fastp report
General
fastp version:0.23.1 (https://github.com/OpenGene/fastp)
sequencing:paired end (150 cycles + 150 cycles)
mean length before filtering:150bp, 150bp
mean length after filtering:143bp, 143bp
duplication rate:26.087236%
Insert size peak:264
Before filtering
total reads:47.377652 M
total bases:7.106648 G
Q20 bases:6.962365 G (97.969746%)
Q30 bases:6.706424 G (94.368322%)
GC content:49.553820%
After filtering
total reads:47.099096 M
total bases:6.768073 G
Q20 bases:6.658664 G (98.383453%)
Q30 bases:6.422322 G (94.891442%)
GC content:49.471994%
Filtering result
reads passed filters:47.099096 M (99.412052%)
reads with low quality:222.368000 K (0.469352%)
reads with too many N:32.394000 K (0.068374%)
reads too short:23.794000 K (0.050222%)
Adapter or bad ligation of read1
The input has little adapter percentage (~0.912434%), probably it's trimmed before.
SequenceOccurrences
A17556
AG18849
AGA19592
AGAT18460
AGATC17625
AGATCG18920
AGATCGG17579
AGATCGGA16584
AGATCGGAA15619
AGATCGGAAG15642
AGATCGGAAGA14671
AGATCGGAAGAG15556
AGATCGGAAGAGC15898
AGATCGGAAGAGCA16211
AGATCGGAAGAGCAC17077
AGATCGGAAGAGCACA17373
AGATCGGAAGAGCACAC15171
AGATCGGAAGAGCACACG29137
AGATCGGAAGAGCACACGT12739
AGATCGGAAGAGCACACGTC12853
AGATCGGAAGAGCACACGTCTGAA12480
AGATCGGAAGAGCACACGTCTGAAC13052
AGATCGGAAGAGCACACGTCTGAACT13926
AGATCGGAAGAGCACACGTCTGAACTC12004
AGATCGGAAGAGCACACGTCTGAACTCC12129
AGATCGGAAGAGCACACGTCTGAACTCCA10481
AGATCGGAAGAGCACACGTCTGAACTCCAG10100
AGATCGGAAGAGCACACGTCTGAACTCCAGT9812
AGATCGGAAGAGCACACGTCTGAACTCCAGTC10808
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA11902
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC11267
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACG12167
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGT11236
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTT10338
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTA10122
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTAG10135
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTAGC14874
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTAGCCTA9861
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTAGCCTAGA24882
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTAGCCTAGAT11314
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTAGCCTAGATCTCGTA10160
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTAGCCTAGATCTCGTATGCCG9921
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTAGCCTAGATCTCGTATGCCGTCTTCTGCTTGAAAA15754
other adapter sequences353991
Adapter or bad ligation of read2
The input has little adapter percentage (~0.942107%), probably it's trimmed before.
SequenceOccurrences
A19707
AG18601
AGA19570
AGAT19195
AGATC18180
AGATCG21962
AGATCGG17321
AGATCGGA16152
AGATCGGAA14318
AGATCGGAAG14467
AGATCGGAAGA14354
AGATCGGAAGAG17259
AGATCGGAAGAGC16165
AGATCGGAAGAGCG16579
AGATCGGAAGAGCGT22726
AGATCGGAAGAGCGTC14720
AGATCGGAAGAGCGTCG21739
AGATCGGAAGAGCGTCGT15623
AGATCGGAAGAGCGTCGTG12301
AGATCGGAAGAGCGTCGTGTAG13652
AGATCGGAAGAGCGTCGTGTAGG22099
AGATCGGAAGAGCGTCGTGTAGGG17207
AGATCGGAAGAGCGTCGTGTAGGGA12956
AGATCGGAAGAGCGTCGTGTAGGGAAAGAG11134
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGT11372
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG10182
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT11987
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTT12457
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTT13264
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTTG11290
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTTGA10079
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTTGATGTCGCGTG10419
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTTGATGTCGCGTGTAGATCTCGGTGGTCGC11384
other adapter sequences476635
This estimation is based on paired-end overlap analysis, and there are 57.674347% reads found not overlapped.
The nonoverlapped read pairs may have insert size <30 or >270, or contain too much sequencing errors to be detected as overlapped.
Value of each position will be shown on mouse over.
Value of each position will be shown on mouse over.
Darker background means larger counts. The count will be shown on mouse over.
AAATACAGTATTTCTGCACTCCCGGAGTGCGG
AAAAAAAAAAAATAAAACAAAAGAAATAAAATTAAATCAAATGAAACAAAACTAAACCAAACGAAAGAAAAGTAAAGCAAAGG
AATAATAAAATATAATACAATAGAATTAAATTTAATTCAATTGAATCAAATCTAATCCAATCGAATGAAATGTAATGCAATGG
AACAACAAAACATAACACAACAGAACTAAACTTAACTCAACTGAACCAAACCTAACCCAACCGAACGAAACGTAACGCAACGG
AAGAAGAAAAGATAAGACAAGAGAAGTAAAGTTAAGTCAAGTGAAGCAAAGCTAAGCCAAGCGAAGGAAAGGTAAGGCAAGGG
ATAATAAAATAATATAACATAAGATATAATATTATATCATATGATACAATACTATACCATACGATAGAATAGTATAGCATAGG
ATTATTAAATTATATTACATTAGATTTAATTTTATTTCATTTGATTCAATTCTATTCCATTCGATTGAATTGTATTGCATTGG
ATCATCAAATCATATCACATCAGATCTAATCTTATCTCATCTGATCCAATCCTATCCCATCCGATCGAATCGTATCGCATCGG
ATGATGAAATGATATGACATGAGATGTAATGTTATGTCATGTGATGCAATGCTATGCCATGCGATGGAATGGTATGGCATGGG
ACAACAAAACAATACAACACAAGACATAACATTACATCACATGACACAACACTACACCACACGACAGAACAGTACAGCACAGG
ACTACTAAACTATACTACACTAGACTTAACTTTACTTCACTTGACTCAACTCTACTCCACTCGACTGAACTGTACTGCACTGG
ACCACCAAACCATACCACACCAGACCTAACCTTACCTCACCTGACCCAACCCTACCCCACCCGACCGAACCGTACCGCACCGG
ACGACGAAACGATACGACACGAGACGTAACGTTACGTCACGTGACGCAACGCTACGCCACGCGACGGAACGGTACGGCACGGG
AGAAGAAAAGAATAGAACAGAAGAGATAAGATTAGATCAGATGAGACAAGACTAGACCAGACGAGAGAAGAGTAGAGCAGAGG
AGTAGTAAAGTATAGTACAGTAGAGTTAAGTTTAGTTCAGTTGAGTCAAGTCTAGTCCAGTCGAGTGAAGTGTAGTGCAGTGG
AGCAGCAAAGCATAGCACAGCAGAGCTAAGCTTAGCTCAGCTGAGCCAAGCCTAGCCCAGCCGAGCGAAGCGTAGCGCAGCGG
AGGAGGAAAGGATAGGACAGGAGAGGTAAGGTTAGGTCAGGTGAGGCAAGGCTAGGCCAGGCGAGGGAAGGGTAGGGCAGGGG
TAATAAAATAAATTAAACTAAAGTAATATAATTTAATCTAATGTAACATAACTTAACCTAACGTAAGATAAGTTAAGCTAAGG
TATTATAATATATTATACTATAGTATTATATTTTATTCTATTGTATCATATCTTATCCTATCGTATGATATGTTATGCTATGG
TACTACAATACATTACACTACAGTACTATACTTTACTCTACTGTACCATACCTTACCCTACCGTACGATACGTTACGCTACGG
TAGTAGAATAGATTAGACTAGAGTAGTATAGTTTAGTCTAGTGTAGCATAGCTTAGCCTAGCGTAGGATAGGTTAGGCTAGGG
TTATTAAATTAATTTAACTTAAGTTATATTATTTTATCTTATGTTACATTACTTTACCTTACGTTAGATTAGTTTAGCTTAGG
TTTTTTAATTTATTTTACTTTAGTTTTATTTTTTTTTCTTTTGTTTCATTTCTTTTCCTTTCGTTTGATTTGTTTTGCTTTGG
TTCTTCAATTCATTTCACTTCAGTTCTATTCTTTTCTCTTCTGTTCCATTCCTTTCCCTTCCGTTCGATTCGTTTCGCTTCGG
TTGTTGAATTGATTTGACTTGAGTTGTATTGTTTTGTCTTGTGTTGCATTGCTTTGCCTTGCGTTGGATTGGTTTGGCTTGGG
TCATCAAATCAATTCAACTCAAGTCATATCATTTCATCTCATGTCACATCACTTCACCTCACGTCAGATCAGTTCAGCTCAGG
TCTTCTAATCTATTCTACTCTAGTCTTATCTTTTCTTCTCTTGTCTCATCTCTTCTCCTCTCGTCTGATCTGTTCTGCTCTGG
TCCTCCAATCCATTCCACTCCAGTCCTATCCTTTCCTCTCCTGTCCCATCCCTTCCCCTCCCGTCCGATCCGTTCCGCTCCGG
TCGTCGAATCGATTCGACTCGAGTCGTATCGTTTCGTCTCGTGTCGCATCGCTTCGCCTCGCGTCGGATCGGTTCGGCTCGGG
TGATGAAATGAATTGAACTGAAGTGATATGATTTGATCTGATGTGACATGACTTGACCTGACGTGAGATGAGTTGAGCTGAGG
TGTTGTAATGTATTGTACTGTAGTGTTATGTTTTGTTCTGTTGTGTCATGTCTTGTCCTGTCGTGTGATGTGTTGTGCTGTGG
TGCTGCAATGCATTGCACTGCAGTGCTATGCTTTGCTCTGCTGTGCCATGCCTTGCCCTGCCGTGCGATGCGTTGCGCTGCGG
TGGTGGAATGGATTGGACTGGAGTGGTATGGTTTGGTCTGGTGTGGCATGGCTTGGCCTGGCGTGGGATGGGTTGGGCTGGGG
CAACAAAACAAATCAAACCAAAGCAATACAATTCAATCCAATGCAACACAACTCAACCCAACGCAAGACAAGTCAAGCCAAGG
CATCATAACATATCATACCATAGCATTACATTTCATTCCATTGCATCACATCTCATCCCATCGCATGACATGTCATGCCATGG
CACCACAACACATCACACCACAGCACTACACTTCACTCCACTGCACCACACCTCACCCCACCGCACGACACGTCACGCCACGG
CAGCAGAACAGATCAGACCAGAGCAGTACAGTTCAGTCCAGTGCAGCACAGCTCAGCCCAGCGCAGGACAGGTCAGGCCAGGG
CTACTAAACTAATCTAACCTAAGCTATACTATTCTATCCTATGCTACACTACTCTACCCTACGCTAGACTAGTCTAGCCTAGG
CTTCTTAACTTATCTTACCTTAGCTTTACTTTTCTTTCCTTTGCTTCACTTCTCTTCCCTTCGCTTGACTTGTCTTGCCTTGG
CTCCTCAACTCATCTCACCTCAGCTCTACTCTTCTCTCCTCTGCTCCACTCCTCTCCCCTCCGCTCGACTCGTCTCGCCTCGG
CTGCTGAACTGATCTGACCTGAGCTGTACTGTTCTGTCCTGTGCTGCACTGCTCTGCCCTGCGCTGGACTGGTCTGGCCTGGG
CCACCAAACCAATCCAACCCAAGCCATACCATTCCATCCCATGCCACACCACTCCACCCCACGCCAGACCAGTCCAGCCCAGG
CCTCCTAACCTATCCTACCCTAGCCTTACCTTTCCTTCCCTTGCCTCACCTCTCCTCCCCTCGCCTGACCTGTCCTGCCCTGG
CCCCCCAACCCATCCCACCCCAGCCCTACCCTTCCCTCCCCTGCCCCACCCCTCCCCCCCCCGCCCGACCCGTCCCGCCCCGG
CCGCCGAACCGATCCGACCCGAGCCGTACCGTTCCGTCCCGTGCCGCACCGCTCCGCCCCGCGCCGGACCGGTCCGGCCCGGG
CGACGAAACGAATCGAACCGAAGCGATACGATTCGATCCGATGCGACACGACTCGACCCGACGCGAGACGAGTCGAGCCGAGG
CGTCGTAACGTATCGTACCGTAGCGTTACGTTTCGTTCCGTTGCGTCACGTCTCGTCCCGTCGCGTGACGTGTCGTGCCGTGG
CGCCGCAACGCATCGCACCGCAGCGCTACGCTTCGCTCCGCTGCGCCACGCCTCGCCCCGCCGCGCGACGCGTCGCGCCGCGG
CGGCGGAACGGATCGGACCGGAGCGGTACGGTTCGGTCCGGTGCGGCACGGCTCGGCCCGGCGCGGGACGGGTCGGGCCGGGG
GAAGAAAAGAAATGAAACGAAAGGAATAGAATTGAATCGAATGGAACAGAACTGAACCGAACGGAAGAGAAGTGAAGCGAAGG
GATGATAAGATATGATACGATAGGATTAGATTTGATTCGATTGGATCAGATCTGATCCGATCGGATGAGATGTGATGCGATGG
GACGACAAGACATGACACGACAGGACTAGACTTGACTCGACTGGACCAGACCTGACCCGACCGGACGAGACGTGACGCGACGG
GAGGAGAAGAGATGAGACGAGAGGAGTAGAGTTGAGTCGAGTGGAGCAGAGCTGAGCCGAGCGGAGGAGAGGTGAGGCGAGGG
GTAGTAAAGTAATGTAACGTAAGGTATAGTATTGTATCGTATGGTACAGTACTGTACCGTACGGTAGAGTAGTGTAGCGTAGG
GTTGTTAAGTTATGTTACGTTAGGTTTAGTTTTGTTTCGTTTGGTTCAGTTCTGTTCCGTTCGGTTGAGTTGTGTTGCGTTGG
GTCGTCAAGTCATGTCACGTCAGGTCTAGTCTTGTCTCGTCTGGTCCAGTCCTGTCCCGTCCGGTCGAGTCGTGTCGCGTCGG
GTGGTGAAGTGATGTGACGTGAGGTGTAGTGTTGTGTCGTGTGGTGCAGTGCTGTGCCGTGCGGTGGAGTGGTGTGGCGTGGG
GCAGCAAAGCAATGCAACGCAAGGCATAGCATTGCATCGCATGGCACAGCACTGCACCGCACGGCAGAGCAGTGCAGCGCAGG
GCTGCTAAGCTATGCTACGCTAGGCTTAGCTTTGCTTCGCTTGGCTCAGCTCTGCTCCGCTCGGCTGAGCTGTGCTGCGCTGG
GCCGCCAAGCCATGCCACGCCAGGCCTAGCCTTGCCTCGCCTGGCCCAGCCCTGCCCCGCCCGGCCGAGCCGTGCCGCGCCGG
GCGGCGAAGCGATGCGACGCGAGGCGTAGCGTTGCGTCGCGTGGCGCAGCGCTGCGCCGCGCGGCGGAGCGGTGCGGCGCGGG
GGAGGAAAGGAATGGAACGGAAGGGATAGGATTGGATCGGATGGGACAGGACTGGACCGGACGGGAGAGGAGTGGAGCGGAGG
GGTGGTAAGGTATGGTACGGTAGGGTTAGGTTTGGTTCGGTTGGGTCAGGTCTGGTCCGGTCGGGTGAGGTGTGGTGCGGTGG
GGCGGCAAGGCATGGCACGGCAGGGCTAGGCTTGGCTCGGCTGGGCCAGGCCTGGCCCGGCCGGGCGAGGCGTGGCGCGGCGG
GGGGGGAAGGGATGGGACGGGAGGGGTAGGGTTGGGTCGGGTGGGGCAGGGCTGGGCCGGGCGGGGGAGGGGTGGGGCGGGGG
Sampling rate: 1 / 20
overrepresented sequencecount (% of bases)distribution: cycle 1 ~ cycle 150
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA201 (0.004525%)
AAAAACTTGTCACTGGGGTCATCGCCGAAATCGTAGCCGTCGAAGGCATCCCCGGCATCTCCACCAATGAAGTAGGCATAGGTCAGGCGGTATTTGTCAG11 (0.000619%)
AAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCA64 (0.003602%)
AAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATG121 (0.006811%)
AAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCT222 (0.018493%)
AAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACC111 (0.006248%)
AAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAA24 (0.001351%)
AAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCC11 (0.000619%)
AAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAA25 (0.001407%)
AAAACTAGGCCTCGCCCCATTCCACTTCTGATTACCAGAAGTAACTCAAGGGATCCCACTGCACATAGGACTTATTCTTCTTACATGACAAAAAATTGCT3 (0.000169%)
AAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATT11 (0.000619%)
AAAACTTGTCACTGGGGTCATCGCCGAAATCGTAGCCGTCGAAGGCATCCCCGGCATCTCCACCAATGAAGTAGGCATAGGTCAGGCGGTATTTGTCAGA5 (0.000281%)
AAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCAT50 (0.002814%)
AAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCA27 (0.001520%)
AAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTAC27 (0.001520%)
AAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGG40 (0.002251%)
AAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGG10 (0.000563%)
AAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTC77 (0.004334%)
AAAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTT336 (0.018912%)
AAAAGTCAGACTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGC17 (0.000957%)
AAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAA44 (0.002477%)
AAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTG36 (0.002026%)
AAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGAT11 (0.000619%)
AAAATTGGGCTCGAACCCGCCACCAGGTCGGACGTACTTGAGGGAATTCAGAATCTCTTCATTCTTGCCATTCTCCTGGTGTCCGAACTGATTGCACGGG4 (0.000225%)
AAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACAT55 (0.003096%)
AAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCT85 (0.004784%)
AAACAATGTAAAATTGGGCTCGAACCCGCCACCAGGTCGGACGTACTTGAGGGAATTCAGAATCTCTTCATTCTTGCCATTCTCCTGGTGTCCGAACTGA96 (0.005403%)
AAACACCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATC327 (0.018405%)
AAACATCTTTCAGGGACCTTCAGTAAGACATACAGTTGTGTGAACAGAGTCAGTGACTCTCATGTACTTTGGACGATGGTTTAATGTCCACCTAGAGAAG166 (0.009343%)
AAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAAC17 (0.000957%)
AAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCT33 (0.001857%)
AAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAAT6 (0.000338%)
AAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGT8 (0.000450%)
AAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGC6 (0.000338%)
AAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATA8 (0.000450%)
AAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCA6 (0.000338%)
AAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTG27 (0.001520%)
AAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAAC4 (0.000225%)
AAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTT15 (0.000844%)
AAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTG22 (0.001238%)
AAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTG14 (0.000788%)
AAACTTGTCACTGGGGTCATCGCCGAAATCGTAGCCGTCGAAGGCATCCCCGGCATCTCCACCAATGAAGTAGGCATAGGTCAGGCGGTATTTGTCAGAC5 (0.000281%)
AAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAA50 (0.002814%)
AAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACG31 (0.001745%)
AAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTG47 (0.002645%)
AAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACAT16 (0.000901%)
AAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAAC78 (0.004390%)
AAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTT9 (0.000507%)
AAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATC11 (0.000619%)
AAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGC23 (0.001295%)
AAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATT35 (0.001970%)
AAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCAT11 (0.000619%)
AAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGC50 (0.002814%)
AAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGT27 (0.001520%)
AAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCC91 (0.005122%)
AAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACT13 (0.000732%)
AAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACC10 (0.000563%)
AAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGGAGTAGTAAGTAACTACATGTGAAATAATT18 (0.001013%)
AAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGA12 (0.000675%)
AAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGC4 (0.000225%)
AAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCA19 (0.001069%)
AAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACA55 (0.003096%)
AAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTCC4 (0.000225%)
AAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCT48 (0.002702%)
AAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTT32 (0.001801%)
AAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTTT6 (0.000338%)
AAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGT48 (0.002702%)
AAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACT38 (0.002139%)
AAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAA4 (0.000225%)
AAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAAT10 (0.000563%)
AAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGA12 (0.000675%)
AAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGT3 (0.000169%)
AAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAAC15 (0.000844%)
AAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAA73 (0.004109%)
AAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTCGG17 (0.000957%)
AAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTT54 (0.003039%)
AAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTA7 (0.000394%)
AAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTA19 (0.001069%)
AAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCG47 (0.002645%)
AAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGATCCAATAATTACATGGAGTCCATGGAAT7 (0.000394%)
AAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCG13 (0.000732%)
AAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGT7 (0.000394%)
AAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCC15 (0.000844%)
AAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAGGGATGAGTTGGATAAAACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAA5 (0.000281%)
AAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTA7 (0.000394%)
AAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGA78 (0.004390%)
AAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGT25 (0.001407%)
AAATTCATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATT20 (0.001126%)
AAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTG19 (0.001069%)
AAATTGGGCTCGAACCCGCCACCAGGTCGGACGTACTTGAGGGAATTCAGAATCTCTTCATTCTTGCCATTCTCCTGGTGTCCGAACTGATTGCACGGGA7 (0.000394%)
AAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACT22 (0.001238%)
AAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGC14 (0.000788%)
AAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGT6 (0.000338%)
AAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAA4 (0.000225%)
AACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATG10 (0.000563%)
AACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTC10 (0.000563%)
AACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACA8 (0.000450%)
AACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGG7 (0.000394%)
AACACCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCT4 (0.000225%)
AACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGG3 (0.000169%)
AACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCC5 (0.000281%)
AACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGG20 (0.001126%)
AACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATT20 (0.001126%)
AACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCT10 (0.000563%)
AACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAG18 (0.001013%)
AACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAAC25 (0.001407%)
AACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCA1092 (0.061464%)
AACATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCT6 (0.000338%)
AACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGA5 (0.000281%)
AACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTTTG7 (0.000394%)
AACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGC13 (0.000732%)
AACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACT18 (0.001013%)
AACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATT30 (0.001689%)
AACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTG24 (0.001351%)
AACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGG6 (0.000338%)
AACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATG19 (0.001069%)
AACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTAT4 (0.000225%)
AACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGA3 (0.000169%)
AACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTC9 (0.000507%)
AACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTC3 (0.000169%)
AACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAA5 (0.000281%)
AACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAA12 (0.000675%)
AACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGC55 (0.003096%)
AACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGG8 (0.000450%)
AACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTA4 (0.000225%)
AACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTC7 (0.000394%)
AACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGAT8 (0.000450%)
AACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGT4 (0.000225%)
AACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAAC4 (0.000225%)
AACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCG5 (0.000281%)
AACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATT9 (0.000507%)
AACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGT6 (0.000338%)
AACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGA8 (0.000450%)
AACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGT5 (0.000281%)
AACTTGTCACTGGGGTCATCGCCGAAATCGTAGCCGTCGAAGGCATCCCCGGCATCTCCACCAATGAAGTAGGCATAGGTCAGGCGGTATTTGTCAGACT3 (0.000169%)
AAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATA14 (0.000788%)
AAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTG38 (0.002139%)
AAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAAC18 (0.001013%)
AAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGA16 (0.000901%)
AAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATA20 (0.001126%)
AAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGG18 (0.001013%)
AAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGC28 (0.001576%)
AAGAAATTCATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGA57 (0.003208%)
AAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGT46 (0.002589%)
AAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCG8 (0.000450%)
AAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCA22 (0.001238%)
AAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTG34 (0.001914%)
AAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGG33 (0.001857%)
AAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCA57 (0.003208%)
AAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGG158 (0.008893%)
AAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATG7 (0.000394%)
AAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGC101 (0.005685%)
AAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCA33 (0.001857%)
AAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCC13 (0.000732%)
AAGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAGGAGTGTACAGAGTAGAACTGGACACCAAATCGTACTGGAAGA3 (0.000169%)
AAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACT10 (0.000563%)
AAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCA3 (0.000169%)
AAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGA10 (0.000563%)
AAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACC6 (0.000338%)
AAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTA17 (0.000957%)
AAGAGCACACGTCTGAACTCCAGTCACGTTAGCCTAGATC6 (0.000135%)
AAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTT26 (0.001463%)
AAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGC12 (0.000675%)
AAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTC3 (0.000169%)
AAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACG7 (0.000394%)
AAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCAT3 (0.000169%)
AAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCG10 (0.000563%)
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTAG3825 (0.086117%)
AAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCT9 (0.000507%)
AAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCA4 (0.000225%)
AAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTT13 (0.000732%)
AAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCT9 (0.000507%)
AAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATG5 (0.000281%)
AAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCC56 (0.003152%)
AAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGT5 (0.000281%)
AAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTG3 (0.000169%)
AAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCA12 (0.000675%)
AAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGA5 (0.000281%)
AAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTT8 (0.000450%)
AAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCT7 (0.000394%)
AAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCC9 (0.000507%)
AAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAG15 (0.000844%)
AAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAA11 (0.000619%)
AAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCA3 (0.000169%)
AAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAG9 (0.000507%)
AAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGA3 (0.000169%)
AAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCAT7 (0.000394%)
AAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGT5 (0.000281%)
AAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAA6 (0.000338%)
AAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCGGCTTACAGCTAACAT6 (0.000338%)
AAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGC5 (0.000281%)
AAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTC5 (0.000281%)
AAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTT5 (0.000281%)
AAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCA42 (0.002364%)
AAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAA18 (0.001013%)
AAGGATTCCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCC28 (0.001576%)
AAGGCACAGCAGCGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACC14 (0.000788%)
AAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGC25 (0.001407%)
AAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTTTG9 (0.000507%)
AAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTG20 (0.001126%)
AAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTT59 (0.003321%)
AAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGT35 (0.001970%)
AAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTG22 (0.001238%)
AAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAAC8 (0.000450%)
AAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTC4 (0.000225%)
AAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCAT18 (0.001013%)
AAGGTAGGGAGAGGGGCTCTAGCGGTGGCCAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTC3 (0.000169%)
AAGGTATCTTTCCTAAAGGGTATTATGCCGTGGCTGTGGTGAAGGCATCGGACACTAGCATCACCTGGAACAACCTGAAAGGCAAGAAGTCCTGCCACAC87 (0.004897%)
AAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGC6 (0.000338%)
AAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGA4 (0.000225%)
AAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAAC3 (0.000169%)
AAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCC13 (0.000732%)
AAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGC22 (0.001238%)
AAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAG5 (0.000281%)
AAGTCAGACTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAA7 (0.000394%)
AAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGAC3 (0.000169%)
AAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTT5 (0.000281%)
AAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCA3 (0.000169%)
AAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCA62 (0.003490%)
AAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACT11 (0.000619%)
AAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCA28 (0.001576%)
AAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGA3 (0.000169%)
AAGTGTCCTGCAGTAATGTTAGCTGTAAGCCGGACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTG373 (0.020994%)
AAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAG12 (0.000675%)
AAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATA9 (0.000507%)
AAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAG8 (0.000450%)
AAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCC4 (0.000225%)
AAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGCTT17 (0.000957%)
AAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACA13 (0.000732%)
AATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGT7 (0.000394%)
AATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTCGGAAGCCTGTAATTACGGCTCCA3 (0.000169%)
AATAATTCTAGCAGCTATTCTTCTAAAATTAGGTAGTTACGGAATAATTCGCATCTCCATTATTCTAGACCCACTAACAAAATATATAGCATACCCCTTC5 (0.000281%)
AATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAG6 (0.000338%)
AATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACA17 (0.000957%)
AATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTT4 (0.000225%)
AATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAA8 (0.000450%)
AATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCC3 (0.000169%)
AATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAG6 (0.000338%)
AATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTAC3 (0.000169%)
AATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATC36 (0.002026%)
AATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGT1830 (0.103002%)
AATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAA13 (0.000732%)
AATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGA42 (0.002364%)
AATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGC10 (0.000563%)
AATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTC12 (0.000675%)
AATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTT6 (0.000338%)
AATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCT3 (0.000169%)
AATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAA15 (0.000844%)
AATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTT11 (0.000619%)
AATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCC4 (0.000225%)
AATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGG26 (0.001463%)
AATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGG13 (0.000732%)
AATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCT6 (0.000338%)
AATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCAT7 (0.000394%)
AATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTGTGATCT11 (0.000619%)
AATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTT4 (0.000225%)
AATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTAT16 (0.000901%)
AATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAG15 (0.000844%)
AATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCAC11 (0.000619%)
AATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAAT15 (0.000844%)
AATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTCGGAAGCCTGTAATTACGGCTCCAGCTCATAGTGGAATG5 (0.000281%)
AATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTT39 (0.002195%)
AATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGC4 (0.000225%)
AATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTTTGATAATAAGTTTAACTAGTCAGTGTTGGAAAGAATGGAGACGGTTG13 (0.000732%)
AATTCATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTG37 (0.002083%)
AATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTC6 (0.000338%)
AATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCATTAT4 (0.000225%)
AATTCTAGCAGCTATTCTTCTAAAATTAGGTAGTTACGGAATAATTCGCATCTCCATTATTCTAGACCCACTAACAAAATATATAGCATACCCCTTCATC4 (0.000225%)
AATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCATGGGCTAGATTTCCGGCTAGAGGTGGG11 (0.000619%)
AATTGCAGCACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCAT17 (0.000957%)
AATTGTGCCATCCCATCACAACAAGGTATCTTTCCTAAAGGGTATTATGCCGTGGCTGTGGTGAAGGCATCGGACACTAGCATCACCTGGAACAACCTGA8 (0.000450%)
AATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTCGGAAGCCTGTA10 (0.000563%)
AATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTA24 (0.001351%)
AATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCA5 (0.000281%)
AATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTT90 (0.005066%)
AATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAA23 (0.001295%)
AATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCC41 (0.002308%)
ACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCA17 (0.000957%)
ACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTG6 (0.000338%)
ACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGT6 (0.000338%)
ACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCA5 (0.000281%)
ACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTA48 (0.002702%)
ACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCC4 (0.000225%)
ACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGT22 (0.001238%)
ACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCA9 (0.000507%)
ACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTT6 (0.000338%)
ACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAA7 (0.000394%)
ACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGG7 (0.000394%)
ACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAG3 (0.000169%)
ACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCC6 (0.000338%)
ACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATA10 (0.000563%)
ACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTT33 (0.001857%)
ACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGC3 (0.000169%)
ACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGT17 (0.000957%)
ACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACT13 (0.000732%)
ACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCA3 (0.000169%)
ACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAG11 (0.000619%)
ACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTT4 (0.000225%)
ACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCT7 (0.000394%)
ACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACA5 (0.000281%)
ACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTG17 (0.000957%)
ACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCAC3 (0.000169%)
ACACCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTT3 (0.000169%)
ACACGAGCTTACTTTACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAAT3 (0.000169%)
ACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTG13 (0.000732%)
ACACGTCTGAACTCCAGTCACGTTAGCCTAGATCTCGTAT8 (0.000180%)
ACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCT4 (0.000225%)
ACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGT5 (0.000281%)
ACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGA3 (0.000169%)
ACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGC5 (0.000281%)
ACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAG8 (0.000450%)
ACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTT4 (0.000225%)
ACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGG11 (0.000619%)
ACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACC11 (0.000619%)
ACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTT11 (0.000619%)
ACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCG7 (0.000394%)
ACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAA5 (0.000281%)
ACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTC12 (0.000675%)
ACAGCAGCGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGT3 (0.000169%)
ACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCA8 (0.000450%)
ACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCT3 (0.000169%)
ACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAA4 (0.000225%)
ACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAA5 (0.000281%)
ACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATAC5 (0.000281%)
ACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATAC3 (0.000169%)
ACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCT5 (0.000281%)
ACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGA4 (0.000225%)
ACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACC3 (0.000169%)
ACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAG7 (0.000394%)
ACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCA5 (0.000281%)
ACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCT17 (0.000957%)
ACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGT24 (0.001351%)
ACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCC11 (0.000619%)
ACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCA9 (0.000507%)
ACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTTG13 (0.000732%)
ACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTC7 (0.000394%)
ACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCT43 (0.002420%)
ACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCC18 (0.001013%)
ACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGG3 (0.000169%)
ACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAG3 (0.000169%)
ACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTC13 (0.000732%)
ACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCAC3 (0.000169%)
ACCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACT7 (0.000394%)
ACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGC4 (0.000225%)
ACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCAC13 (0.000732%)
ACCAGCTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACT7 (0.000394%)
ACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCT5 (0.000281%)
ACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGC3 (0.000169%)
ACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCA11 (0.000619%)
ACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGA15 (0.000844%)
ACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTACCAG5 (0.000281%)
ACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGG9 (0.000507%)
ACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGT3 (0.000169%)
ACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATG9 (0.000507%)
ACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGT13 (0.000732%)
ACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACAT7 (0.000394%)
ACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGA9 (0.000507%)
ACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCA4 (0.000225%)
ACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAG5 (0.000281%)
ACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGATGGACCAGCTCCCGGTAT4 (0.000225%)
ACCGAGGCCACAGGAGAGAAGGCGTGGCGTAGGTCGTGGTAAGTTCGGTGGTCTGAAAGTCCTCGTGGAACCACCACAGGTCCCACCACCACAGATGCAG4 (0.000225%)
ACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGA4 (0.000225%)
ACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCT39 (0.002195%)
ACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGT6 (0.000338%)
ACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGG15 (0.000844%)
ACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATG7 (0.000394%)
ACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAG13 (0.000732%)
ACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCA6 (0.000338%)
ACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGT16 (0.000901%)
ACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTC16 (0.000901%)
ACGAGCTTACTTTACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGA5 (0.000281%)
ACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGG6 (0.000338%)
ACGCTGTCCAGCTGGGTGCTGCTGATGGATTATGCAGGCAATGCCACTGCTGTCTTCCTTCTGCCCGATGATGGGAAGATGCAGCATCTGGAGCAAACTC14 (0.000788%)
ACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAG12 (0.000675%)
ACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTG4 (0.000225%)
ACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATT37 (0.002083%)
ACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCA20 (0.001126%)
ACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCA12 (0.000675%)
ACGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATA4 (0.000225%)
ACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGA4 (0.000225%)
ACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCG6 (0.000338%)
ACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTAC4 (0.000225%)
ACTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAA9 (0.000507%)
ACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGC42 (0.002364%)
ACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAG6 (0.000338%)
ACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAA13 (0.000732%)
ACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCC5 (0.000281%)
ACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATT6 (0.000338%)
ACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGC6 (0.000338%)
ACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGA6 (0.000338%)
ACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTG4 (0.000225%)
ACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAA18 (0.001013%)
ACTCCTTCTACAAACTTCTCATCTGTGGTGAGCCCGTGCAGCTCTCCAGACTCCGCGGTCTTCCCAGAGGCAAAGGGCTCCCAGGATCCCTCAGAGGTCT3 (0.000169%)
ACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCA4 (0.000225%)
ACTCTGTACACTCCTTCTACAAACTTCTCATCTGTGGTGAGCCCGTGCAGCTCTCCAGACTCCGCGGTCTTCCCAGAGGCAAAGGGCTCCCAGGATCCCT6 (0.000338%)
ACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCT20 (0.001126%)
ACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATT5 (0.000281%)
ACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAAT5 (0.000281%)
ACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTC7 (0.000394%)
ACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTG10 (0.000563%)
ACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCAT13 (0.000732%)
ACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGT15 (0.000844%)
ACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTT3 (0.000169%)
ACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCA17 (0.000957%)
ACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACT7 (0.000394%)
ACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCAT3 (0.000169%)
ACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGA4 (0.000225%)
ACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGT4 (0.000225%)
ACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTG3 (0.000169%)
ACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTC5 (0.000281%)
ACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGAT5 (0.000281%)
ACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGT18 (0.001013%)
ACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTG5 (0.000281%)
ACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGAC11 (0.000619%)
ACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCAT9 (0.000507%)
ACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCCCAAAT5 (0.000281%)
ACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTG20 (0.001126%)
ACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGC3 (0.000169%)
ACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAG8 (0.000450%)
ACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTA5 (0.000281%)
ACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTG5 (0.000281%)
ACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTC6 (0.000338%)
ACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATC4 (0.000225%)
ACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTC7 (0.000394%)
ACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTG20 (0.001126%)
ACTTTACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGC4 (0.000225%)
ACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCG3 (0.000169%)
ACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTT14 (0.000788%)
ACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACT6 (0.000338%)
ACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCT4 (0.000225%)
AGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATC4 (0.000225%)
AGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGT5 (0.000281%)
AGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACC3 (0.000169%)
AGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACT15 (0.000844%)
AGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAG26 (0.001463%)
AGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAA49 (0.002758%)
AGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAG8 (0.000450%)
AGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGA29 (0.001632%)
AGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCC15 (0.000844%)
AGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAG3 (0.000169%)
AGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATC16 (0.000901%)
AGAAATTCATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAA25 (0.001407%)
AGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTG84 (0.004728%)
AGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGAC4 (0.000225%)
AGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGT9 (0.000507%)
AGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCAT18 (0.001013%)
AGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGT8 (0.000450%)
AGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCA4 (0.000225%)
AGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAA361 (0.020319%)
AGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCAT76 (0.004278%)
AGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGT44 (0.002477%)
AGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAA27 (0.001520%)
AGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGAT1101 (0.061970%)
AGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGAT6 (0.000338%)
AGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAA4 (0.000225%)
AGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTT7 (0.000394%)
