCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGA38 (0.002455%)
CCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCA24 (0.001550%)
CCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGAT28 (0.001809%)
CCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGA9 (0.000581%)
CCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAA13 (0.000840%)
CCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGT5 (0.000323%)
CCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTT11 (0.000711%)
CCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTG39 (0.002519%)
CCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTC66 (0.004263%)
CCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTG4 (0.000258%)
CCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGG11 (0.000711%)
CCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTG10 (0.000646%)
CCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGATCAAAGAAAGTTG3 (0.000194%)
CCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAG24 (0.001550%)
CCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCTGTAGGAGTATGGGCTGAGCAGGGCTGCGATGGTGTAGTGGCGATGGCCA6 (0.000388%)
CCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTT17 (0.001098%)
CCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCTGTAGGAGTATGGGCTGAGCAGGGCTGCGATGGTGTAGTGG13 (0.000840%)
CCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGT10 (0.000646%)
CCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGT6 (0.000388%)
CCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTG3 (0.000194%)
CCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTA21 (0.001356%)
CCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTT10 (0.000646%)
CCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTT11 (0.000711%)
CCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAAGTTGAAACCATTTGAACTATTCTACC25 (0.001615%)
CCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCC14 (0.000904%)
CCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCA12 (0.000775%)
CCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCAC20 (0.001292%)
CCTTGATGCTTCGAGGTGGCCCGCCAGGTGCTCAGGAGAACGTGGTCTTCAACTTCTCCTTCACTTTGCCAAATGCCTCTGAGAACCAGGCCCGGGTCTT7 (0.000452%)
CCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCA88 (0.005684%)
CCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGATGGACCAGCTCCCGGTATAG69 (0.004457%)
CCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACT6 (0.000388%)
CCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAAC21 (0.001356%)
CCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGA3 (0.000194%)
CCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCAC3 (0.000194%)
CCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGAC5 (0.000323%)
CCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCA4 (0.000258%)
CCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAG4 (0.000258%)
CCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGA61 (0.003940%)
CCTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTT94 (0.006072%)
CCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCA42 (0.002713%)
CCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACAC5 (0.000323%)
CCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGC13 (0.000840%)
CCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGA5 (0.000323%)
CGAAAAGGCCCTAACATTGTTGGTCCATACGGCATTTTACAACCATTTGCAGACGCCATAAAATTATTTATAAAAGAACCAATACGCCCTTTAACAACCT5 (0.000323%)
CGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAA8 (0.000517%)
CGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGC110 (0.007105%)
CGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACAC26 (0.001679%)
CGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCA10 (0.000646%)
CGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTA6 (0.000388%)
CGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACA30 (0.001938%)
CGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCT22 (0.001421%)
CGACTCCACCGAGGCCACAGGAGAGAAGGCGTGGCGTAGGTCGTGGTAAGTTCGGTGGTCTGAAAGTCCTCGTGGAACCACCACAGGTCCCACCACCACA5 (0.000323%)
CGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGC19 (0.001227%)
CGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGC6 (0.000388%)
CGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAA17 (0.001098%)
CGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTT77 (0.004974%)
CGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTG12 (0.000775%)
CGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGAC3 (0.000194%)
CGAGCTGGTTCAGCTGGAAGTCTGTTCCCTTCTTTACCACAGCCACAGCGTAGTAGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGCCAC3 (0.000194%)
CGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTG41 (0.002648%)
CGAGGCTAGAATGATAGAACGCTCAGAAGAATCCTGCAAAGAAAAATACTTCCGAGACGATGAATAGAATTATACCATATCGTAGTCCTTTTTGTACAAT10 (0.000646%)
CGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCC10 (0.000646%)
CGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAG6 (0.000388%)
CGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGGCCCAAGGAGG5 (0.000323%)
CGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGAC39 (0.002519%)
CGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACAC10 (0.000646%)
CGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAG8 (0.000517%)
CGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTT18 (0.001163%)
CGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTC15 (0.000969%)
CGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGC8 (0.000517%)
CGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATG12 (0.000775%)
CGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCC7 (0.000452%)
CGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATAC37 (0.002390%)
CGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGG87 (0.005620%)
CGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACC25 (0.001615%)
CGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGC22 (0.001421%)
CGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCT35 (0.002261%)
CGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATG11 (0.000711%)
CGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTC13 (0.000840%)
CGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAA26 (0.001679%)
CGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTG21 (0.001356%)
CGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGG45 (0.002907%)
CGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTG8 (0.000517%)
CGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTG5 (0.000323%)
CGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCC288 (0.018603%)
CGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCA14 (0.000904%)
CGCCCTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGACGAGTCCACCACG301 (0.019443%)
CGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCA6 (0.000388%)
CGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCC10 (0.000646%)
CGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCT15 (0.000969%)
CGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTA25 (0.001615%)
CGCCTAATCAACAACCGTCTCCATTCTTTCCAACACTGACTAGTTAAACTTATTATCAAACAAATAATGCTAATCCACACACCAAAAGGACGAACATGAA3 (0.000194%)
CGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGC6 (0.000388%)
CGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCC7 (0.000452%)
CGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCT4 (0.000258%)
CGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGAT252 (0.016277%)
CGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCG20 (0.001292%)
CGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCAC36 (0.002325%)
CGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGG34 (0.002196%)
CGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCG27 (0.001744%)
CGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGG29 (0.001873%)
CGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGACTCTCTGCGCACACAG4 (0.000258%)
CGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTG18 (0.001163%)
CGCGGATGTGGTTTTCACAGCCAACGACTCTGGCCATCGCCACTACACCATCGCAGCCCTGCTCAGCCCATACTCCTACAGCACCACGGCTGTCGTCAGC189 (0.012208%)
CGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCTGCTGTAGACGTGGCTGTAAAAGTGTTCAAAAAG29 (0.001873%)
CGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCG26 (0.001679%)
CGCGTGCTCAGTCAGCTGCCTCACAGAACAGTTTGCCAGCGGGGTGGGGTCCAAAGCATGGCAAGTGGTCTCCAGTGTGTCAACTTCCATCTCATACACC13 (0.000840%)
CGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAG9 (0.000581%)
CGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGC6 (0.000388%)
CGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTG7 (0.000452%)
CGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTT11 (0.000711%)
CGCTGGACTGGTATTTGTGTCTGAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCT5 (0.000323%)
CGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGC3 (0.000194%)
CGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTA15 (0.000969%)
CGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTGCAGAGCTCCCAAGTCACACAAGAACTGACGGCACTGATGGAGGACACTATGACGGAAG3 (0.000194%)
CGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACC213 (0.013758%)
CGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGC281 (0.026863%)
CGGAAGAGCACACGTCTGAACTCCAGTCACCGTGTCAATG8 (0.000207%)
CGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCAT16 (0.001033%)
CGGACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGG31 (0.002002%)
CGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAA9 (0.000581%)
CGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCATTATCTTC6 (0.000388%)
CGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTC27 (0.001744%)
CGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCC17 (0.001098%)
CGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGAC197 (0.012725%)
CGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGG36 (0.002325%)
CGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTC92 (0.005943%)
CGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAA12 (0.000775%)
CGGCATCGTACACCCAACCCCCATCCAAGGTCATAGCATCGGCTTCACTTGCAGAAATGGCCTTGATGCAATCCGGATAGGAGGTTTTCTTCACACAGGC248 (0.016019%)
CGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATG15 (0.000969%)
CGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAG129 (0.008333%)
CGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCG8 (0.000517%)
CGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACT14 (0.000904%)
CGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGG237 (0.015309%)
CGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTA46 (0.002971%)
CGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACC7 (0.000452%)
CGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGC6 (0.000388%)
CGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTG22 (0.001421%)
CGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTG33 (0.002132%)
CGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGG8 (0.000517%)
CGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTT61 (0.003940%)
CGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAA219 (0.014146%)
CGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAG12 (0.000775%)
CGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGC10 (0.000646%)
CGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTA15 (0.000969%)
CGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTT7 (0.000452%)
CGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAG6 (0.000388%)
CGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAG3 (0.000194%)
CGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAA14 (0.000904%)
CGTACACCCAACCCCCATCCAAGGTCATAGCATCGGCTTCACTTGCAGAAATGGCCTTGATGCAATCCGGATAGGAGGTTTTCTTCACACAGGCAAGCCG13 (0.000840%)
CGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGA5 (0.000323%)
CGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTT9 (0.000581%)
CGTAGTAGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGCCACGGGCTTCAGGTTGTTCGGAGTCAGGCCGGCATCGTACACCCAACCCCC5 (0.000323%)
CGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAA8 (0.000517%)
CGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGC4 (0.000258%)
CGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTG7 (0.000452%)
CGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATC62 (0.004005%)
CGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTG4 (0.000258%)
CGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATC13 (0.000840%)
CGTGGATGTCCTTGATGCTTCGAGGTGGCCCGCCAGGTGCTCAGGAGAACGTGGTCTTCAACTTCTCCTTCACTTTGCCAAATGCCTCTGAGAACCAGGC22 (0.001421%)
CGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTG13 (0.000840%)
CGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGA26 (0.001679%)
CGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGG15 (0.000969%)
CGTTCACCTCCTCTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAA192 (0.012402%)
CGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGGCCCAAGGAGGAGGATTCAAACTGGGACA9 (0.000581%)
CGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGC35 (0.002261%)
CGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTG11 (0.000711%)
CTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAA12 (0.000775%)
CTAACATTGTTGGTCCATACGGCATTTTACAACCATTTGCAGACGCCATAAAATTATTTATAAAAGAACCAATACGCCCTTTAACAACCTCTATATCCTT7 (0.000452%)
CTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGA11 (0.000711%)
CTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCA26 (0.001679%)
CTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTT76 (0.004909%)
CTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCG22 (0.001421%)
CTAAGGATTCCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTT6 (0.000388%)
CTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAA67 (0.004328%)
CTAAGTCACACACAGCATCAGGATCTGTTGGCCAATGAGGCTTTTCCCTCTGCTGTTTCCTCACGCTGGGGGAAAGGGGAAAGCTGGGATCTCTGCCCAG3 (0.000194%)
CTAATCAACAACCGTCTCCATTCTTTCCAACACTGACTAGTTAAACTTATTATCAAACAAATAATGCTAATCCACACACCAAAAGGACGAACATGAACCC5 (0.000323%)
CTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGGTTCTACAT4 (0.000258%)
CTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGAT12 (0.000775%)
CTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTC9 (0.000581%)
CTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGG25 (0.001615%)
CTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAA3 (0.000194%)
CTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAGGTCTGCAGGCTGG3 (0.000194%)
CTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGA46 (0.002971%)
CTACTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGGTTCTA8 (0.000517%)
CTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCA22 (0.001421%)
CTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAGGTCTGCAGGC7 (0.000452%)
CTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAGGTCTGCA4 (0.000258%)
CTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTCCGATTAT8 (0.000517%)
CTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACC776 (0.050124%)
CTACTTCATGCCAGCTGCTGAACCACTTCAATTGCCAGCTATCAAGTTGCCAACTGGCAAAGACCTCTGTGGTCAGAGTACCACACAAGCCATGGACCAG4 (0.000258%)
CTAGAATGATAGAACGCTCAGAAGAATCCTGCAAAGAAAAATACTTCCGAGACGATGAATAGAATTATACCATATCGTAGTCCTTTTTGTACAATAGGAG7 (0.000452%)
CTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTC118 (0.007622%)
CTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGG9 (0.000581%)
CTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTAT55 (0.003553%)
CTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTT17 (0.001098%)
CTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTA26 (0.001679%)
CTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTA13 (0.000840%)
CTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGC9 (0.000581%)
CTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACC10 (0.000646%)
CTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGC12 (0.000775%)
CTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGATGGACCAGCTCCCGGTATAGGCTGATTGC13 (0.000840%)
CTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACC5 (0.000323%)
CTAGGTCATAGTTTATGTTTCTGTTCTCATTAATGTAACTAGAACACTGGAAAAAGGAAAAAGAAAGACATATTAACCAAAGGCTGCAGTCACTTTTCAG3 (0.000194%)
CTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTT8 (0.000517%)
CTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTG20 (0.001292%)
CTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACA16 (0.001033%)
CTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACC18 (0.001163%)
CTATCATTCTAGCCTCGTACCAACACATGATCTAGGAGGCTGCTGACCTCCAACAGGAATTTCACCACTTAACCCTCTAGAAGTCCCACTACTTAATACT3 (0.000194%)
CTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGG11 (0.000711%)
CTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTCAGAC3 (0.000194%)
CTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTT24 (0.001550%)
CTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTC44 (0.002842%)
CTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCA12 (0.000775%)
CTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAG38 (0.002455%)
CTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTCCGATTATTAG5 (0.000323%)
CTCAAAACGCCTAATCAACAACCGTCTCCATTCTTTCCAACACTGACTAGTTAAACTTATTATCAAACAAATAATGCTAATCCACACACCAAAAGGACGA17 (0.001098%)
CTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCT136 (0.008785%)
CTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAG18 (0.001163%)
CTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTCC10 (0.000646%)
CTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTTG3 (0.000194%)
CTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGC56 (0.003617%)
CTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTA12 (0.000775%)
CTCACGACTCAATAGCTGGAGTTGGTTGGTCCTCAGGGTTAGAATCCCAGAAGCCGGTGAACTTGTCAGTAAACTTGCTCCAGTAGCCTTTCAGGGATCT5 (0.000323%)
CTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGC17 (0.001098%)
CTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGT5 (0.000323%)
CTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTA38 (0.002455%)
CTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAAC14 (0.000904%)
CTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTG48 (0.003100%)
CTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTA25 (0.001615%)
CTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAG7 (0.000452%)
CTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAG13 (0.000840%)
CTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACA149 (0.009624%)
CTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTTGTGGAA6 (0.000388%)
CTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTC185 (0.011950%)
CTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGT44 (0.002842%)
CTCAGTCAGCTGCCTCACAGAACAGTTTGCCAGCGGGGTGGGGTCCAAAGCATGGCAAGTGGTCTCCAGTGTGTCAACTTCCATCTCATACACCACTCCG8 (0.000517%)
CTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGGAGTAGTAAGTAACTACATG6 (0.000388%)
CTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCAC3 (0.000194%)
CTCATAGTGGAATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCCAATAAATAT5 (0.000323%)
CTCATAGTTGTCAAATAAAAGGGAGTCCAGAGTTGGAATTACAACTGTACCCTTGGGGATGACATATCCTCGGAACACGGTGTCTCGGGTTGCTTCGTGG7 (0.000452%)
CTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCT7 (0.000452%)
CTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTT32 (0.002067%)
CTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATC29 (0.001873%)
CTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCC72 (0.004651%)
CTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACT17 (0.001098%)
CTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAA14 (0.000904%)
CTCATGTTACCGACAGATTGCATGTACTCCGCTCCTAAGTATTTTTCAGGTGTGGTACCCTCTGGAAGTTTAACGAAACATTTGGTGTCATCCCTGAACA10 (0.000646%)
CTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGG10 (0.000646%)
CTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTC11 (0.000711%)
CTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCAT6 (0.000388%)
CTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCC28 (0.001809%)
CTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCC21 (0.001356%)
CTCCACCGCGTGCTCAGTCAGCTGCCTCACAGAACAGTTTGCCAGCGGGGTGGGGTCCAAAGCATGGCAAGTGGTCTCCAGTGTGTCAACTTCCATCTCA7 (0.000452%)
CTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTG93 (0.006007%)
CTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATCC4 (0.000258%)
CTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCA29 (0.001873%)
CTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCAT51 (0.003294%)
CTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGC26 (0.001679%)
CTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCC4 (0.000258%)
CTCCAGGTTAGCAGTTGGCACTTTTTGGGCTAGTTTTATGAGATGGCTCAGCCTTGATTTTTCCTTTCCATATGCAGCATATTGTGAGCAGACTCTGTTT22 (0.001421%)
CTCCAGGTTATCCCAGAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGG8 (0.000517%)
CTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAA65 (0.004199%)
CTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTGTGATCTGCATTCCATCCT10 (0.000646%)
CTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCACCCAGCGCAGGTAATCCCAGAAG7 (0.000452%)
CTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACAAACCTGGGAGACTTTGCAATCAGCCTATACCGGGAGCTGGTCCATCAGTCCAACACT5 (0.000323%)
CTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGG48 (0.003100%)
CTCCCTCCACCGCGTGCTCAGTCAGCTGCCTCACAGAACAGTTTGCCAGCGGGGTGGGGTCCAAAGCATGGCAAGTGGTCTCCAGTGTGTCAACTTCCAT8 (0.000517%)
CTCCCTCCATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAA15 (0.000969%)
CTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACT8 (0.000517%)
CTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATG27 (0.001744%)
CTCCGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAG470 (0.030359%)
CTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGC28 (0.001809%)
CTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGC3 (0.000194%)
CTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACC4 (0.000258%)
CTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCG3 (0.000194%)
CTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAG62 (0.004005%)
CTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAAC60 (0.003876%)
CTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCC36 (0.002325%)
CTCCTCTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCC4 (0.000258%)
CTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAAC111 (0.007170%)
CTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGC9 (0.000581%)
CTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCTGTAGGAGTATGGGCTGAGCAGGGCTGCGATGGTGTAGTGGCGATGGC5 (0.000323%)
CTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAAGTTGAAACCATTTGAACTATTCTA192 (0.012402%)
CTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGA41 (0.002648%)
CTCCTTCTCTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAG17 (0.001098%)
CTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTA4 (0.000258%)
CTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCT9 (0.000581%)
CTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCA3 (0.000194%)
CTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCT61 (0.003940%)
CTCGACAAATGTGTGTTACTGATGAAAAGGCTGTTATTGTATCTGATGTGTAGTGTATGGCTAAGAAAAGACCTGTAATGATTTGGACTATTAGGCAGAC4 (0.000258%)
CTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAAT20 (0.001292%)
CTCGCTGGACTGGTATTTGTGTCTGAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCC6 (0.000388%)
CTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGC37 (0.002390%)
CTCGGATCCCTTCTCATGCTGTTGTGGCTCGAAAAAACAATGGCAAGGAAGACTTGATCTGGGAGATTCTCAAAGTGGCACAGGAACACTTTGGCAAAGG61 (0.003940%)
CTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGG57 (0.003682%)
CTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAA20 (0.001292%)
CTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCT13 (0.000840%)
CTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTC21 (0.001356%)
CTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCT58 (0.003746%)
CTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAA30 (0.001938%)
CTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAATAATTATGTATATTGAGTATATACCTGTAATAATAAT27 (0.001744%)
CTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTT9 (0.000581%)
CTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTG3 (0.000194%)
CTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCA16 (0.001033%)
CTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAAGTTGAAACCATTTGAACTATTCTACCAGCTGTAA7 (0.000452%)
CTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTT8 (0.000517%)
CTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCG11 (0.000711%)
CTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCC3 (0.000194%)
CTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGC33 (0.002132%)
CTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGC24 (0.001550%)
CTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCA6 (0.000388%)
CTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGAT20 (0.001292%)
CTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAA15 (0.000969%)
CTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGG34 (0.002196%)
CTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAA17 (0.001098%)
CTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCA5 (0.000323%)
CTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAG67 (0.004328%)
CTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTC5 (0.000323%)
CTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAA5 (0.000323%)
CTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCTCCAGCGCAGGTCTGGCTTTCTCGCCAAGTGTCTTCAGGTGGG7 (0.000452%)
CTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTGTATGT22 (0.001421%)
CTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTT17 (0.001098%)
CTCTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAG10 (0.000646%)
CTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATT31 (0.002002%)
CTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACAC7 (0.000452%)
CTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCA11 (0.000711%)
CTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGACGAGTCCACCACGGTGAAGGTGCCCATGATGA6 (0.000388%)
CTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACT9 (0.000581%)
CTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTG155 (0.010012%)
CTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCA29 (0.001873%)
CTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTA45 (0.002907%)
CTGAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCTGCTGTAGACGTGGCTGTAAA10 (0.000646%)
CTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAA13 (0.000840%)
CTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTGTATGTGGATGCGGTCA8 (0.000517%)
CTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTA53 (0.003423%)
CTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTA3 (0.000194%)
CTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTT91 (0.005878%)
CTGACCCTCCTGCTGCTGCTGCTGGCTGGGGATAGAGCCTTCTCAGATCCCGAAGCTACCAGCCACAGCACCCAGGATCCACTGGAGGCTCAAGCGAAAA23 (0.001486%)
CTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATC23 (0.001486%)
CTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGA27 (0.001744%)
CTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAG8 (0.000517%)
CTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACA102 (0.009751%)
CTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTC104 (0.006718%)
CTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGT25 (0.001615%)
CTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGG50 (0.003230%)
CTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTGTGATCTGCATTC8 (0.000517%)
CTGAGCGTTCTATCATTCTAGCCTCGTACCAACACATGATCTAGGAGGCTGCTGACCTCCAACAGGAATTTCACCACTTAACCCTCTAGAAGTCCCACTA3 (0.000194%)
CTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACAAACCTGGGAGACTTTGCAATCAGCCTATACCG3 (0.000194%)
CTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATA87 (0.005620%)
CTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGA43 (0.002778%)
CTGAGGTCTTGGCCTTCTCCATCAAATCTTTGCCATAATCAGTCATGCTCTGAAAGTATTGAGTGAACAGGCTCTGCATATCCGGTCCGTCTGCCTGTCT297 (0.019184%)
CTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTA69 (0.004457%)
CTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCTGTAGGAGTATGGGCTGAGCAGGGCTGCGATGGTGTAGTGGCGATGGCCAGAGTCG4 (0.000258%)
CTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGAC26 (0.001679%)
CTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACT44 (0.002842%)
CTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTG38 (0.002455%)
CTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCAC13 (0.000840%)
CTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATG19 (0.001227%)
CTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGA24 (0.001550%)
CTGCAACACAGAAGTCTCACGACTCAATAGCTGGAGTTGGTTGGTCCTCAGGGTTAGAATCCCAGAAGCCGGTGAACTTGTCAGTAAACTTGCTCCAGTA26 (0.001679%)
CTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCG14 (0.000904%)
CTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATG102 (0.006589%)
CTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATA19 (0.001227%)
CTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAG3 (0.000194%)
CTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTG10 (0.000646%)
CTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTG15 (0.000969%)
CTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACT4 (0.000258%)
CTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCC40 (0.002584%)
CTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCC14 (0.000904%)
CTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAA12 (0.000775%)
CTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGC6 (0.000388%)
CTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAA4 (0.000258%)
CTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCA68 (0.004392%)
CTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGC18 (0.001163%)
CTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAG25 (0.001615%)
CTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATC3 (0.000194%)
CTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCA13 (0.000840%)
CTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGA11 (0.000711%)
CTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTG55 (0.003553%)
CTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAG31 (0.002002%)
CTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGT6 (0.000388%)
CTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACA4 (0.000258%)
CTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGAT45 (0.002907%)
CTGCGCTGCCCTGGGGCTGTGTCTGGCTGTCCCTGACAAAACGGTCAAATGGTGCGCAGTGTCAGAGCACGAGAATACCAAGTGCATCAGCTTCCGTGAC6 (0.000388%)
CTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTT11 (0.000711%)
CTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTA7 (0.000452%)
CTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGG8 (0.000517%)
CTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTC15 (0.000969%)
CTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCA41 (0.002648%)
CTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCC3 (0.000194%)
CTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATG25 (0.001615%)
CTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCAC7 (0.000452%)
CTGCTGGCCTGCGCTGCCCTGGGGCTGTGTCTGGCTGTCCCTGACAAAACGGTCAAATGGTGCGCAGTGTCAGAGCACGAGAATACCAAGTGCATCAGCT402 (0.025966%)
CTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGA27 (0.001744%)
CTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTCC3 (0.000194%)
CTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCT4 (0.000258%)
CTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAA9 (0.000581%)
CTGGAAGTCTGTTCCCTTCTTTACCACAGCCACAGCGTAGTAGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGCCACGGGCTTCAGGTTG22 (0.001421%)
CTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCG36 (0.002325%)
CTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGT63 (0.004069%)
CTGGACTGGTATTTGTGTCTGAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCTGC10 (0.000646%)
CTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTT17 (0.001098%)
CTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCAC24 (0.001550%)
CTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTCCTCACATA58 (0.003746%)
CTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCT14 (0.000904%)
CTGGATCTGCACAGGGGACACAACTGCCCGAGAAGAAACTGGACACAGCTTTCTCAAGAGGACTGCGGGGCTCCGACAGCTTACAGAAGAGCAAGCCAAT5 (0.000323%)
CTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGACGAGTCCACCACGGTGA5 (0.000323%)
CTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGG85 (0.005490%)
CTGGCACATTACGTGGATGTCCTTGATGCTTCGAGGTGGCCCGCCAGGTGCTCAGGAGAACGTGGTCTTCAACTTCTCCTTCACTTTGCCAAATGCCTCT30 (0.001938%)
CTGGCCCACCTTAGGAGAATGAAGAGTTTCTCCCGAGGCCGACTCCACCGAGGCCACAGGAGAGAAGGCGTGGCGTAGGTCGTGGTAAGTTCGGTGGTCT7 (0.000452%)
CTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCTGCTGTAGACGTGGCTGTAAAAGTGTT14 (0.000904%)
CTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTA15 (0.000969%)
CTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCC37 (0.002390%)
CTGGCCTGCGCTGCCCTGGGGCTGTGTCTGGCTGTCCCTGACAAAACGGTCAAATGGTGCGCAGTGTCAGAGCACGAGAATACCAAGTGCATCAGCTTCC25 (0.001615%)
CTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTC620 (0.040048%)
CTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGC4 (0.000258%)
CTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGT3 (0.000194%)
CTGGGACACTCTGGGTTCAACCGTTAGTCAGCTGCAGGAACGGCTGGGCCCATTGACTCGGGACTTCTGGGATAACCTGGAGAAAGAAACAGATTGGGTG9 (0.000581%)
CTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGT29 (0.001873%)
CTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGAC58 (0.003746%)
CTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACAC252 (0.016277%)
CTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCA26 (0.001679%)
CTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCC21 (0.001356%)
CTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCTGTAGGAGTATGGGCTGAGCAGGGCTGCGATGGTGTAGTGGCGATGGCCAG7 (0.000452%)
CTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGA19 (0.001227%)
CTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGA25 (0.001615%)
CTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTT70 (0.004522%)
CTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTT22 (0.001421%)
CTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTG40 (0.002584%)
CTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATA8 (0.000517%)
CTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACA31 (0.002002%)
CTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAAT21 (0.001356%)
CTGGTATTTGTGTCTGAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCTGCTGTAG8 (0.000517%)
CTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTG20 (0.001292%)
CTGGTCCAGTGTCCCCCATGTGCCCAGGGAGGATCAGACACTTCAAAATCTAGGCTTGATTCGGGGAAGTAAGGTTTTGGCAGACAGGACATAGCCACCA4 (0.000258%)
CTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTA77 (0.004974%)
CTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCTGTAGGAGTATGGGCTGAGCAGGGCTGCGATGGTGTAGTGGC11 (0.000711%)
CTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTGTATGTGG11 (0.000711%)
CTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTC8 (0.000517%)
CTGGTTCAGCTGGAAGTCTGTTCCCTTCTTTACCACAGCCACAGCGTAGTAGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGCCACGGGC3 (0.000194%)
CTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTAT5 (0.000323%)
CTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTG14 (0.000904%)
CTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTT59 (0.003811%)
CTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTTGACACC327 (0.021122%)
CTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAA5 (0.000323%)
CTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAA7 (0.000452%)
CTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTC35 (0.002261%)
CTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGC34 (0.002196%)
CTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACAC3 (0.000194%)
CTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGG19 (0.001227%)
CTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATG9 (0.000581%)
CTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGC11 (0.000711%)
CTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGC28 (0.001809%)
CTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTG14 (0.000904%)
CTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGA8 (0.000517%)
CTGTTCCCTTCTTTACCACAGCCACAGCGTAGTAGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGCCACGGGCTTCAGGTTGTTCGGAGT6 (0.000388%)
CTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTAT7 (0.000452%)
CTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTC14 (0.000904%)
CTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAG6 (0.000388%)
CTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCG52 (0.003359%)
CTTAGGGTACATACAACTACGAAAAGGCCCTAACATTGTTGGTCCATACGGCATTTTACAACCATTTGCAGACGCCATAAAATTATTTATAAAAGAACCA7 (0.000452%)
CTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTT20 (0.001292%)
CTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAAGTTGAAACCATTTGAACTATTCTACCA17 (0.001098%)
CTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATC8 (0.000517%)
CTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCC72 (0.004651%)
CTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATAT32 (0.002067%)
CTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCAT53 (0.003423%)
CTTCAATTGCCAGCTATCAAGTTGCCAACTGGCAAAGACCTCTGTGGTCAGAGTACCACACAAGCCATGGACCAGTATACATTTGAACTAAGCAGAAGGA4 (0.000258%)
CTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCG8 (0.000517%)
CTTCAGGATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGG12 (0.000775%)
CTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTT36 (0.002325%)
CTTCATGCCAGCTGCTGAACCACTTCAATTGCCAGCTATCAAGTTGCCAACTGGCAAAGACCTCTGTGGTCAGAGTACCACACAAGCCATGGACCAGTAT7 (0.000452%)
CTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAG22 (0.001421%)
CTTCATTCTCCTAAGGTGGGCCAGCCTGGTGCTGCTGGTCCAGTGTCCCCCATGTGCCCAGGGAGGATCAGACACTTCAAAATCTAGGCTTGATTCGGGG13 (0.000840%)
CTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTCCTCACATAGTTGTGCAAACCTTTCCT17 (0.001098%)
CTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGG69 (0.004457%)
CTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCAC22 (0.001421%)
CTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCT6 (0.000388%)
CTTCCAACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGGCTGTAC3 (0.000194%)
CTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACAC45 (0.002907%)
CTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCACCCAGCG9 (0.000581%)
CTTCCTCATGTTACCGACAGATTGCATGTACTCCGCTCCTAAGTATTTTTCAGGTGTGGTACCCTCTGGAAGTTTAACGAAACATTTGGTGTCATCCCTG9 (0.000581%)
CTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGT4 (0.000258%)
CTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACC24 (0.001550%)
CTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTGTATGTGGATGCG4 (0.000258%)
CTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAA17 (0.001098%)
CTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGG32 (0.002067%)
CTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCGGCTT14 (0.000904%)
CTTCGAGCTGGTTCAGCTGGAAGTCTGTTCCCTTCTTTACCACAGCCACAGCGTAGTAGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGC42 (0.002713%)
CTTCGAGGTGGCCCGCCAGGTGCTCAGGAGAACGTGGTCTTCAACTTCTCCTTCACTTTGCCAAATGCCTCTGAGAACCAGGCCCGGGTCTTGGTCAAAA9 (0.000581%)
CTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTC30 (0.001938%)
CTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTCCGAT3 (0.000194%)
CTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCC5 (0.000323%)
CTTCTCCATCAAATCTTTGCCATAATCAGTCATGCTCTGAAAGTATTGAGTGAACAGGCTCTGCATATCCGGTCCGTCTGCCTGTCTCTTAACCAAAGCT4 (0.000258%)
CTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTC30 (0.001938%)
CTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAG135 (0.008720%)
CTTCTCTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCAT10 (0.000646%)
CTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCA57 (0.003682%)
CTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAAC4 (0.000258%)
CTTCTTTACCACAGCCACAGCGTAGTAGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGCCACGGGCTTCAGGTTGTTCGGAGTCAGGCCG7 (0.000452%)
CTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGG21 (0.001356%)
CTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAG759 (0.049026%)
CTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACT11 (0.000711%)
CTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGT36 (0.002325%)
CTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGC6 (0.000388%)
CTTGATGCTTCGAGGTGGCCCGCCAGGTGCTCAGGAGAACGTGGTCTTCAACTTCTCCTTCACTTTGCCAAATGCCTCTGAGAACCAGGCCCGGGTCTTG13 (0.000840%)
CTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGG39 (0.002519%)
CTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTC26 (0.001679%)
CTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAG5 (0.000323%)
CTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAG22 (0.001421%)
CTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAG16 (0.001033%)
CTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGATGGACCAGCTCCCGGTATAGG10 (0.000646%)
CTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCA4 (0.000258%)
CTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGT8 (0.000517%)
CTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCT17 (0.001098%)
CTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTA50 (0.003230%)
CTTGGCCTTCTCCATCAAATCTTTGCCATAATCAGTCATGCTCTGAAAGTATTGAGTGAACAGGCTCTGCATATCCGGTCCGTCTGCCTGTCTCTTAACC10 (0.000646%)
CTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCT8 (0.000517%)
CTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCA24 (0.001550%)
CTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGG42 (0.002713%)
CTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCC14 (0.000904%)
CTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAA21 (0.001356%)
CTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACT20 (0.001292%)
CTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCA388 (0.025062%)
CTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATC71 (0.004586%)
CTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACA31 (0.002002%)
CTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGG10 (0.000646%)
CTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTC58 (0.003746%)
CTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGACGAGTCCACCACGGTGAAGGTGCCCATGATGACC4 (0.000258%)
CTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAG36 (0.002325%)
CTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTG46 (0.002971%)
CTTTACCACAGCCACAGCGTAGTAGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGCCACGGGCTTCAGGTTGTTCGGAGTCAGGCCGGCA18 (0.001163%)
CTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTG29 (0.001873%)
CTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGA112 (0.007234%)
CTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCACC14 (0.000904%)
CTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACC28 (0.001809%)
CTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCAT18 (0.001163%)
CTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGT41 (0.002648%)
CTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAA25 (0.001615%)
CTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGG37 (0.002390%)
CTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGG69 (0.004457%)
CTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTG313 (0.020218%)
CTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTA30 (0.001938%)
CTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTC41 (0.002648%)
CTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGC21 (0.001356%)
CTTTGACACCGGTAGGAATTGCGATAATTATAGTGGCTGATGTAAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATAC96 (0.006201%)
CTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGTCAGAAATCGTGCATGAAGGGAAGAAA11 (0.000711%)
CTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGT17 (0.001098%)
CTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAA5 (0.000323%)
CTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTT14 (0.000904%)
CTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCAT59 (0.003811%)
CTTTGCCTCGCTGGACTGGTATTTGTGTCTGAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAG579 (0.037399%)
CTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCAC57 (0.003682%)
CTTTGGCAAAGGCAAATCAAAAGACTTCCAACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCC216 (0.013952%)
CTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGG62 (0.004005%)
CTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAA31 (0.002002%)
CTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAA4 (0.000258%)
CTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCG112 (0.007234%)
CTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACA20 (0.001292%)
CTTTTAGTTGCTTACACCAAGAATTATCTCTCTATGGTTGGATCCTGCTGTACTTCTGCAAACCCAACTGTATGCTTTGTGAAGGAGAGACTCCAGATGA6 (0.000388%)
CTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCC4 (0.000258%)
CTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGC18 (0.001163%)
CTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATA30 (0.001938%)
CTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGAT13 (0.000840%)
CTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGAC18 (0.001163%)
CTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAG34 (0.002196%)
GAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACA82 (0.005297%)
GAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTG104 (0.006718%)
GAAAAGGCCCTAACATTGTTGGTCCATACGGCATTTTACAACCATTTGCAGACGCCATAAAATTATTTATAAAAGAACCAATACGCCCTTTAACAACCTC4 (0.000258%)
GAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCA83 (0.005361%)
GAAAATGACTCCCTCCATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACC327 (0.021122%)
GAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGG72 (0.004651%)
GAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAA41 (0.002648%)
GAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTG8 (0.000517%)
GAAACTCATAGTTGTCAAATAAAAGGGAGTCCAGAGTTGGAATTACAACTGTACCCTTGGGGATGACATATCCTCGGAACACGGTGTCTCGGGTTGCTTC8 (0.000517%)
GAAACTCTTCATTCTCCTAAGGTGGGCCAGCCTGGTGCTGCTGGTCCAGTGTCCCCCATGTGCCCAGGGAGGATCAGACACTTCAAAATCTAGGCTTGAT107 (0.006911%)
GAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTG19 (0.001227%)
GAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGC18 (0.001163%)
GAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAAC13 (0.000840%)
GAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAG50 (0.003230%)
GAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTG18 (0.001163%)
GAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATT21 (0.001356%)
GAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACAC38 (0.002455%)
GAAATAATTCCAAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGG4 (0.000258%)
GAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCT44 (0.002842%)
GAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCAC13 (0.000840%)
GAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCC19 (0.001227%)
GAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGG55 (0.003553%)
GAACAAACGTAACCTCATATAGTTTTCTAATTAGTTTAACCAGCCTAACACTTCTATGACAAACCGACGAAAATTATAAAAACTTTTCAAATATATTCTC115 (0.007428%)
GAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACT13 (0.000840%)
GAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTG4 (0.000258%)
GAACAGGCACATCTGCAACACAGAAGTCTCACGACTCAATAGCTGGAGTTGGTTGGTCCTCAGGGTTAGAATCCCAGAAGCCGGTGAACTTGTCAGTAAA4 (0.000258%)
GAACATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCC5 (0.000323%)
GAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCT51 (0.003294%)
GAACGCAAAATCTTAGGGTACATACAACTACGAAAAGGCCCTAACATTGTTGGTCCATACGGCATTTTACAACCATTTGCAGACGCCATAAAATTATTTA5 (0.000323%)
GAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATG11 (0.000711%)
GAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAA11 (0.000711%)
GAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCT27 (0.001744%)
GAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATG15 (0.000969%)
GAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGA24 (0.001550%)
GAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTG3 (0.000194%)
GAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTT3 (0.000194%)
GAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGTCAGAAATCGTGCATGAAGGGAAG3 (0.000194%)
GAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAG11 (0.000711%)
GAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTGTG4 (0.000258%)
GAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACA39 (0.002519%)
GAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATG32 (0.002067%)
GAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTG6 (0.000388%)
GAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCC3 (0.000194%)
GAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTC66 (0.004263%)
GAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGG20 (0.001292%)
GAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGAC53 (0.003423%)
GAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACT27 (0.001744%)
GAAGAGCACACGTCTGAACTCCAGTCACCGTGTCAATGAT14 (0.000362%)
GAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAG16 (0.001033%)
GAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCA7 (0.000452%)
GAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAAT36 (0.002325%)
GAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACG7 (0.000452%)
GAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACT7 (0.000452%)
GAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGACTCTCTGCGCACACAGCTAGCGCCC3 (0.000194%)
GAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTC17 (0.001098%)
GAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCTGCTGTAGACGTGGCTGTAAAAG6 (0.000388%)
GAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCA23 (0.001486%)
GAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGT20 (0.001292%)
GAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGC9 (0.000581%)
GAAGGCCACTGGATCTGCACAGGGGACACAACTGCCCGAGAAGAAACTGGACACAGCTTTCTCAAGAGGACTGCGGGGCTCCGACAGCTTACAGAAGAGC3 (0.000194%)
GAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGA7 (0.000452%)
GAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCA8 (0.000517%)
GAAGGGCTATTAGTGTTAGTTCTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAATAATTATGTATATTGA4 (0.000258%)
GAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTG24 (0.001550%)
GAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAG5 (0.000323%)
GAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTT9 (0.000581%)
GAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTC10 (0.000646%)
GAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTA5 (0.000323%)
GAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGGCCC3 (0.000194%)
GAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGAT7 (0.000452%)
GAAGTCTGTTCCCTTCTTTACCACAGCCACAGCGTAGTAGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGCCACGGGCTTCAGGTTGTTC7 (0.000452%)
GAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATC30 (0.001938%)
GAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGAT5 (0.000323%)
GAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAG6 (0.000388%)
GAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCT4 (0.000258%)
GAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACA5 (0.000323%)
GAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGAC6 (0.000388%)
GAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACT5 (0.000323%)
GAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGGAGTAG6 (0.000388%)
GAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATC34 (0.002196%)
GAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCA17 (0.001098%)
GAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATG12 (0.000775%)
GAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGT4 (0.000258%)
GAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGA166 (0.010722%)
GAATGATAGAACGCTCAGAAGAATCCTGCAAAGAAAAATACTTCCGAGACGATGAATAGAATTATACCATATCGTAGTCCTTTTTGTACAATAGGAGTGT5 (0.000323%)
GAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGC7 (0.000452%)
GAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAAT4 (0.000258%)
GAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAA5 (0.000323%)
GACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATG63 (0.004069%)
GACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTAT3 (0.000194%)
GACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTT12 (0.000775%)
GACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCA19 (0.001227%)
GACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTA9 (0.000581%)
GACACCGGTAGGAATTGCGATAATTATAGTGGCTGATGTAAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATA8 (0.000517%)
GACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACAAACCTGGGAGACTTTGCAATCAGCCTATACCGGGAGCTGGTCCATCAGTCCA3 (0.000194%)
GACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGT14 (0.000904%)
GACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTG7 (0.000452%)
GACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACAAACCTGGGAGACTTTGCAATCAGCCTATACCGGGAGCTGGTCCATCAG4 (0.000258%)
GACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGT16 (0.001033%)
GACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTG6 (0.000388%)
GACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTG12 (0.000775%)
GACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTG5 (0.000323%)
GACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTGTATGTGGATGCGGTCAAA3 (0.000194%)
GACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCA7 (0.000452%)
GACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAG3 (0.000194%)
GACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTC4 (0.000258%)
GACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCT8 (0.000517%)
GACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACC5 (0.000323%)
GACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGAT3 (0.000194%)
GACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACAC3 (0.000194%)
GACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCA5 (0.000323%)
GACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATC7 (0.000452%)
GACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCA4 (0.000258%)
GACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCC7 (0.000452%)
GACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTT8 (0.000517%)
GACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAA3 (0.000194%)
GACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGA6 (0.000388%)
GACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAAC3 (0.000194%)
GACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTG5 (0.000323%)
GACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTC4 (0.000258%)
GACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTAT12 (0.000775%)
GACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAA9 (0.000581%)
GACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAA3 (0.000194%)
GACTCCCTCCATCTCATGGGGTCTACTGCTTCTGGCAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAG9 (0.000581%)
GACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCG3 (0.000194%)
GACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAG11 (0.000711%)
GACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCA5 (0.000323%)
GACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTG14 (0.000904%)
GACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGT7 (0.000452%)
GACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTT3 (0.000194%)
GACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCC8 (0.000517%)
GACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAAC3 (0.000194%)
GAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGA12 (0.000775%)
GAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGA7 (0.000452%)
GAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGTCAGAAATCGTGCATGAAGGGA4 (0.000258%)
GAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATG17 (0.001098%)
GAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGA13 (0.000840%)
GAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGAT5 (0.000323%)
GAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCC13 (0.000840%)
GAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGG10 (0.000646%)
GAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACAAACCTGGGAGACTTTGCAATCAGCCTATACCGGGAGCTGGTCCATC5 (0.000323%)
GAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGC9 (0.000581%)
GAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCT17 (0.001098%)
GAGACTATGTGTCCCAGTTTGAATCCTCCTCCTTGGGCCAACAGCTGAACCTGAATCTCCTGGAAAACTGGGACACTCTGGGTTCAACCGTTAGTCAGCT3 (0.000194%)
GAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGT20 (0.001292%)
GAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTT7 (0.000452%)
GAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAA10 (0.000646%)
GAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAG11 (0.000711%)
GAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTC21 (0.001356%)
GAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATG19 (0.001227%)
GAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTG6 (0.000388%)
GAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGG18 (0.001163%)
GAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGT4809 (0.124252%)
GAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTC29 (0.001873%)
GAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACC30 (0.001938%)
GAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTC5 (0.000323%)
GAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCATTATCTTCTA12 (0.000775%)
GAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAAC75 (0.004844%)
GAGCACTTCCTCATGTTACCGACAGATTGCATGTACTCCGCTCCTAAGTATTTTTCAGGTGTGGTACCCTCTGGAAGTTTAACGAAACATTTGGTGTCAT265 (0.017117%)
GAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAAT27 (0.001744%)
GAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGA9 (0.000581%)
GAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCT9 (0.000581%)
GAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTA43 (0.002778%)
GAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACC4 (0.000258%)
GAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTG26 (0.001679%)
GAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAG27 (0.001744%)
GAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAA5 (0.000323%)
GAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAAT3 (0.000194%)
GAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTC9 (0.000581%)
GAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCAC11 (0.000711%)
GAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGACTCTCTGCGCACA3 (0.000194%)
GAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGC5 (0.000323%)
GAGCTGGTTCAGCTGGAAGTCTGTTCCCTTCTTTACCACAGCCACAGCGTAGTAGTAGGTCTGTGGATGTTCCACTGATCCATAAAACTCCGCCGCCACG4 (0.000258%)
GAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAA25 (0.001615%)
GAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCG12 (0.000775%)
GAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTAT7 (0.000452%)
GAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGG8 (0.000517%)
GAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGC7 (0.000452%)
GAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGG9 (0.000581%)
GAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATG11 (0.000711%)
GAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAAC11 (0.000711%)
GAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATC9 (0.000581%)
GAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGC9 (0.000581%)
GAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGA3 (0.000194%)
GAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTG5 (0.000323%)
GAGGGACCTGGCACATTACGTGGATGTCCTTGATGCTTCGAGGTGGCCCGCCAGGTGCTCAGGAGAACGTGGTCTTCAACTTCTCCTTCACTTTGCCAAA213 (0.013758%)
GAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGG10 (0.000646%)
GAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCC3 (0.000194%)
GAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAATAATTATGTATATTGAGTATATACCTGTAATAATAATGTTAATTCCTA6 (0.000388%)
GAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGG6 (0.000388%)
GAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAG3 (0.000194%)
GAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGG10 (0.000646%)
GAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGG4 (0.000258%)
GAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATT9 (0.000581%)
GAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAG5 (0.000323%)
GAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGGCCCAAGGAGGA3 (0.000194%)
GAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTT4 (0.000258%)
GAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTT11 (0.000711%)
GAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGA4 (0.000258%)
GAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGATGGACCAGCTC3 (0.000194%)
GAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAG3 (0.000194%)
GATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACC7 (0.000452%)
GATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAA9 (0.000581%)
GATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCATGGGCT3 (0.000194%)
GATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGCAGCGATTGGCA3 (0.000194%)
GATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTC5 (0.000323%)
GATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGT7 (0.000452%)
GATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGG3 (0.000194%)
GATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCT4 (0.000258%)
GATATTTTCTCTAAGGATTCCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGC204 (0.013177%)
GATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATCCTAATCATATTCTT4 (0.000258%)
GATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGT22 (0.001421%)
GATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATG9 (0.000581%)
GATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGC20 (0.001292%)
GATCAGTGGAACATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCA7 (0.000452%)
GATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAG4 (0.000258%)
GATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGA11 (0.000711%)
GATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTT4 (0.000258%)
GATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCTGTAGGAGTATGGGCTGAGCAGGGCTGCGATGGTGTAG5 (0.000323%)
GATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACC7 (0.000452%)
GATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGG3 (0.000194%)
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGTCA32 (0.000827%)
GATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCA9 (0.000581%)
GATCTGCACAGGGGACACAACTGCCCGAGAAGAAACTGGACACAGCTTTCTCAAGAGGACTGCGGGGCTCCGACAGCTTACAGAAGAGCAAGCCAATGGG5 (0.000323%)
GATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGC4 (0.000258%)
GATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGG7 (0.000452%)
GATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAA19 (0.001227%)
GATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAA12 (0.000775%)
GATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAG3 (0.000194%)
GATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGC13 (0.000840%)
GATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACT7 (0.000452%)
GATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTT6 (0.000388%)
GATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAG15 (0.000969%)
GATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTCCGATTATTAGTGGGA3 (0.000194%)
GATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCC3 (0.000194%)
GATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCC4 (0.000258%)
GATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGCCTGGAGGC4 (0.000258%)
GATGCTTCGAGGTGGCCCGCCAGGTGCTCAGGAGAACGTGGTCTTCAACTTCTCCTTCACTTTGCCAAATGCCTCTGAGAACCAGGCCCGGGTCTTGGTC3 (0.000194%)
GATGGAGGAACAGGCACATCTGCAACACAGAAGTCTCACGACTCAATAGCTGGAGTTGGTTGGTCCTCAGGGTTAGAATCCCAGAAGCCGGTGAACTTGT97 (0.006266%)
GATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCC6 (0.000388%)