AGAAGGTAGGGAGAGGGGCTCTAGCGGTGGCCAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCC229 (0.012889%)
AGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGA136 (0.007655%)
AGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCT10 (0.000563%)
AGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGT32 (0.001801%)
AGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGG10 (0.000563%)
AGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGA40 (0.002251%)
AGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGA10 (0.000563%)
AGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGG3 (0.000169%)
AGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAG8 (0.000450%)
AGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTGTGAT3 (0.000169%)
AGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCA5 (0.000281%)
AGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTC14 (0.000788%)
AGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGT33 (0.001857%)
AGACACACGAGCTTACTTTACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATT235 (0.013227%)
AGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCT22 (0.001238%)
AGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTT4 (0.000225%)
AGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAG222 (0.012495%)
AGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGA18 (0.001013%)
AGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCAC7 (0.000394%)
AGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGC40 (0.002251%)
AGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATA10 (0.000563%)
AGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCC11 (0.000619%)
AGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTACCAGCATCTGTTCTGATTCTTTGGGCACCCAGAAGTTTAT5 (0.000281%)
AGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAGGAGTGTACAGAGTAGAACTGGACACCAAATCGTACTGGAAGAC3 (0.000169%)
AGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAGGTC3 (0.000169%)
AGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAA13 (0.000732%)
AGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCT38 (0.002139%)
AGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCAC7 (0.000394%)
AGACTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAAT6 (0.000338%)
AGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAA48 (0.002702%)
AGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCA5 (0.000281%)
AGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTA33 (0.001857%)
AGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCT10 (0.000563%)
AGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAG16 (0.000901%)
AGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCG19 (0.001069%)
AGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTG8 (0.000450%)
AGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTT21 (0.001182%)
AGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTC6 (0.000338%)
AGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGAC3 (0.000169%)
AGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGC67 (0.003771%)
AGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTC26 (0.001463%)
AGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTG48 (0.002702%)
AGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAA6 (0.000338%)
AGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGAT10 (0.000563%)
AGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTA1972 (0.044398%)
AGAGCACACGTCTGAACTCCAGTCACGTTAGCCTAGATCT12 (0.000270%)
AGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAGCAGCT9 (0.000507%)
AGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTT3 (0.000169%)
AGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCA7 (0.000394%)
AGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCA5 (0.000281%)
AGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCC3 (0.000169%)
AGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCAT5 (0.000281%)
AGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCC9 (0.000507%)
AGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGG5 (0.000281%)
AGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGG5 (0.000281%)
AGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGG3 (0.000169%)
AGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACA18 (0.001013%)
AGAGTACTACGAGAGCTCTAATTGTGCCATCCCATCACAACAAGGTATCTTTCCTAAAGGGTATTATGCCGTGGCTGTGGTGAAGGCATCGGACACTAGC3 (0.000169%)
AGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATG20 (0.001126%)
AGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGT10 (0.000563%)
AGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAA5 (0.000281%)
AGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCA3 (0.000169%)
AGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGT24 (0.001351%)
AGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGC5 (0.000281%)
AGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAG15 (0.000844%)
AGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCA11 (0.000619%)
AGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCA25 (0.001407%)
AGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGC11 (0.000619%)
AGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAA8 (0.000450%)
AGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAA4 (0.000225%)
AGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTG37 (0.002083%)
AGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGA5 (0.000281%)
AGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTT123 (0.006923%)
AGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTAC8 (0.000450%)
AGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGT11 (0.000619%)
AGATGAGCTCCTTGTTGAGAGTTTGCTCCAGATGCTGCATCTTCCCATCTTCGGGCAGGAGGAAGACAGCACTGGCGTTGCCCGCGTAATCCATCAGCAG6 (0.000338%)
AGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCT5 (0.000281%)
AGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGT3 (0.000169%)
AGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCA3 (0.000169%)
AGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGC6 (0.000338%)
AGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTG13 (0.000732%)
AGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTA18 (0.001013%)
AGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCT15 (0.000844%)
AGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCA45 (0.002533%)
AGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTG14 (0.000788%)
AGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGC15 (0.000844%)
AGCACACGTCTGAACTCCAGTCACGTTAGCCTAGATCTCG8 (0.000180%)
AGCACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTT12 (0.000675%)
AGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCT25 (0.001407%)
AGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACA8 (0.000450%)
AGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTG8 (0.000450%)
AGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTT21 (0.001182%)
AGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCA15 (0.000844%)
AGCAGCGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGG5 (0.000281%)
AGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGAC12 (0.000675%)
AGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCC99 (0.008247%)
AGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGAC15 (0.000844%)
AGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGA7 (0.000394%)
AGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAG4 (0.000225%)
AGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTG9 (0.000507%)
AGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGC30 (0.001689%)
AGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGC17 (0.000957%)
AGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGC5 (0.000281%)
AGCATTATTTGTTTGATAATAAGTTTAACTAGTCAGTGTTGGAAAGAATGGAGACGGTTGTTGATTAGGCGTTTTGAGGATGGGAATAGGATTGAAGGAA3 (0.000169%)
AGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACA3 (0.000169%)
AGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAG6 (0.000338%)
AGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAG30 (0.001689%)
AGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGA11 (0.000619%)
AGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTG17 (0.000957%)
AGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCG45 (0.002533%)
AGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAAC4 (0.000225%)
AGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTAT5 (0.000281%)
AGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTC4 (0.000225%)
AGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGT7 (0.000394%)
AGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCA17 (0.000957%)
AGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGA5 (0.000281%)
AGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGC9 (0.000507%)
AGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCC5 (0.000281%)
AGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTA7 (0.000394%)
AGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAG9 (0.000507%)
AGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCA3 (0.000169%)
AGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCA4 (0.000225%)
AGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATG3 (0.000169%)
AGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACT337 (0.018968%)
AGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGA9 (0.000507%)
AGCGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAA4 (0.000225%)
AGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGA13 (0.000732%)
AGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCG4 (0.000225%)
AGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCA25 (0.001407%)
AGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTA3 (0.000169%)
AGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTA4 (0.000225%)
AGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACA12 (0.000675%)
AGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAAT3 (0.000169%)
AGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGAC9 (0.000507%)
AGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAG5 (0.000281%)
AGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCAC4 (0.000225%)
AGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAG10 (0.000563%)
AGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAA15 (0.000844%)
AGCTTACTTTACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCT3 (0.000169%)
AGCTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGT4 (0.000225%)
AGCTTCCTCAGTGTTCTCAGGATCGAATGGCTTCTTCCATTTGCCTTTAAAAAGAATGTAATTCGCCAGGGCGAAAACTGTGTCTTGGTCCAGTTCTTTC4 (0.000225%)
AGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCT8 (0.000450%)
AGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAAC15 (0.000844%)
AGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTA4 (0.000225%)
AGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAG5 (0.000281%)
AGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCGGCTTACAGCTAACATT17 (0.000957%)
AGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCT7 (0.000394%)
AGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCAT9 (0.000507%)
AGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACT22 (0.001238%)
AGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTT29 (0.001632%)
AGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCAC3 (0.000169%)
AGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATC3 (0.000169%)
AGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCC7 (0.000394%)
AGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCT5 (0.000281%)
AGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGC4 (0.000225%)
AGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCA8 (0.000450%)
AGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTC3 (0.000169%)
AGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCAC55 (0.003096%)
AGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAAT9 (0.000507%)
AGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCA8 (0.000450%)
AGGCACAGCAGCGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCA3 (0.000169%)
AGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTC18 (0.001013%)
AGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCT24 (0.001351%)
AGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCT3 (0.000169%)
AGGCCATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGAC14 (0.000788%)
AGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACT14 (0.000788%)
AGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACCC3 (0.000169%)
AGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTTTGA3 (0.000169%)
AGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGT5 (0.000281%)
AGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGA14 (0.000788%)
AGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCA7 (0.000394%)
AGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTC14 (0.000788%)
AGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGC4 (0.000225%)
AGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGC4 (0.000225%)
AGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTC8 (0.000450%)
AGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGC3 (0.000169%)
AGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGA5 (0.000281%)
AGGCTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTGG5 (0.000281%)
AGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCC3 (0.000169%)
AGGGAGAGGGGCTCTAGCGGTGGCCAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGT3 (0.000169%)
AGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGT653 (0.036754%)
AGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACAC5 (0.000281%)
AGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATT8 (0.000450%)
AGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATG11 (0.000619%)
AGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCA8 (0.000450%)
AGGGGCTCTAGCGGTGGCCAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTA7 (0.000394%)
AGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTT12 (0.000675%)
AGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCA19 (0.001069%)
AGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGG4 (0.000225%)
AGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCC5 (0.000281%)
AGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCT7 (0.000394%)
AGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATA5 (0.000281%)
AGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAG10 (0.000563%)
AGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGG4 (0.000225%)
AGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGT4 (0.000225%)
AGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACA6 (0.000338%)
AGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGA5 (0.000281%)
AGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTC18 (0.001013%)
AGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACA12 (0.000675%)
AGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAA9 (0.000507%)
AGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCT5 (0.000281%)
AGTAATGTTAGCTGTAAGCCGGACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTT4 (0.000225%)
AGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATC3 (0.000169%)
AGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCA19 (0.001069%)
AGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGAT3 (0.000169%)
AGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGT13 (0.000732%)
AGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTA4 (0.000225%)
AGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTG10 (0.000563%)
AGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGG10 (0.000563%)
AGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCATTATCTTCTATCTTTTCTCTTTTGTCAGAG4 (0.000225%)
AGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGC8 (0.000450%)
AGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGC60 (0.003377%)
AGTCAGACTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAA18 (0.001013%)
AGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACG7 (0.000394%)
AGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTA39 (0.002195%)
AGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGG8 (0.000450%)
AGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCT3 (0.000169%)
AGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCA6 (0.000338%)
AGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTA3 (0.000169%)
AGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAG9 (0.000507%)
AGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCAC4 (0.000225%)
AGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACT32 (0.001801%)
AGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCAT4 (0.000225%)
AGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCA4 (0.000225%)
AGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAA4 (0.000225%)
AGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTG4 (0.000225%)
AGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTAT3 (0.000169%)
AGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTG8 (0.000450%)
AGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATT3 (0.000169%)
AGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAA12 (0.000675%)
AGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAA6 (0.000338%)
AGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGG7 (0.000394%)
AGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTT11 (0.000619%)
AGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCA102 (0.005741%)
AGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTT3 (0.000169%)
AGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGT7 (0.000394%)
AGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCT3 (0.000169%)
ATAAAACTAGGCCTCGCCCCATTCCACTTCTGATTACCAGAAGTAACTCAAGGGATCCCACTGCACATAGGACTTATTCTTCTTACATGACAAAAAATTG6 (0.000338%)
ATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCA21 (0.001182%)
ATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGGAGTAGTAAGTAACTACATGTGAAATAA496 (0.027918%)
ATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGA18 (0.001013%)
ATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACA23 (0.001295%)
ATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTCGGAAGCCTGTAATTACGGCTC3 (0.000169%)
ATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCA14 (0.000788%)
ATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAG3 (0.000169%)
ATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCATT8 (0.000450%)
ATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCA12 (0.000675%)
ATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTC31 (0.001745%)
ATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGG4 (0.000225%)
ATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAA3 (0.000169%)
ATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACT17 (0.000957%)
ATACGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAA523 (0.029437%)
ATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAG13 (0.000732%)
ATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTG7 (0.000394%)
ATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCATGGGCTAGATTTCCGGCTAGAGGT13 (0.001083%)
ATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACAC6 (0.000338%)
ATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTCGGAA3 (0.000169%)
ATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAA6 (0.000338%)
ATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTG9 (0.000507%)
ATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTA5 (0.000281%)
ATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGG7 (0.000394%)
ATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCA6 (0.000338%)
ATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGAT36 (0.002026%)
ATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAG10 (0.000563%)
ATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTG18 (0.001013%)
ATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCACCCAGCGCAGGTAAT7 (0.000394%)
ATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCT11 (0.000619%)
ATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTC39 (0.002195%)
ATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAG14 (0.000788%)
ATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTG3 (0.000169%)
ATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAG5 (0.000281%)
ATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCT5 (0.000281%)
ATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCAT52 (0.002927%)
ATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGT11 (0.000619%)
ATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCA14 (0.000788%)
ATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAAT15 (0.000844%)
ATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGC21 (0.001182%)
ATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAG14 (0.000788%)
ATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTC12 (0.000675%)
ATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTG57 (0.003208%)
ATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTA7 (0.000394%)
ATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCA45 (0.002533%)
ATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACT10 (0.000563%)
ATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCG17 (0.000957%)
ATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCA5 (0.000281%)
ATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCC9 (0.000507%)
ATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCA31 (0.001745%)
ATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGG37 (0.002083%)
ATCCAGGGTGCCCCTCCAACCAGGATGAGGCTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGG85 (0.004784%)
ATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTA6 (0.000338%)
ATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAG9 (0.000507%)
ATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGAT3 (0.000169%)
ATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAA10 (0.000563%)
ATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAA19 (0.001069%)
ATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTT3 (0.000169%)
ATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTT6 (0.000338%)
ATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCT3 (0.000169%)
ATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACC6 (0.000338%)
ATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCT16 (0.000901%)
ATCCTGGGAGCCCTTTGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAGGAGTGTACAGAGTAGAA3 (0.000169%)
ATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGC15 (0.000844%)
ATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCA6 (0.000338%)
ATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTA5 (0.000281%)
ATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCA35 (0.001970%)
ATCGCCACCCTCCTCCTCGTATCCATCTGGAAACAGATCTATAGAAGTTGGAACCTGCCCCCAGGACCTTTCCCAATTCCTTTCTTTGGAAACATTTTTC4 (0.000225%)
ATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATG26 (0.001463%)
ATCGCCTACTCCTCAGTTAGCCACATAGCACTTGTTATTGCATCAATCATAATCCAAACTCCATGAAGCTTCATAGGAGCAACAATACTAATAATCGCAC62 (0.003490%)
ATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTGGAGAGCATAC10 (0.000563%)
ATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTAGCCT9 (0.000203%)
ATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGG26 (0.001463%)
ATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATT18 (0.001013%)
ATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCC6 (0.000338%)
ATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCA9 (0.000507%)
ATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGC25 (0.001407%)
ATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTG9 (0.000507%)
ATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCA5 (0.000281%)
ATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTG9 (0.000507%)
ATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGT4 (0.000225%)
ATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATA10 (0.000563%)
ATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAAT3 (0.000169%)
ATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGAT7 (0.000394%)
ATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAAT5 (0.000281%)
ATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCG13 (0.000732%)
ATCTGTTTCTTTCTCCAGGTTATCCCAGAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCC3 (0.000169%)
ATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAG6 (0.000338%)
ATCTTCCTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAG340 (0.019137%)
ATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTT11 (0.000619%)
ATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAA9 (0.000507%)
ATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGT10 (0.000563%)
ATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACC9 (0.000507%)
ATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCT19 (0.001069%)
ATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAA76 (0.004278%)
ATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGA13 (0.000732%)
ATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAA8 (0.000450%)
ATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCA14 (0.000788%)
ATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACG4 (0.000225%)
ATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGC13 (0.000732%)
ATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATA21 (0.001182%)
ATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTG9 (0.000507%)
ATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTT13 (0.000732%)
ATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCG13 (0.000732%)
ATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCA3 (0.000169%)
ATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCA7 (0.000394%)
ATGAGCTCCTTGTTGAGAGTTTGCTCCAGATGCTGCATCTTCCCATCTTCGGGCAGGAGGAAGACAGCACTGGCGTTGCCCGCGTAATCCATCAGCAGCA5 (0.000281%)
ATGAGGCTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACAT4 (0.000225%)
ATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGA4 (0.000225%)
ATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGA9 (0.000507%)
ATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGA8 (0.000450%)
ATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCA12 (0.000675%)
ATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTG21 (0.001182%)
ATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGG3 (0.000169%)
ATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCT4 (0.000225%)
ATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATAT11 (0.000619%)
ATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGT3 (0.000169%)
ATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTT12 (0.000675%)
ATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGC3 (0.000169%)
ATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATT4 (0.000225%)
ATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAA3 (0.000169%)
ATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTT7 (0.000394%)
ATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATA16 (0.000901%)
ATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAG16 (0.000901%)
ATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAG4 (0.000225%)
ATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCA5 (0.000281%)
ATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGG36 (0.002026%)
ATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCT31 (0.001745%)
ATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCA11 (0.000619%)
ATGGCCGAGAACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAA6 (0.000338%)
ATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGA11 (0.000619%)
ATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTGTGATCTG4 (0.000225%)
ATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGT10 (0.000563%)
ATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGC23 (0.001295%)
ATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAGGGATGAGTTGGATAAAACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAG13 (0.000732%)
ATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTC6 (0.000338%)
ATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGT4 (0.000225%)
ATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGA8 (0.000450%)
ATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCA3 (0.000169%)
ATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCT6 (0.000338%)
ATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTTTGTTT5 (0.000281%)
ATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCT20 (0.001126%)
ATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGT4 (0.000225%)
ATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGT3 (0.000169%)
ATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTT10 (0.000563%)
ATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACA7 (0.000394%)
ATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGG3 (0.000169%)
ATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGA20 (0.001126%)
ATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGG14 (0.000788%)
ATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCAC5 (0.000281%)
ATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGA4 (0.000225%)
ATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTATCCTAATTT12 (0.000675%)
ATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGG7 (0.000394%)
ATTAATTGCAGCACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTT41 (0.002308%)
ATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCG8 (0.000450%)
ATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTAT5 (0.000281%)
ATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGT24 (0.001351%)
ATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTC136 (0.007655%)
ATTAGCATTATTTGTTTGATAATAAGTTTAACTAGTCAGTGTTGGAAAGAATGGAGACGGTTGTTGATTAGGCGTTTTGAGGATGGGAATAGGATTGAAG3 (0.000169%)
ATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATA26 (0.001463%)
ATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCC66 (0.003715%)
ATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATC43 (0.002420%)
ATTCATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGG8 (0.000450%)
ATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACC9 (0.000507%)
ATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACC6 (0.000338%)
ATTCCACTTCTGATTACCAGAAGTAACTCAAGGGATCCCACTGCACATAGGACTTATTCTTCTTACATGACAAAAAATTGCTCCCCTATCAATTTTAATT4 (0.000225%)
ATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCT38 (0.002139%)
ATTCCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCAT28 (0.001576%)
ATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGAT30 (0.001689%)
ATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCT5 (0.000281%)
ATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATA8 (0.000450%)
ATTCGCGTTATTCTTTATAGCAGAGTACACTAACATTATTCTAATAAACGCCCTAACAACTATTATCTTCCTAGGACCCCTATACTATATCAATTTACCA179 (0.010075%)
ATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCATTATC31 (0.001745%)
ATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTAC14 (0.000788%)
ATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGA6 (0.000338%)
ATTCTAGCAGCTATTCTTCTAAAATTAGGTAGTTACGGAATAATTCGCATCTCCATTATTCTAGACCCACTAACAAAATATATAGCATACCCCTTCATCC4 (0.000225%)
ATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACAC35 (0.001970%)
ATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGC24 (0.001351%)
ATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCA5 (0.000281%)
ATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGA11 (0.000619%)
ATTCTGCAGCATTTTAATCTGAAGTCTCTGGTTGACCCTAAGGATATCGACCTCAGCCCTGTTACAATTGGCTTTGGCAGTATCCCACGCGAATTTAAAC32 (0.001801%)
ATTCTTTATAGCAGAGTACACTAACATTATTCTAATAAACGCCCTAACAACTATTATCTTCCTAGGACCCCTATACTATATCAATTTACCAGAACTCTAC5 (0.000281%)
ATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAAT103 (0.005797%)
ATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCAT190 (0.010694%)
ATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCATGGGCTAGATTTCCGGCTAGAGGTGGGT17 (0.000957%)
ATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGA22 (0.001238%)
ATTGCAGCACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATG18 (0.001013%)
ATTGCAGCACGCTGTCCAGCTGGGTGCTGCTGATGGATTATGCAGGCAATGCCACTGCTGTCTTCCTTCTGCCCGATGATGGGAAGATGCAGCATCTGGA194 (0.010919%)
ATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGT33 (0.001857%)
ATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGC632 (0.035572%)
ATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGG3 (0.000169%)
ATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGAC13 (0.000732%)
ATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTCGGAAGCCTGTAATTACGGCTCCAGCTCATAGTG13 (0.000732%)
ATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAA10 (0.000563%)
ATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGAT13 (0.000732%)
ATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACA52 (0.002927%)
ATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTT15 (0.000844%)
ATTGTGCCATCCCATCACAACAAGGTATCTTTCCTAAAGGGTATTATGCCGTGGCTGTGGTGAAGGCATCGGACACTAGCATCACCTGGAACAACCTGAA6 (0.000338%)
ATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCC4 (0.000225%)
ATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTA5 (0.000281%)
ATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAAGTTGAAA26 (0.001463%)
ATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAA46 (0.002589%)
ATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTT43 (0.002420%)
ATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCAC10 (0.000563%)
ATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCA14 (0.000788%)
ATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCT29 (0.001632%)
ATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCT71 (0.003996%)
ATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGA34 (0.001914%)
ATTTGCCTTTAAAAAGAATGTAATTCGCCAGGGCGAAAACTGTGTCTTGGTCCAGTTCTTTCACTGCCTCAACTATCTTTCCTTGGGTTCCCTTCTCCAC7 (0.000394%)
ATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGT39 (0.002195%)
ATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGA10 (0.000563%)
ATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTG18 (0.001013%)
ATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTG48 (0.002702%)
ATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAAT23 (0.001295%)
ATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGT31 (0.001745%)
ATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTAC17 (0.000957%)
ATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCT6 (0.000338%)
ATTTTCTCTAAGGATTCCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGG505 (0.028424%)
ATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCC9 (0.000507%)
ATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTA59 (0.003321%)
ATTTTTTATTAATTGCAGCACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCT8 (0.000450%)
CAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTC50 (0.002814%)
CAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCAC47 (0.002645%)
CAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCA39 (0.002195%)
CAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTA164 (0.009231%)
CAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACG31 (0.001745%)
CAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGT73 (0.004109%)
CAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGA31 (0.001745%)
CAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAG61 (0.003433%)
CAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCAT29 (0.001632%)
CAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTT43 (0.002420%)
CAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAA3 (0.000169%)
CAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCT29 (0.001632%)
CAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTT102 (0.005741%)
CAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAA83 (0.004672%)
CAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGT13 (0.000732%)
CAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTAT45 (0.002533%)
CAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTC9 (0.000507%)
CAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACG206 (0.011595%)
CAAAGTATGCCTTGGCCTGGCTCTGAATCTCTGAGGTCTTGGCCTTCTCCATCAAATCTTTGCCATAATCAGTCATGCTCTGAAAGTATTGAGTGAACAG8 (0.000450%)
CAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTG31 (0.001745%)
CAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTG3 (0.000169%)
CAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCT19 (0.001069%)
CAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCC59 (0.003321%)
CAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGATCCAATAATTACATGGAGTCCATGGAA37 (0.002083%)
CAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTG81 (0.004559%)
CAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAG20 (0.001126%)
CAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGT30 (0.001689%)
CAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCAC42 (0.002364%)
CAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGAC7 (0.000394%)
CAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAG17 (0.000957%)
CAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTC25 (0.001407%)
CAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAG5 (0.000281%)
CAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCAT71 (0.003996%)
CAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATC27 (0.001520%)
CAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCA21 (0.001182%)
CAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTTT20 (0.001126%)
CAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTG57 (0.003208%)
CAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGAT34 (0.001914%)
CAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTG22 (0.001238%)
CAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAA21 (0.001182%)
CAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTA24 (0.001351%)
CAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTT18 (0.001013%)
CAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCT19 (0.001069%)
CAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGA18 (0.001013%)
CAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTC45 (0.002533%)
CAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTG25 (0.001407%)
CAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTTGAC9 (0.000507%)
CAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAA18 (0.001013%)
CAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTC42 (0.002364%)
CAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAAT14 (0.000788%)
CAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGG47 (0.002645%)
CAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGAT91 (0.007581%)
CAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGT16 (0.000901%)
CAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCC43 (0.002420%)
CAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGC226 (0.012720%)
CAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTT86 (0.004841%)
CAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGC151 (0.008499%)
CAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGG325 (0.018293%)
CAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCT19 (0.001069%)
CAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATAC35 (0.001970%)
CAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGC9 (0.000507%)
CAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTC97 (0.005460%)
CAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATA50 (0.002814%)
CAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGG61 (0.003433%)
CAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGA19 (0.001069%)
CAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCGGCTTACAGCTAACA3 (0.000169%)
CAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCG38 (0.002139%)
CAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCC228 (0.012833%)
CAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTG19 (0.001069%)
CAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACT50 (0.002814%)
CAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTT11 (0.000619%)
CAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACCCCATCATCACC7 (0.000394%)
CAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAG53 (0.002983%)
CAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGC107 (0.006023%)
CAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTC32 (0.001801%)
CAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCA40 (0.002251%)
CAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAA18 (0.001013%)
CAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGCT50 (0.002814%)
CAATAATTCTAGCAGCTATTCTTCTAAAATTAGGTAGTTACGGAATAATTCGCATCTCCATTATTCTAGACCCACTAACAAAATATATAGCATACCCCTT4 (0.000225%)
CAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACAC14 (0.000788%)
CAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAG46 (0.002589%)
CAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTT80 (0.004503%)
CAATCTGTTTCTTTCTCCAGGTTATCCCAGAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTT4 (0.000225%)
CAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTC7 (0.000394%)
CAATGCCAACGCAGTAGGTCCCGTACCCACAGCGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGAGGA7 (0.000394%)
CAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGG22 (0.001238%)
CAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCA14 (0.000788%)
CAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTT7 (0.000394%)
CAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATC27 (0.001520%)
CAATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTTTGATAATAAGTTTAACTAGTCAGTGTTGGAAAGAATGGAGACGGTT248 (0.013959%)
CAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTT4 (0.000225%)
CAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTG7 (0.000394%)
CACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTC372 (0.020938%)
CACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTG11 (0.000619%)
CACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGC12 (0.000675%)
CACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTA28 (0.001576%)
CACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCT88 (0.004953%)
CACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGG52 (0.002927%)
CACAATTTCATTTTGAGAATGTTTACAGCCCATTTAATTAATCAGTGAACTAAAAGTCATAGAAATTGGATTTGTGCAAATGTAGAGAAATCTACCATAT84 (0.004728%)
CACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCAC6 (0.000338%)
CACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTC3 (0.000169%)
CACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGA8 (0.000450%)
CACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTC16 (0.000901%)
CACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCAC21 (0.001182%)
CACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTT129 (0.007261%)
CACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCT16 (0.000901%)
CACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGC4 (0.000225%)
CACACGAGCTTACTTTACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAA3 (0.000169%)
CACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAAACCCTCAACAGAC345 (0.019418%)
CACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTT23 (0.001295%)
CACACGTCTGAACTCCAGTCACGTTAGCCTAGATCTCGTA7 (0.000158%)
CACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCC11 (0.000619%)
CACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAA8 (0.000450%)
CACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACG16 (0.000901%)
CACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTC56 (0.003152%)
CACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACA132 (0.007430%)
CACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAG32 (0.001801%)
CACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTT58 (0.003265%)
CACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCC474 (0.026679%)
CACAGCAGCGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAG6 (0.000338%)
CACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTC15 (0.000844%)
CACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAA42 (0.002364%)
CACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTA57 (0.003208%)
CACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATA15 (0.000844%)
CACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCA23 (0.001295%)
CACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAAT4 (0.000225%)
CACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTC21 (0.001182%)
CACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTAC4 (0.000225%)
CACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGG18 (0.001013%)
CACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTC10 (0.000563%)
CACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATG6 (0.000338%)
CACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGC47 (0.002645%)
CACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTT11 (0.000619%)
CACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACC12 (0.000675%)
CACCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCAC31 (0.001745%)
CACCAGCTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGAC6 (0.000338%)
CACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCC7 (0.000394%)
CACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTG25 (0.001407%)
CACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACA9 (0.000507%)
CACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGG24 (0.001351%)
CACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTAT5 (0.000281%)
CACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACG16 (0.000901%)
CACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACA27 (0.001520%)
CACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAG8 (0.000450%)
CACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTAT5 (0.000281%)
CACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATA3 (0.000169%)
CACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACG10 (0.000563%)
CACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGATGGACCAGCTCCCGGTA8 (0.000450%)
CACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAG12 (0.000675%)
CACCGTGGGTGCCCTGCTGGCCTGCGCTGCCCTGGGGCTGTGTCTGGCTGTCCCTGACAAAACGGTCAAATGGTGCGCAGTGTCAGAGCACGAGAATACC5 (0.000281%)
CACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTG8 (0.000450%)
CACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCG4 (0.000225%)
CACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTAT7 (0.000394%)
CACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCC4 (0.000225%)
CACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCC4 (0.000225%)
CACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACA11 (0.000619%)
CACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTG17 (0.000957%)
CACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAG32 (0.001801%)
CACGAGCTTACTTTACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATG62 (0.003490%)
CACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTG806 (0.045366%)
CACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAAACCCTCAACAGACCA10 (0.000563%)
CACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGC15 (0.000844%)
CACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAA16 (0.000901%)
CACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTT23 (0.001295%)
CACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTT7 (0.000394%)
CACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGC105 (0.005910%)
CACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGT10 (0.000563%)
CACGTCTGAACTCCAGTCACGTTAGCCTAGATCTCGTATG6 (0.000135%)
CACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTT20 (0.001126%)
CACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGC30 (0.001689%)
CACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTAT4 (0.000225%)
CACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGA4 (0.000225%)
CACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAG30 (0.001689%)
CACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTA12 (0.000675%)
CACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTG6 (0.000338%)
CACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAG5 (0.000281%)
CACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTT9 (0.000507%)
CACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACA21 (0.001182%)
CACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGC6 (0.000338%)
CACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTC9 (0.000507%)
CACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCATTATCTTCTATCT4 (0.000225%)
CACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATAT18 (0.001013%)
CACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAA11 (0.000619%)
CACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCAT11 (0.000619%)
CACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACAC17 (0.000957%)
CACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCA6 (0.000338%)
CACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTG9 (0.000507%)
CACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGT50 (0.002814%)
CACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTG11 (0.000619%)
CACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCT15 (0.000844%)
CACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGC6 (0.000338%)
CACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCAT11 (0.000619%)
CACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGA11 (0.000619%)
CACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCA9 (0.000507%)
CACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGT9 (0.000507%)
CACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCGGC3 (0.000169%)
CACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATG11 (0.000619%)
CACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGC15 (0.000844%)
CACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGAT12 (0.000675%)
CACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTT5 (0.000281%)
CAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAG13 (0.000732%)
CAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGAC87 (0.004897%)
CAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAA88 (0.004953%)
CAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAAT112 (0.006304%)
CAGAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGGC8 (0.000450%)
CAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTG47 (0.002645%)
CAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACC226 (0.012720%)
CAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGG308 (0.017336%)
CAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGT82 (0.004615%)
CAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCG169 (0.009512%)
CAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCG114 (0.006417%)
CAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACC88 (0.004953%)
CAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTACCAGCATCTGTTCTGATTCTTTGGGCACCCAGAAGTTTA222 (0.012495%)
CAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAGGT14 (0.000788%)
CAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGC26 (0.001463%)
CAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCC20 (0.001126%)
CAGACTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAA27 (0.001520%)
CAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGC50 (0.002814%)
CAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATT115 (0.006473%)
CAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCT25 (0.001407%)
CAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGA7 (0.000394%)
CAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTG61 (0.003433%)
CAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTT106 (0.005966%)
CAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCT149 (0.008387%)
CAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGA115 (0.006473%)
CAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAGCAGC26 (0.001463%)
CAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCA8 (0.000450%)
CAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGC29 (0.001632%)
CAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCG22 (0.001238%)
CAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGG73 (0.004109%)
CAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAAC18 (0.001013%)
CAGAGTACTACGAGAGCTCTAATTGTGCCATCCCATCACAACAAGGTATCTTTCCTAAAGGGTATTATGCCGTGGCTGTGGTGAAGGCATCGGACACTAG180 (0.010131%)
CAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAAACCCTCAACAGACCAGACA6 (0.000338%)
CAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGC15 (0.000844%)
CAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTAG4553 (0.102507%)
CAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTA4 (0.000225%)
CAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCC6 (0.000338%)
CAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTG47 (0.002645%)
CAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATT45 (0.002533%)
CAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCT28 (0.001576%)
CAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGC94 (0.005291%)
CAGCACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTT23 (0.001295%)
CAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCT25 (0.001407%)
CAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGC45 (0.002533%)
CAGCAGCGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTG15 (0.000844%)
CAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGA82 (0.004615%)
CAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAG62 (0.003490%)
CAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGA7 (0.000394%)
CAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTG7 (0.000394%)
CAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGAC28 (0.001576%)
CAGCATTTTAATCTGAAGTCTCTGGTTGACCCTAAGGATATCGACCTCAGCCCTGTTACAATTGGCTTTGGCAGTATCCCACGCGAATTTAAACTCTGTG5 (0.000281%)
CAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATG4 (0.000225%)
CAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATC13 (0.000732%)
CAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAA42 (0.002364%)
CAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGC12 (0.000675%)
CAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCT38 (0.002139%)
CAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCC11 (0.000619%)
CAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAG11 (0.000619%)
CAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATG21 (0.001182%)
CAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGC674 (0.037936%)
CAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCT17 (0.000957%)
CAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCC199 (0.011201%)
CAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTC3 (0.000169%)
CAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAG80 (0.004503%)
CAGCGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCA3 (0.000169%)
CAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCC13 (0.000732%)
CAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCC26 (0.001463%)
CAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGT9 (0.000507%)
CAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTG10 (0.000563%)
CAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATAC359 (0.020206%)
CAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTA19 (0.001069%)
CAGCTGGGTGCTGCTGATGGATTATGCAGGCAATGCCACTGCTGTCTTCCTTCTGCCCGATGATGGGAAGATGCAGCATCTGGAGCAAACTCTCAGCAAG12 (0.000675%)
CAGCTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTG16 (0.000901%)
CAGCTTCCTCAGTGTTCTCAGGATCGAATGGCTTCTTCCATTTGCCTTTAAAAAGAATGTAATTCGCCAGGGCGAAAACTGTGTCTTGGTCCAGTTCTTT3 (0.000169%)
CAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTC36 (0.002026%)
CAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGC29 (0.001632%)
CAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCA98 (0.005516%)
CAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAAC36 (0.002026%)
CAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGT97 (0.005460%)
CAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCA8 (0.000450%)
CAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCC314 (0.017674%)
CAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTT18 (0.001013%)
CAGGATCTTAGAGATGAGCTCCTTGTTGAGAGTTTGCTCCAGATGCTGCATCTTCCCATCTTCGGGCAGGAGGAAGACAGCACTGGCGTTGCCCGCGTAA12 (0.000675%)
CAGGATGAGGCTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGA5 (0.000281%)
CAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCT11 (0.000619%)
CAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCC77 (0.004334%)
CAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGT29 (0.001632%)
CAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAG5 (0.000281%)
CAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACC8 (0.000450%)
CAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTAC459 (0.025835%)
CAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTG48 (0.002702%)
CAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCT4 (0.000225%)
CAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCC3 (0.000169%)
CAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACA188 (0.010582%)
CAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACA7 (0.000394%)
CAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGC9 (0.000507%)
CAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCT16 (0.000901%)
CAGGGTGCCCCTCCAACCAGGATGAGGCTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGG21 (0.001182%)
CAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGC18 (0.001013%)
CAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGA18 (0.001013%)
CAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAAC46 (0.002589%)
CAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGG3 (0.000169%)
CAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGG43 (0.002420%)
CAGTAATGTTAGCTGTAAGCCGGACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGT19 (0.001069%)
CAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGG10 (0.000563%)
CAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACT6 (0.000338%)
CAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTG7 (0.000394%)
CAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACT32 (0.001801%)
CAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTC6 (0.000338%)
CAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGA51 (0.002871%)
CAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTACCAGCA4 (0.000225%)
CAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAA4 (0.000225%)
CAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCA12 (0.000675%)
CAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGC8 (0.000450%)
CAGTGTTCTCAGGATCGAATGGCTTCTTCCATTTGCCTTTAAAAAGAATGTAATTCGCCAGGGCGAAAACTGTGTCTTGGTCCAGTTCTTTCACTGCCTC3 (0.000169%)
CAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGAT8 (0.000450%)
CAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCA11 (0.000619%)
CAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAA5 (0.000281%)
CATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGG17 (0.000957%)
CATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGC8 (0.000450%)
CATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACAC3 (0.000169%)
CATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAA8 (0.000450%)
CATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCT8 (0.000450%)
CATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGA18 (0.001013%)
CATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGA11 (0.000619%)
CATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCACCCAGCGCAGGTAA3 (0.000169%)
CATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGC15 (0.000844%)
CATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGA11 (0.000619%)
CATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGT6 (0.000338%)
CATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACA11 (0.000619%)
CATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCA10 (0.000563%)
CATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGC10 (0.000563%)
CATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAA4 (0.000225%)
CATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAAC5 (0.000281%)
CATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACC5 (0.000281%)
CATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGC5 (0.000281%)
CATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGG7 (0.000394%)
CATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGT25 (0.001407%)
CATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCT7 (0.000394%)
CATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATG10 (0.000563%)
CATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTC5 (0.000281%)
CATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACC15 (0.000844%)
CATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTGGAGAGCATA13 (0.000732%)
CATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAG12 (0.000675%)
CATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAAT39 (0.002195%)
CATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAG3 (0.000169%)
CATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAA4 (0.000225%)
CATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGC9 (0.000507%)
CATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAA25 (0.001407%)
CATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTG28 (0.001576%)
CATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGC37 (0.002083%)
CATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTG24 (0.001351%)
CATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACAT21 (0.001182%)
CATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAG16 (0.000901%)
CATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTC9 (0.000507%)
CATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTC23 (0.001295%)
CATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATA11 (0.000619%)
CATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAG5 (0.000281%)
CATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTT9 (0.000507%)
CATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCT7 (0.000394%)
CATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAA19 (0.001069%)
CATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAG7 (0.000394%)
CATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTG8 (0.000450%)
CATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTG18 (0.001013%)
CATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTTTGTT45 (0.002533%)
CATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTT7 (0.000394%)
CATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGAC14 (0.000788%)
CATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTG15 (0.000844%)
CATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTTTGATAATAAGTTTAACTAGTCAGTGTTGGAAAGAATGGAGACGGTTGTTGATTAGGCGTT8 (0.000450%)
CATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCA6 (0.000338%)
CATTATTTGTTTGATAATAAGTTTAACTAGTCAGTGTTGGAAAGAATGGAGACGGTTGTTGATTAGGCGTTTTGAGGATGGGAATAGGATTGAAGGAAAT3 (0.000169%)
CATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAAC6 (0.000338%)
CATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGA12 (0.000675%)
CATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACA7 (0.000394%)
CATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTC16 (0.000901%)
CATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGA30 (0.001689%)
CATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGAC26 (0.001463%)
CATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTT10 (0.000563%)
CATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAA4 (0.000225%)
CATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACAT7 (0.000394%)
CATTTTTTATTAATTGCAGCACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCC5 (0.000281%)
CCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCT16 (0.000901%)
CCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCAC14 (0.000788%)
CCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAG48 (0.002702%)
CCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCA15 (0.000844%)
CCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCT23 (0.001295%)
CCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAA156 (0.008781%)
CCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTG10 (0.000563%)
CCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCA7 (0.000394%)
CCAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGA323 (0.018180%)
CCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCAT18 (0.001013%)
CCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGA21 (0.001182%)
CCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTT3 (0.000169%)
CCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGG32 (0.001801%)
CCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGT18 (0.001013%)
CCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTTGA7 (0.000394%)
CCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAA16 (0.000901%)
CCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCT9 (0.000507%)
CCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCG683 (0.038443%)
CCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAG41 (0.002308%)
CCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGC33 (0.001857%)
CCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGAC13 (0.000732%)
CCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGA14 (0.000788%)
CCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTT14 (0.000788%)
CCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCC4 (0.000225%)
CCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGC22 (0.001238%)
CCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAA26 (0.001463%)
CCAATCTGTTTCTTTCTCCAGGTTATCCCAGAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTT212 (0.011932%)
CCAATGCCAACGCAGTAGGTCCCGTACCCACAGCGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGAGG339 (0.019081%)
CCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAG44 (0.002477%)
CCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGC4 (0.000225%)
CCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACT8 (0.000450%)
CCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTG10 (0.000563%)
CCACATAGCACTTGTTATTGCATCAATCATAATCCAAACTCCATGAAGCTTCATAGGAGCAACAATACTAATAATCGCACATGGCCTCACATCATCACTC4 (0.000225%)
CCACCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCA8 (0.000450%)
CCACCAGCTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGA5 (0.000281%)
CCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTC7 (0.000394%)
CCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGAC5 (0.000281%)
CCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTA32 (0.001801%)
CCACCTTAGGAGAATGAAGAGTTTCTCCCGAGGCCGACTCCACCGAGGCCACAGGAGAGAAGGCGTGGCGTAGGTCGTGGTAAGTTCGGTGGTCTGAAAG26 (0.001463%)
CCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCT14 (0.000788%)
CCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACA11 (0.000619%)
CCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCA17 (0.000957%)
CCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGC4 (0.000225%)
CCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAG12 (0.000675%)
CCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGT24 (0.001351%)
CCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATA7 (0.000394%)
CCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCT21 (0.001182%)
CCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCG9 (0.000507%)
CCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGAT5 (0.000281%)
CCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGA49 (0.002758%)
CCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAA17 (0.000957%)
CCAGAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGG4 (0.000225%)
CCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGC16 (0.000901%)
CCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATG5 (0.000281%)
CCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATG19 (0.001069%)
CCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATG15 (0.000844%)
CCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTG22 (0.001238%)
CCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCT146 (0.008218%)
CCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCAT7 (0.000394%)
CCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAG10 (0.000563%)
CCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACC15 (0.000844%)
CCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTC10 (0.000563%)
CCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGT6 (0.000338%)
CCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCC7 (0.000394%)
CCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTG7 (0.000394%)
CCAGCTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTT22 (0.001238%)
CCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATG5 (0.000281%)
CCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTG14 (0.000788%)
CCAGGATGAGGCTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGG30 (0.001689%)
CCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCA16 (0.000901%)
CCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAAC9 (0.000507%)
CCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCT12 (0.000675%)
CCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCAC5 (0.000281%)
CCAGGGTGCCCCTCCAACCAGGATGAGGCTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCG35 (0.001970%)
CCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAG11 (0.000619%)
CCAGGTTATCCCAGAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTT12 (0.000675%)
CCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAAC35 (0.001970%)
CCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATT50 (0.002814%)
CCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAG9 (0.000507%)
CCAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTC4 (0.000225%)
CCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGA8 (0.000450%)
CCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGC16 (0.000901%)
CCAGTTCTACTCTGTACACTCCTTCTACAAACTTCTCATCTGTGGTGAGCCCGTGCAGCTCTCCAGACTCCGCGGTCTTCCCAGAGGCAAAGGGCTCCCA336 (0.018912%)
CCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAG3 (0.000169%)
CCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAAC9 (0.000507%)
CCATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGG101 (0.005685%)
CCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACG3 (0.000169%)
CCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGC44 (0.002477%)
CCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAA11 (0.000619%)
CCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACAC4 (0.000225%)
CCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAG27 (0.001520%)
CCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGC4 (0.000225%)
CCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCAC8 (0.000450%)
CCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAA7 (0.000394%)
CCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGG7 (0.000394%)
CCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATA23 (0.001295%)
CCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTT4 (0.000225%)
CCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCT19 (0.001069%)
CCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGC12 (0.000675%)
CCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCT7 (0.000394%)
CCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAA33 (0.001857%)
CCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTAC4 (0.000225%)
CCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAG4 (0.000225%)
CCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACA4 (0.000225%)
CCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATC4 (0.000225%)
CCATTTTTTATTAATTGCAGCACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTC282 (0.015872%)
CCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAG24 (0.001351%)
CCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGT7 (0.000394%)
CCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTG120 (0.006754%)
CCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGA80 (0.004503%)
CCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACA22 (0.001238%)
CCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCAT49 (0.002758%)
CCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGC5 (0.000281%)
CCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGC41 (0.002308%)
CCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCG9 (0.000507%)
CCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGA21 (0.001182%)
CCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAG8 (0.000450%)
CCCAGAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTG11 (0.000619%)
CCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCG14 (0.000788%)
CCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCC9 (0.000507%)
CCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCAT27 (0.001520%)
CCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAA11 (0.000619%)
CCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAA17 (0.000957%)
CCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTATCCT13 (0.000732%)
CCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCA16 (0.000901%)
CCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAA19 (0.001069%)
CCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAG10 (0.000563%)
CCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACAC64 (0.003602%)
CCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATG10 (0.000563%)
CCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCT20 (0.001126%)
CCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGAC37 (0.002083%)
CCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAA20 (0.001126%)
CCCCATTCCACTTCTGATTACCAGAAGTAACTCAAGGGATCCCACTGCACATAGGACTTATTCTTCTTACATGACAAAAAATTGCTCCCCTATCAATTTT10 (0.000563%)
CCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAA6 (0.000338%)
CCCCTCCAACCAGGATGAGGCTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGA3 (0.000169%)
CCCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAG5 (0.000281%)
CCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTAT6 (0.000338%)
CCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGG10 (0.000563%)
CCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAA73 (0.004109%)
CCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGGCCCAAGGA5 (0.000281%)
CCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAG30 (0.001689%)
CCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACCCCAT10 (0.000563%)
CCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTG31 (0.001745%)
CCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCC4 (0.000225%)
CCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACC3 (0.000169%)
CCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGT33 (0.001857%)
CCCTCCTCCTCGTATCCATCTGGAAACAGATCTATAGAAGTTGGAACCTGCCCCCAGGACCTTTCCCAATTCCTTTCTTTGGAAACATTTTTCAGCTGGA3 (0.000169%)
CCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCC7 (0.000394%)
CCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGA8 (0.000450%)
CCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGC13 (0.000732%)
CCCTGCTGGCCTGCGCTGCCCTGGGGCTGTGTCTGGCTGTCCCTGACAAAACGGTCAAATGGTGCGCAGTGTCAGAGCACGAGAATACCAAGTGCATCAG4 (0.000225%)
CCCTGGGCACATGGGGGACACTGGACCAGCAGCACCAGGCTGGCCCACCTTAGGAGAATGAAGAGTTTCTCCCGAGGCCGACTCCACCGAGGCCACAGGA5 (0.000281%)
CCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATAT30 (0.001689%)
CCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATT5 (0.000281%)
CCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATT15 (0.000844%)
CCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAG4 (0.000225%)
CCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCA3 (0.000169%)
CCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGATGGACCAGCTCCCGGTATA4 (0.000225%)
CCCTTTGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAGGAGTGTACAGAGTAGAACTGGACACCA4 (0.000225%)
CCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGA17 (0.000957%)
CCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAG43 (0.002420%)
CCGACTCCACCGAGGCCACAGGAGAGAAGGCGTGGCGTAGGTCGTGGTAAGTTCGGTGGTCTGAAAGTCCTCGTGGAACCACCACAGGTCCCACCACCAC4 (0.000225%)
CCGAGAACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCC52 (0.002927%)
CCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAG32 (0.001801%)
CCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAA11 (0.000619%)
CCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCT14 (0.000788%)
CCGAGGCCGACTCCACCGAGGCCACAGGAGAGAAGGCGTGGCGTAGGTCGTGGTAAGTTCGGTGGTCTGAAAGTCCTCGTGGAACCACCACAGGTCCCAC14 (0.000788%)
CCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGGCCCAAGGAG11 (0.000619%)
CCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGC15 (0.000844%)
CCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTACCAGCATCTGTTCTGATTCTTTGGGCACCCAGAAGTTTATATT38 (0.002139%)
CCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGT12 (0.000675%)
CCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGA83 (0.004672%)
CCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTAC25 (0.001407%)
CCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGA10 (0.000563%)
CCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACC39 (0.002195%)
CCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGC32 (0.001801%)
CCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACCCCATC15 (0.000844%)
CCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGT6 (0.000338%)
CCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCC8 (0.000450%)
CCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGA31 (0.001745%)
CCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGT90 (0.005066%)
CCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAGGAGTGTACAGAGTAGAACTGGACACCAAATCGTACTGGAAGACACT8 (0.000450%)
CCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTAC479 (0.026961%)
CCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTT38 (0.002139%)
CCGGACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGG135 (0.007599%)
CCGGCTGCGTATTCTACGTTAAACCCTGATACTAATTCTGATTCTCCTTCTGTCAGGTCGAAGGGGGCCCGGTTTGTTTCTGCTAGGGTTGAGATAAATC3 (0.000169%)
CCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTT576 (0.032420%)
CCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGAC11 (0.000619%)
CCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTT15 (0.000844%)
CCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGC16 (0.000901%)
CCGTGGGTGCCCTGCTGGCCTGCGCTGCCCTGGGGCTGTGTCTGGCTGTCCCTGACAAAACGGTCAAATGGTGCGCAGTGTCAGAGCACGAGAATACCAA5 (0.000281%)
CCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGT8 (0.000450%)
CCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTG16 (0.000901%)
CCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTAT7 (0.000394%)
CCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCA18 (0.001013%)
CCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCA12 (0.000675%)
CCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTG17 (0.000957%)
CCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCT13 (0.000732%)
CCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAA4 (0.000225%)
CCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTT8 (0.000450%)
CCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCC5 (0.000281%)
CCTATCCATAAAACTAGGCCTCGCCCCATTCCACTTCTGATTACCAGAAGTAACTCAAGGGATCCCACTGCACATAGGACTTATTCTTCTTACATGACAA3 (0.000169%)
CCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTT4 (0.000225%)
CCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTT7 (0.000394%)
CCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACA31 (0.001745%)
CCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTTGTGGA3 (0.000169%)
CCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTG9 (0.000507%)
CCTCAGTGTTCTCAGGATCGAATGGCTTCTTCCATTTGCCTTTAAAAAGAATGTAATTCGCCAGGGCGAAAACTGTGTCTTGGTCCAGTTCTTTCACTGC6 (0.000338%)
CCTCAGTTAGCCACATAGCACTTGTTATTGCATCAATCATAATCCAAACTCCATGAAGCTTCATAGGAGCAACAATACTAATAATCGCACATGGCCTCAC3 (0.000169%)
CCTCCAACCAGGATGAGGCTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATT3 (0.000169%)
CCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATC12 (0.000675%)
CCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTG7 (0.000394%)
CCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGG9 (0.000507%)
CCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCC4 (0.000225%)
CCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTG11 (0.000619%)
CCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTG5 (0.000281%)
CCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTA14 (0.000788%)
CCTCCTCCTCGTATCCATCTGGAAACAGATCTATAGAAGTTGGAACCTGCCCCCAGGACCTTTCCCAATTCCTTTCTTTGGAAACATTTTTCAGCTGGAT3 (0.000169%)
CCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGC5 (0.000281%)
CCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGC12 (0.000675%)
CCTCGCCCCATTCCACTTCTGATTACCAGAAGTAACTCAAGGGATCCCACTGCACATAGGACTTATTCTTCTTACATGACAAAAAATTGCTCCCCTATCA14 (0.000788%)
CCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCG5 (0.000281%)
CCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAG8 (0.000450%)
CCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTC7 (0.000394%)
CCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCC3 (0.000169%)
CCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGAT152 (0.008555%)
CCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAA9 (0.000507%)
CCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAG8 (0.000450%)
CCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGC581 (0.032702%)
CCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCT142 (0.007993%)
CCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTA19 (0.001069%)
CCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACT34 (0.001914%)
CCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCT9 (0.000507%)
CCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCA5 (0.000281%)
CCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTAT3 (0.000169%)
CCTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCT3 (0.000169%)
CCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCA38 (0.002139%)
CCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGAT20 (0.001126%)
CCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTC7 (0.000394%)
CCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCCCAAATCATT6 (0.000338%)
CCTGCAGTAATGTTAGCTGTAAGCCGGACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTG4 (0.000225%)
CCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGA10 (0.000563%)
CCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAA10 (0.000563%)
CCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCT4 (0.000225%)
CCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTT12 (0.000675%)
CCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTG50 (0.002814%)
CCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTC75 (0.004221%)
CCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACAT27 (0.001520%)
CCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGG9 (0.000507%)
CCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGT14 (0.000788%)
CCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTG13 (0.000732%)
CCTGGGAGCCCTTTGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAGGAGTGTACAGAGTAGAACT10 (0.000563%)
CCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAG38 (0.002139%)
CCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGC3 (0.000169%)
CCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTT16 (0.000901%)
CCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATC15 (0.000844%)
CCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGT7 (0.000394%)
CCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGT16 (0.000901%)
CCTGTCTCCTGCTTCTCCTCCTTGCCAGCCTGAGCAGCACCACCTATCTCCAGCAACAGATGAGACAGACTACAGAGCTGCAGCCTTTGCACGGGGAAGA9 (0.000507%)
CCTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGT7 (0.000394%)
CCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTT18 (0.001013%)
CCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTA25 (0.001407%)
CCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTT3 (0.000169%)
CCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGG3 (0.000169%)
CCTTAACATAACATTAATAGCCCTATCCATAAAACTAGGCCTCGCCCCATTCCACTTCTGATTACCAGAAGTAACTCAAGGGATCCCACTGCACATAGGA148 (0.008330%)
CCTTAATCTTATCTATCCTAATTTTAGCCCTAATACCTTTCCTTCATACCTCAAAGCAACGAAGCCTAATATTCCGCCCAATCACACAAATTTTGTACTG8 (0.000450%)
CCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTC5 (0.000281%)
CCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTT24 (0.001351%)
CCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAAGTTGAAACCATTTGAACTATTCTACC29 (0.001632%)
CCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAG8 (0.000450%)
CCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGA46 (0.002589%)
CCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGC31 (0.001745%)
CCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCGGCTTACA3 (0.000169%)
CCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGC4 (0.000225%)
CCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGA8 (0.000450%)
CCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCAC22 (0.001238%)
CCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTC6 (0.000338%)
CCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTT28 (0.001576%)
CCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGC11 (0.000619%)
CCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCA96 (0.005403%)
CCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGATGGACCAGCTCCCGGTATAG11 (0.000619%)
CCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACT5 (0.000281%)
CCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAAC19 (0.001069%)
CCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGAT6 (0.000338%)
CCTTGTTGAGAGTTTGCTCCAGATGCTGCATCTTCCCATCTTCGGGCAGGAGGAAGACAGCACTGGCGTTGCCCGCGTAATCCATCAGCAGCACCCAGCT5 (0.000281%)
CCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGA6 (0.000338%)
CCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGAC10 (0.000563%)
CCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAG12 (0.000675%)
CCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACT6 (0.000338%)
CCTTTGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAGGAGTGTACAGAGTAGAACTGGACACCAA3 (0.000169%)
CCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGC13 (0.000732%)
CCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGC6 (0.000338%)
CGAAAACTGTGTCTTGGTCCAGTTTTTTCACCGCCTCAGCTATCTTTCCTTGGGTTCCCTTCTCCACAAAATCATTAATCACTTTCTTGGCCTCCTCTGA167 (0.009400%)
CGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAA12 (0.000675%)
CGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACG28 (0.001576%)
CGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACC17 (0.000957%)
CGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAG177 (0.009963%)
CGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGC147 (0.008274%)
CGAATGGGCCGGCTGCGTATTCTACGTTAAACCCTGATACTAATTCTGATTCTCCTTCTGTCAGGTCGAAGGGGGCCCGGTTTGTTTCTGCTAGGGTTGA7 (0.000394%)
CGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCA14 (0.000788%)
CGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACC40 (0.002251%)
CGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAG6 (0.000338%)
CGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCT26 (0.001463%)
CGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCT182 (0.010244%)
CGACTCCACCGAGGCCACAGGAGAGAAGGCGTGGCGTAGGTCGTGGTAAGTTCGGTGGTCTGAAAGTCCTCGTGGAACCACCACAGGTCCCACCACCACA5 (0.000281%)
CGAGAACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCA63 (0.003546%)
CGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGA23 (0.001295%)
CGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGA40 (0.002251%)
CGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAA46 (0.002589%)
CGAGAGCTCTAATTGTGCCATCCCATCACAACAAGGTATCTTTCCTAAAGGGTATTATGCCGTGGCTGTGGTGAAGGCATCGGACACTAGCATCACCTGG4 (0.000225%)
CGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTT88 (0.004953%)
CGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTG17 (0.000957%)
CGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCA40 (0.002251%)
CGAGCTTACTTTACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGAT25 (0.001407%)
CGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCC4 (0.000225%)
CGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGGTTCAGCTGTTGGCCCAAGGAGG3 (0.000169%)
CGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGAC82 (0.004615%)
CGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCT24 (0.001351%)
CGATGTCAAGGGATGAGTTGGATAAAACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTT210 (0.011820%)
CGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCA828 (0.046604%)
CGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATAC22 (0.001238%)
CGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATT33 (0.001857%)
CGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGG73 (0.004109%)
CGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGC21 (0.001182%)
CGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAAACCCTCAACAGACCAGA53 (0.002983%)
CGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATG13 (0.000732%)
CGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTC14 (0.000788%)
CGCAGGTCTGGCTTTCTCGCCAAGTGTCTTCAGGTGGGTTTTGGCCCTGGTGTGGTACTCGTTCAAGGTAGGGTTGCTCTTGAGCTCAGCCAGGCGCTGG249 (0.014015%)
CGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAA36 (0.002026%)
CGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTG21 (0.001182%)
CGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACA56 (0.003152%)
CGCCAAGTGTCTTCAGGTGGGTTTTGGCCCTGGTGTGGTACTCGTTCAAGGTAGGGTTGCTCTTGAGCTCAGCCAGGCGCTGGGCCAGGCTCTCGCGCAT10 (0.000563%)
CGCCACCAGGTCGGACGTACTTGAGGGAATTCAGAATCTCTTCATTCTTGCCATTCTCCTGGTGTCCGAACTGATTGCACGGGAAACCGAGCACCACCAG3 (0.000169%)
CGCCACCCTCCTCCTCGTATCCATCTGGAAACAGATCTATAGAAGTTGGAACCTGCCCCCAGGACCTTTCCCAATTCCTTTCTTTGGAAACATTTTTCAG23 (0.001295%)
CGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTAC21 (0.001182%)
CGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCC104 (0.005854%)
CGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAG4 (0.000225%)
CGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCA10 (0.000563%)
CGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCA16 (0.000901%)
CGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCC18 (0.001013%)
CGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCT15 (0.000844%)
CGCCTACTCCTCAGTTAGCCACATAGCACTTGTTATTGCATCAATCATAATCCAAACTCCATGAAGCTTCATAGGAGCAACAATACTAATAATCGCACAT5 (0.000281%)
CGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGC8 (0.000450%)
CGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACCCCATCA8 (0.000450%)
CGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTG8 (0.000450%)
CGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATAC17 (0.000957%)
CGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCC9 (0.000507%)
CGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACC20 (0.001126%)
CGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCT5 (0.000281%)
CGCCTGTTTAGCAGGATCTTAGAGATGAGCTCCTTGTTGAGAGTTTGCTCCAGATGCTGCATCTTCCCATCTTCGGGCAGGAGGAAGACAGCACTGGCGT172 (0.009681%)
CGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGAT331 (0.018630%)
CGCGAATGGGCCGGCTGCGTATTCTACGTTAAACCCTGATACTAATTCTGATTCTCCTTCTGTCAGGTCGAAGGGGGCCCGGTTTGTTTCTGCTAGGGTT137 (0.007711%)
CGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCG27 (0.001520%)
CGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCAC25 (0.001407%)
CGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTG23 (0.001295%)
CGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAGGAGTGTACAGAGTAGAACTGGACACCAAATCGTACTGGAAGACACTT20 (0.001126%)
CGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCG43 (0.002420%)
CGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAG18 (0.001013%)
CGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGC46 (0.002589%)
CGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTG14 (0.000788%)
CGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTGGAGAGCATACCG23 (0.001295%)
CGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTT12 (0.000675%)
CGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAG248 (0.013959%)
CGCTGGTGCCCTGGTACTGCTGGGGCGAGACTTTTGTAAACAGCCTGTTCGTTAGCACCTTCTTGCGATACACTCTGGTGCTCAACGCCACCTGGCTGGT3 (0.000169%)
CGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCA26 (0.001463%)
CGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCA283 (0.023575%)
CGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAG62 (0.003490%)
CGGAAGAGCACACGTCTGAACTCCAGTCACGTTAGCCTAG7 (0.000158%)
CGGAAGCCTGTAATTACGGCTCCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTA18 (0.001013%)
CGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTT27 (0.001520%)
CGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCAT17 (0.000957%)
CGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGT41 (0.002308%)
CGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAA16 (0.000901%)
CGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCATTATCTTC21 (0.001182%)
CGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAAT29 (0.001632%)
CGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCA141 (0.007936%)
CGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGT30 (0.001689%)
CGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCC25 (0.001407%)
CGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGC7 (0.000394%)
CGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGAC260 (0.014634%)
CGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTC131 (0.007373%)
CGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAA42 (0.002364%)
CGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTT55 (0.003096%)
CGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCG7 (0.000394%)
CGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGA80 (0.004503%)
CGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAA27 (0.001520%)
CGGCTGCGTATTCTACGTTAAACCCTGATACTAATTCTGATTCTCCTTCTGTCAGGTCGAAGGGGGCCCGGTTTGTTTCTGCTAGGGTTGAGATAAATCA3 (0.000169%)
CGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAAC43 (0.002420%)
CGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAAT48 (0.002702%)
CGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGT33 (0.001857%)
CGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGG12 (0.000675%)
CGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTT68 (0.003827%)
CGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAA26 (0.001463%)
CGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAG9 (0.000507%)
CGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGC11 (0.000619%)
CGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTA21 (0.001182%)
CGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTT5 (0.000281%)
CGGTTACAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGA227 (0.012777%)
CGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTC7 (0.000394%)
CGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTT10 (0.000563%)
CGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAAC5 (0.000281%)
CGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATAC5 (0.000281%)
CGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCACCCAGCGCAGG449 (0.025272%)
CGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAA18 (0.001013%)
CGTCTGAACTCCAGTCACGTTAGCCTAGATCTCGTATGCC6 (0.000135%)
CGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGC13 (0.000732%)
CGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTG5 (0.000281%)
CGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATC107 (0.006023%)
CGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCAC3 (0.000169%)
CGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTG4 (0.000225%)
CGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTG6 (0.000338%)
CGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCC18 (0.001013%)
CGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCC9 (0.000507%)
CGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCA4 (0.000225%)
CGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATC12 (0.000675%)
CGTGGGTGCCCTGCTGGCCTGCGCTGCCCTGGGGCTGTGTCTGGCTGTCCCTGACAAAACGGTCAAATGGTGCGCAGTGTCAGAGCACGAGAATACCAAG6 (0.000338%)
CGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTG9 (0.000507%)
CGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGATGGACC6 (0.000338%)
CGTGTGTCTTCTCAAAGTATGCCTTGGCCTGGCTCTGAATCTCTGAGGTCTTGGCCTTCTCCATCAAATCTTTGCCATAATCAGTCATGCTCTGAAAGTA8 (0.000450%)
CGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGA40 (0.002251%)
CGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGG10 (0.000563%)
CGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTC39 (0.002195%)
CGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGC38 (0.002139%)
CTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAA17 (0.000957%)
CTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCATGGGCTAGATTTCCGGCTAGAGGTGGGTAGACTGT25 (0.001407%)
CTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAAT23 (0.001295%)
CTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGG10 (0.000563%)
CTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAG6 (0.000338%)
CTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGA16 (0.000901%)
CTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCA30 (0.001689%)
CTAAGGATTCCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTT21 (0.001182%)
CTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAA105 (0.005910%)
CTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAAG12 (0.000675%)
CTAATTGTGCCATCCCATCACAACAAGGTATCTTTCCTAAAGGGTATTATGCCGTGGCTGTGGTGAAGGCATCGGACACTAGCATCACCTGGAACAACCT11 (0.000619%)
CTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTCGGAAGCCTG3 (0.000169%)
CTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGT5 (0.000281%)
CTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTC12 (0.000675%)
CTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGAT22 (0.001238%)
CTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTC9 (0.000507%)
CTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGG43 (0.002420%)
CTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTACC3 (0.000169%)
CTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATT9 (0.000507%)
CTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAG5 (0.000281%)
CTACGAGAGCTCTAATTGTGCCATCCCATCACAACAAGGTATCTTTCCTAAAGGGTATTATGCCGTGGCTGTGGTGAAGGCATCGGACACTAGCATCACC4 (0.000225%)
CTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGA60 (0.003377%)
CTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTT9 (0.000507%)
CTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAG5 (0.000281%)
CTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAGGTCTGCA3 (0.000169%)
CTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAA16 (0.000901%)
CTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTCCGATTAT12 (0.000675%)
CTACTCCTCAGTTAGCCACATAGCACTTGTTATTGCATCAATCATAATCCAAACTCCATGAAGCTTCATAGGAGCAACAATACTAATAATCGCACATGGC11 (0.000619%)
CTACTCTGTACACTCCTTCTACAAACTTCTCATCTGTGGTGAGCCCGTGCAGCTCTCCAGACTCCGCGGTCTTCCCAGAGGCAAAGGGCTCCCAGGATCC16 (0.000901%)
CTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACC52 (0.002927%)
CTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCAC11 (0.000619%)
CTAGCAGCTATTCTTCTAAAATTAGGTAGTTACGGAATAATTCGCATCTCCATTATTCTAGACCCACTAACAAAATATATAGCATACCCCTTCATCCTTC12 (0.000675%)
CTAGCCTTAATCTTATCTATCCTAATTTTAGCCCTAATACCTTTCCTTCATACCTCAAAGCAACGAAGCCTAATATTCCGCCCAATCACACAAATTTTGT252 (0.014184%)
CTAGCGGTGGCCAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCT19 (0.001069%)
CTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGC11 (0.000619%)
CTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTCCGATTATTAGTGGGACAAGTCA5 (0.000281%)
CTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTAGGGTTCATGTTCGTCCTTTTGGTGTGTGGATTAGCATTATTTGTTTGATAAT11 (0.000619%)
CTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGA628 (0.035347%)
CTAGGCCATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGG595 (0.033490%)
CTAGGCCTCGCCCCATTCCACTTCTGATTACCAGAAGTAACTCAAGGGATCCCACTGCACATAGGACTTATTCTTCTTACATGACAAAAAATTGCTCCCC4 (0.000225%)
CTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCC15 (0.000844%)
CTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGC13 (0.000732%)
CTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTT7 (0.000394%)
CTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAG17 (0.000957%)
CTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTG33 (0.001857%)
CTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTC42 (0.002364%)
CTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGG4 (0.000225%)
CTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCC10 (0.000563%)
CTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGAC13 (0.000732%)
CTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCC29 (0.001632%)
CTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGG19 (0.001069%)
CTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAG55 (0.003096%)
CTATGGCCGAGAACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCC10 (0.000563%)
CTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTT10 (0.000563%)
CTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCA3 (0.000169%)
CTCAAAGTATGCCTTGGCCTGGCTCTGAATCTCTGAGGTCTTGGCCTTCTCCATCAAATCTTTGCCATAATCAGTCATGCTCTGAAAGTATTGAGTGAAC22 (0.001238%)
CTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACCCCATCATCA6 (0.000338%)
CTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGAC12 (0.000675%)
CTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGC61 (0.003433%)
CTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTA24 (0.001351%)
CTCACCGTGGGTGCCCTGCTGGCCTGCGCTGCCCTGGGGCTGTGTCTGGCTGTCCCTGACAAAACGGTCAAATGGTGCGCAGTGTCAGAGCACGAGAATA350 (0.019700%)
CTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGC6 (0.000338%)
CTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTA65 (0.003659%)
CTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAAC27 (0.001520%)
CTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTG73 (0.004109%)
CTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTA23 (0.001295%)
CTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCT50 (0.002814%)
CTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAG6 (0.000338%)
CTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAG14 (0.000788%)
CTCAGCTTCCTCAGTGTTCTCAGGATCGAATGGCTTCTTCCATTTGCCTTTAAAAAGAATGTAATTCGCCAGGGCGAAAACTGTGTCTTGGTCCAGTTCT67 (0.003771%)
CTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGG202 (0.016827%)
CTCAGGCTACCCTGAGAAAAAAAGACATGAAGACTCAGGACTCATCTTTTCTGTTGGTGTAAAATCAACACCCTAAGGAACACAAATTTCTTTAAACATT136 (0.007655%)
CTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTTGTGGAA3 (0.000169%)
CTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTC233 (0.013114%)
CTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGT89 (0.005009%)
CTCAGTTAGCCACATAGCACTTGTTATTGCATCAATCATAATCCAAACTCCATGAAGCTTCATAGGAGCAACAATACTAATAATCGCACATGGCCTCACA6 (0.000338%)
CTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCAC6 (0.000338%)
CTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTT40 (0.002251%)
CTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATC39 (0.002195%)
CTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCC108 (0.006079%)
CTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACT32 (0.001801%)
CTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGG13 (0.000732%)
CTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTC22 (0.001238%)
CTCCAACCAGGATGAGGCTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTT26 (0.001463%)
CTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGG65 (0.003659%)
CTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCGGCTTACAGCTAACATTACTGC5 (0.000281%)
CTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCC30 (0.001689%)
CTCCACCAGCTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAG361 (0.020319%)
CTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCA42 (0.002364%)
CTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACA9 (0.000507%)
CTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCC35 (0.001970%)
CTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGC33 (0.001857%)
CTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGC8 (0.000450%)
CTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCC5 (0.000281%)
CTCCAGGTTATCCCAGAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATTCAGG8 (0.000450%)
CTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAA80 (0.004503%)
CTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGG52 (0.002927%)
CTCCCTGGGCACATGGGGGACACTGGACCAGCAGCACCAGGCTGGCCCACCTTAGGAGAATGAAGAGTTTCTCCCGAGGCCGACTCCACCGAGGCCACAG386 (0.021726%)
CTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGG14 (0.000788%)
CTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTG4 (0.000225%)
CTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGC19 (0.001069%)
CTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTAC24 (0.001351%)
CTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACT4 (0.000225%)
CTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCC33 (0.001857%)
CTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGGTCATTGTTGACA5 (0.000281%)
CTCCTGCTGATGTGCTTCATCCTGCCCACGCTGGTGCCCTGGTACTGCTGGGGCGAGACTTTTGTAAACAGCCTGTTCGTTAGCACCTTCTTGCGATACA84 (0.004728%)
CTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGC11 (0.000619%)
CTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAAGTTGAAACCATTTGAACTATTCTA7 (0.000394%)
CTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGA45 (0.002533%)
CTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCT22 (0.001238%)
CTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCA702 (0.039512%)
CTCGAACCCGCCACCAGGTCGGACGTACTTGAGGGAATTCAGAATCTCTTCATTCTTGCCATTCTCCTGGTGTCCGAACTGATTGCACGGGAAACCGAGC40 (0.002251%)
CTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCT71 (0.003996%)
CTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAAT26 (0.001463%)
CTCGCCAAGTGTCTTCAGGTGGGTTTTGGCCCTGGTGTGGTACTCGTTCAAGGTAGGGTTGCTCTTGAGCTCAGCCAGGCGCTGGGCCAGGCTCTCGCGC4 (0.000225%)
CTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGC28 (0.001576%)
CTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGG84 (0.004728%)
CTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCG20 (0.001126%)
CTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTG18 (0.001013%)
CTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCT13 (0.000732%)
CTCGTATCCATCTGGAAACAGATCTATAGAAGTTGGAACCTGCCCCCAGGACCTTTCCCAATTCCTTTCTTTGGAAACATTTTTCAGCTGGATTTGAAGG25 (0.001407%)
CTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCT93 (0.005235%)
CTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAA24 (0.001351%)
CTCGTGTGTCTTCTCAAAGTATGCCTTGGCCTGGCTCTGAATCTCTGAGGTCTTGGCCTTCTCCATCAAATCTTTGCCATAATCAGTCATGCTCTGAAAG33 (0.001857%)
CTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGT80 (0.004503%)
CTCTAAGGATTCCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGT3 (0.000169%)
CTCTAATTGTGCCATCCCATCACAACAAGGTATCTTTCCTAAAGGGTATTATGCCGTGGCTGTGGTGAAGGCATCGGACACTAGCATCACCTGGAACAAC10 (0.000563%)
CTCTAGCGGTGGCCAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTG9 (0.000507%)
CTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCA20 (0.001126%)
CTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATG14 (0.000788%)
CTCTATGGCCGAGAACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTAT486 (0.027355%)
CTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTT9 (0.000507%)
CTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGC39 (0.002195%)
CTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGC20 (0.001126%)
CTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCA5 (0.000281%)
CTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAA35 (0.001970%)
CTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGGTCATTGTTGACAAAG7 (0.000394%)
CTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAA15 (0.000844%)
CTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGG64 (0.003602%)
CTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAA20 (0.001126%)
CTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAA8 (0.000450%)
CTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGT17 (0.000957%)
CTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAGGAGTGTACAGAGTAGAACTGGACACCAAATCGTAC7 (0.000394%)
CTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGG43 (0.002420%)
CTCTGTACACTCCTTCTACAAACTTCTCATCTGTGGTGAGCCCGTGCAGCTCTCCAGACTCCGCGGTCTTCCCAGAGGCAAAGGGCTCCCAGGATCCCTC4 (0.000225%)
CTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTT22 (0.001238%)
CTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTG5 (0.000281%)
CTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCATTATCTTCTATCTTTTCTCTTTT4 (0.000225%)
CTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTGGAGA8 (0.000450%)
CTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCATTATCTTCTATCTTT3 (0.000169%)
CTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTC34 (0.001914%)
CTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTGGAGAGCATACCGGA4 (0.000225%)
CTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGC87 (0.004897%)
CTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACAC16 (0.000901%)
CTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCA17 (0.000957%)
CTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATG21 (0.001182%)
CTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACAC57 (0.004748%)
CTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTG206 (0.011595%)
CTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCA39 (0.002195%)
CTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTAC17 (0.000957%)
CTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTA53 (0.002983%)
CTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCT91 (0.005122%)
CTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTA8 (0.000450%)
CTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTT128 (0.007205%)
CTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATC26 (0.001463%)
CTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGA22 (0.001238%)
CTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGA326 (0.018349%)
CTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGA34 (0.001914%)
CTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAG9 (0.000507%)
CTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCC183 (0.010300%)
CTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTC158 (0.008893%)
CTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGT40 (0.002251%)
CTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGG73 (0.004109%)
CTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATC7 (0.000394%)
CTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTC28 (0.001576%)
CTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGA78 (0.004390%)
CTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATA99 (0.005572%)
CTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGA43 (0.002420%)
CTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACT106 (0.005966%)
CTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGA69 (0.003884%)
CTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTG60 (0.003377%)
CTGATGTGCTTCATCCTGCCCACGCTGGTGCCCTGGTACTGCTGGGGCGAGACTTTTGTAAACAGCCTGTTCGTTAGCACCTTCTTGCGATACACTCTGG5 (0.000281%)
CTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCAC26 (0.001463%)
CTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATG18 (0.001013%)
CTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGA22 (0.001238%)
CTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCT15 (0.000844%)
CTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGG29 (0.001632%)
CTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCG16 (0.000901%)
CTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATG149 (0.008387%)
CTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATA25 (0.001407%)
CTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACT20 (0.001126%)
CTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCC7 (0.000394%)
CTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGT21 (0.001182%)
CTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTG13 (0.000732%)
CTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTG6 (0.000338%)
CTGCAGCATTTTAATCTGAAGTCTCTGGTTGACCCTAAGGATATCGACCTCAGCCCTGTTACAATTGGCTTTGGCAGTATCCCACGCGAATTTAAACTCT3 (0.000169%)
CTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGG3 (0.000169%)
CTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACT5 (0.000281%)
CTGCAGTAATGTTAGCTGTAAGCCGGACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGG15 (0.000844%)
CTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCC59 (0.003321%)
CTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCC21 (0.001182%)
CTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAA9 (0.000507%)
CTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAA7 (0.000394%)
CTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCA50 (0.002814%)
CTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAG35 (0.001970%)
CTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATC10 (0.000563%)
CTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTG41 (0.002308%)
CTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCA10 (0.000563%)
CTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGA589 (0.033152%)
CTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATT41 (0.002308%)
CTGCCTGTCTCCTGCTTCTCCTCCTTGCCAGCCTGAGCAGCACCACCTATCTCCAGCAACAGATGAGACAGACTACAGAGCTGCAGCCTTTGCACGGGGA4 (0.000225%)
CTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTC25 (0.001407%)
CTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTG82 (0.004615%)
CTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAG55 (0.003096%)
CTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGT5 (0.000281%)
CTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGAT62 (0.003490%)
CTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTT10 (0.000563%)
CTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGATGG11 (0.000619%)
CTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTC14 (0.000788%)
CTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTA9 (0.000507%)
CTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGG10 (0.000563%)
CTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTC6 (0.000338%)
CTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTA6 (0.000338%)
CTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCC4 (0.000225%)
CTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATG31 (0.001745%)
CTGCTGGCCTGCGCTGCCCTGGGGCTGTGTCTGGCTGTCCCTGACAAAACGGTCAAATGGTGCGCAGTGTCAGAGCACGAGAATACCAAGTGCATCAGCT4 (0.000225%)
CTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGA32 (0.001801%)
CTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCC21 (0.001182%)
CTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTCC5 (0.000281%)
CTGCTTTTGTCTGCTATTCTGCAGCATTTTAATCTGAAGTCTCTGGTTGACCCTAAGGATATCGACCTCAGCCCTGTTACAATTGGCTTTGGCAGTATCC11 (0.000619%)
CTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAA27 (0.001520%)
CTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGG7 (0.000394%)
CTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTC11 (0.000619%)
CTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAGGAGTGTACAGAGTAGAACTGGACACCAAATCGTACTGGAAGACACTTGGCATTTC10 (0.000563%)
CTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTT15 (0.000844%)
CTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCAC42 (0.002364%)
CTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTG24 (0.001351%)
CTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATC29 (0.001632%)
CTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCT21 (0.001182%)
CTGGATCGCCACCCTCCTCCTCGTATCCATCTGGAAACAGATCTATAGAAGTTGGAACCTGCCCCCAGGACCTTTCCCAATTCCTTTCTTTGGAAACATT10 (0.000563%)
CTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGC119 (0.006698%)
CTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGG83 (0.004672%)
CTGGCCCACCTTAGGAGAATGAAGAGTTTCTCCCGAGGCCGACTCCACCGAGGCCACAGGAGAGAAGGCGTGGCGTAGGTCGTGGTAAGTTCGGTGGTCT6 (0.000338%)
CTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTT19 (0.001069%)
CTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGC11 (0.000619%)
CTGGCTCAACAATAGGGACCAGCCCATTCTGCTGACAGATGCTGGCATAGCGAGCCAGAGCATTGGCATTTTCTTGGATAGCAAGGCTGGAAGGACACTG63 (0.003546%)
CTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCT42 (0.002364%)
CTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGT7 (0.000394%)
CTGGCTTTCTCGCCAAGTGTCTTCAGGTGGGTTTTGGCCCTGGTGTGGTACTCGTTCAAGGTAGGGTTGCTCTTGAGCTCAGCCAGGCGCTGGGCCAGGC13 (0.000732%)
CTGGGAAGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAGGAGTGTACAGAGTAGAACTGGACACCAAATCGTACTG7 (0.000394%)
CTGGGAGCCCTTTGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAGGAGTGTACAGAGTAGAACTG22 (0.001238%)
CTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGT28 (0.001576%)
CTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGAC60 (0.003377%)
CTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCA16 (0.000901%)
CTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCC16 (0.000901%)
CTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCA35 (0.001970%)
CTGGGGTCATCGCCGAAATCGTAGCCGTCGAAGGCATCCCCGGCATCTCCACCAATGAAGTAGGCATAGGTCAGGCGGTATTTGTCAGACTCGGGACCCA8 (0.000450%)
CTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTT102 (0.005741%)
CTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTT27 (0.001520%)
CTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATA16 (0.000901%)
CTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTG25 (0.001407%)
CTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACAC97 (0.008080%)
CTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGG25 (0.001407%)
CTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCT74 (0.004165%)
CTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGC7 (0.000394%)
CTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTG8 (0.000450%)
CTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTT93 (0.005235%)
CTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATG6 (0.000338%)
CTGTACACTCCTTCTACAAACTTCTCATCTGTGGTGAGCCCGTGCAGCTCTCCAGACTCCGCGGTCTTCCCAGAGGCAAAGGGCTCCCAGGATCCCTCAG9 (0.000507%)
CTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTC65 (0.003659%)
CTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGC50 (0.002814%)
CTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGG27 (0.001520%)
CTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATG18 (0.001013%)
CTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGC11 (0.000619%)
CTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGC32 (0.001801%)
CTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTC9 (0.000507%)
CTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAG9 (0.000507%)
CTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAA12 (0.000675%)
CTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTG17 (0.000957%)
CTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTC9 (0.000507%)
CTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAGGTCTGCAGGCTGGGTCAT35 (0.001970%)
CTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGG12 (0.000675%)
CTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCC4 (0.000225%)
CTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTG7 (0.000394%)
CTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTAT8 (0.000450%)
CTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTG9 (0.000507%)
CTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTC12 (0.000675%)
CTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGA6 (0.000338%)
CTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCT10 (0.000563%)
CTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAG15 (0.000844%)
CTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGC67 (0.003771%)
CTTAACATAACATTAATAGCCCTATCCATAAAACTAGGCCTCGCCCCATTCCACTTCTGATTACCAGAAGTAACTCAAGGGATCCCACTGCACATAGGAC3 (0.000169%)
CTTAATCTTATCTATCCTAATTTTAGCCCTAATACCTTTCCTTCATACCTCAAAGCAACGAAGCCTAATATTCCGCCCAATCACACAAATTTTGTACTGA7 (0.000394%)
CTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCATTATCTTCTATCTTTTCTCTTTTGT3 (0.000169%)
CTTACGCCAAACAGATTTAAAATCACTAATCGCCTACTCCTCAGTTAGCCACATAGCACTTGTTATTGCATCAATCATAATCCAAACTCCATGAAGCTTC3 (0.000169%)
CTTACTTTACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCC28 (0.001576%)
CTTAGAGATGAGCTCCTTGTTGAGAGTTTGCTCCAGATGCTGCATCTTCCCATCTTCGGGCAGGAGGAAGACAGCACTGGCGTTGCCCGCGTAATCCATC10 (0.000563%)
CTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCG54 (0.003039%)
CTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTT31 (0.001745%)
CTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCA69 (0.003884%)
CTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAAGTTGAAACCATTTGAACTATTCTACCA14 (0.000788%)
CTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCA10 (0.000563%)
CTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTG93 (0.005235%)
CTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATC19 (0.001069%)
CTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATAT43 (0.002420%)
CTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGT79 (0.004447%)
CTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAA142 (0.007993%)
CTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGA662 (0.037261%)
CTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCT143 (0.008049%)
CTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTAT19 (0.001069%)
CTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCG14 (0.000788%)
CTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGG34 (0.001914%)
CTTCATCCTGCCCACGCTGGTGCCCTGGTACTGCTGGGGCGAGACTTTTGTAAACAGCCTGTTCGTTAGCACCTTCTTGCGATACACTCTGGTGCTCAAC5 (0.000281%)
CTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTGGAGAGC21 (0.001182%)
CTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCATTATCTTCTATCTTTTC9 (0.000507%)
CTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTT35 (0.001970%)
CTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGG67 (0.003771%)
CTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCT11 (0.000619%)
CTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCGGCTTACAG9 (0.000507%)
CTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACAC73 (0.004109%)
CTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCG49 (0.002758%)
CTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGG6 (0.000338%)
CTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACC11 (0.000619%)
CTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTC10 (0.000563%)
CTTCCTCAGTGTTCTCAGGATCGAATGGCTTCTTCCATTTGCCTTTAAAAAGAATGTAATTCGCCAGGGCGAAAACTGTGTCTTGGTCCAGTTCTTTCAC6 (0.000338%)
CTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACC25 (0.001407%)
CTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATG16 (0.000901%)
CTTCCTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTC6 (0.000338%)
CTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAA24 (0.001351%)
CTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGG52 (0.002927%)
CTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTGGAGAGCATACCGGATA13 (0.000732%)
CTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCGGCTT19 (0.001069%)
CTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGAT18 (0.001013%)
CTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCT68 (0.003827%)
CTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAA29 (0.001632%)
CTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTCCGAT4 (0.000225%)
CTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCC9 (0.000507%)
CTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTG11 (0.000619%)
CTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATG17 (0.000957%)
CTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCA67 (0.003771%)
CTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGG15 (0.000844%)
CTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAG99 (0.005572%)
CTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACT11 (0.000619%)
CTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGT19 (0.001069%)
CTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCT39 (0.002195%)
CTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTG722 (0.040638%)
CTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGG52 (0.002927%)
CTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTA22 (0.001238%)
CTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCC52 (0.002927%)
CTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTG16 (0.000901%)
CTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTC24 (0.001351%)
CTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGT43 (0.002420%)
CTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGG40 (0.002251%)
CTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAG27 (0.001520%)
CTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAG23 (0.001295%)
CTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAG24 (0.001351%)
CTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGATGGACCAGCTCCCGGTATAGG24 (0.001351%)
CTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCA12 (0.000675%)
CTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTG16 (0.000901%)
CTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGT16 (0.000901%)
CTTGCTTGTCTGGATCGCCACCCTCCTCCTCGTATCCATCTGGAAACAGATCTATAGAAGTTGGAACCTGCCCCCAGGACCTTTCCCAATTCCTTTCTTT242 (0.013621%)
CTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAG13 (0.000732%)
CTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCT17 (0.000957%)
CTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTA70 (0.003940%)
CTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGGTCATTG25 (0.001407%)
CTTGGGTTCCCTTCTCCACAAAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGC346 (0.019475%)
CTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCT23 (0.001295%)
CTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCA28 (0.001576%)
CTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGG38 (0.002139%)
CTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCT33 (0.001857%)
CTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCC14 (0.000788%)
CTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAA46 (0.002589%)
CTTGTCACTGGGGTCATCGCCGAAATCGTAGCCGTCGAAGGCATCCCCGGCATCTCCACCAATGAAGTAGGCATAGGTCAGGCGGTATTTGTCAGACTCG5 (0.000281%)
CTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACT39 (0.002195%)
CTTGTCTGGATCGCCACCCTCCTCCTCGTATCCATCTGGAAACAGATCTATAGAAGTTGGAACCTGCCCCCAGGACCTTTCCCAATTCCTTTCTTTGGAA10 (0.000563%)
CTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATC112 (0.006304%)
CTTGTTGAGAGTTTGCTCCAGATGCTGCATCTTCCCATCTTCGGGCAGGAGGAAGACAGCACTGGCGTTGCCCGCGTAATCCATCAGCAGCACCCAGCTG8 (0.000450%)
CTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACA41 (0.002308%)
CTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGG15 (0.000844%)
CTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAG50 (0.002814%)
CTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTG103 (0.005797%)
CTTTACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCT17 (0.000957%)
CTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACC48 (0.002702%)
CTTTATTGTATGAGCCCACCACATATTCACAGTAGGATTAGATGTAGACACACGAGCTTACTTTACATCAGCCACTATAATTATCGCAATTCCTACCGGT104 (0.005854%)
CTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCAT16 (0.000901%)
CTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAG9 (0.000507%)
CTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGT73 (0.004109%)
CTTTCCTAAAGGGTATTATGCCGTGGCTGTGGTGAAGGCATCGGACACTAGCATCACCTGGAACAACCTGAAAGGCAAGAAGTCCTGCCACACTGGGGTA15 (0.000844%)
CTTTCCTTGATGTCTGAACTCAAATCTGGTTCTCGGCCATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAA30 (0.001689%)
CTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGG37 (0.002083%)
CTTTCTCCAGGTTATCCCAGAAGTCCCGAGTCAATGGGCCCAGCCGTTCCTGCAGCTGACTAACGGTTGAACCCAGAGTGTCCCAGTTTTCCAGGAGATT5 (0.000281%)
CTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTA43 (0.002420%)
CTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTG27 (0.001520%)
CTTTGACACCGGTAGGAATTGCGATAATTATAGTGGCTGATGTAAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTAT107 (0.008913%)
CTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGT22 (0.001238%)
CTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTA32 (0.001801%)
CTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTT13 (0.000732%)
CTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCAT96 (0.005403%)
CTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAG25 (0.001407%)
CTTTGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAGGAGTGTACAGAGTAGAACTGGACACCAAA22 (0.001238%)
CTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTC93 (0.005235%)
CTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAA717 (0.040357%)
CTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAA10 (0.000563%)
CTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCG150 (0.008443%)
CTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCC14 (0.000788%)
CTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCC20 (0.001126%)
CTTTTGGTGTGTGGATTAGCATTATTTGTTTGATAATAAGTTTAACTAGTCAGTGTTGGAAAGAATGGAGACGGTTGTTGATTAGGCGTTTTGAGGATGG12 (0.000675%)
CTTTTGTCTGCTATTCTGCAGCATTTTAATCTGAAGTCTCTGGTTGACCCTAAGGATATCGACCTCAGCCCTGTTACAATTGGCTTTGGCAGTATCCCAC49 (0.002758%)
CTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTT36 (0.002026%)
CTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAG636 (0.035797%)
GAAAAACTTGTCACTGGGGTCATCGCCGAAATCGTAGCCGTCGAAGGCATCCCCGGCATCTCCACCAATGAAGTAGGCATAGGTCAGGCGGTATTTGTCA87 (0.004897%)
GAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCT156 (0.008781%)
GAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGC94 (0.005291%)
GAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACA121 (0.006811%)
GAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCAT60 (0.003377%)
GAAAACTGTGTCTTGGTCCAGTTTTTTCACCGCCTCAGCTATCTTTCCTTGGGTTCCCTTCTCCACAAAATCATTAATCACTTTCTTGGCCTCCTCTGAC7 (0.000394%)
GAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCC7 (0.000394%)
GAAAAGTCAGACTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGG76 (0.004278%)
GAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCA125 (0.007036%)
GAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACA4 (0.000225%)
GAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTG26 (0.001463%)
GAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCC9 (0.000507%)
GAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAA4 (0.000225%)
GAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTG4 (0.000225%)
GAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTG29 (0.001632%)
GAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGC8 (0.000450%)
GAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAAC27 (0.001520%)
GAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATT18 (0.001013%)
GAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACAC51 (0.002871%)
GAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAA25 (0.001407%)
GAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGA15 (0.000844%)
GAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGAT20 (0.001126%)
GAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCT66 (0.003715%)
GAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGT29 (0.001632%)
GAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCC9 (0.000507%)
GAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGG3 (0.000169%)
GAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAGGGATGAGTTGGATAAAACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATA18 (0.001013%)
GAAATTCATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAAT29 (0.001632%)
GAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGG74 (0.004165%)
GAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACT34 (0.001914%)
GAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTG6 (0.000338%)
GAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTG8 (0.000450%)
GAACCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATC6 (0.000338%)
GAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGC3 (0.000169%)
GAACCCGCCACCAGGTCGGACGTACTTGAGGGAATTCAGAATCTCTTCATTCTTGCCATTCTCCTGGTGTCCGAACTGATTGCACGGGAAACCGAGCACC3 (0.000169%)
GAACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGG564 (0.031745%)
GAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCT75 (0.004221%)
GAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATG15 (0.000844%)
GAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCT31 (0.001745%)
GAACTCCAGTCACGTTAGCCTAGATCTCGTATGCCGTCTT220 (0.004953%)
GAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTG62 (0.003490%)
GAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTG5 (0.000281%)
GAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTT4 (0.000225%)
GAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAG8 (0.000450%)
GAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAA5 (0.000281%)
GAAGAAATTCATGAAAAATTGTCATGG