fastp report
General
fastp version:0.23.1 (https://github.com/OpenGene/fastp)
sequencing:paired end (150 cycles + 150 cycles)
mean length before filtering:150bp, 150bp
mean length after filtering:144bp, 143bp
duplication rate:23.306469%
Insert size peak:260
Before filtering
total reads:42.852266 M
total bases:6.427840 G
Q20 bases:6.307073 G (98.121188%)
Q30 bases:6.083281 G (94.639581%)
GC content:49.865022%
After filtering
total reads:42.633548 M
total bases:6.141035 G
Q20 bases:6.047883 G (98.483123%)
Q30 bases:5.839295 G (95.086492%)
GC content:49.774625%
Filtering result
reads passed filters:42.633548 M (99.489600%)
reads with low quality:172.164000 K (0.401762%)
reads with too many N:28.082000 K (0.065532%)
reads too short:18.472000 K (0.043106%)
Adapter or bad ligation of read1
The input has little adapter percentage (~0.730465%), probably it's trimmed before.
SequenceOccurrences
A14566
AG15373
AGA16128
AGAT15603
AGATC14644
AGATCG16044
AGATCGG13915
AGATCGGA12525
AGATCGGAA11612
AGATCGGAAG11845
AGATCGGAAGA11457
AGATCGGAAGAG12461
AGATCGGAAGAGC13332
AGATCGGAAGAGCA13745
AGATCGGAAGAGCAC14304
AGATCGGAAGAGCACA13999
AGATCGGAAGAGCACAC11884
AGATCGGAAGAGCACACG10950
AGATCGGAAGAGCACACGT10139
AGATCGGAAGAGCACACGTC10219
AGATCGGAAGAGCACACGTCT11010
AGATCGGAAGAGCACACGTCTG11339
AGATCGGAAGAGCACACGTCTGA11789
AGATCGGAAGAGCACACGTCTGAA11607
AGATCGGAAGAGCACACGTCTGAAC12047
AGATCGGAAGAGCACACGTCTGAACT11450
AGATCGGAAGAGCACACGTCTGAACTC10919
AGATCGGAAGAGCACACGTCTGAACTCC10540
AGATCGGAAGAGCACACGTCTGAACTCCA9236
AGATCGGAAGAGCACACGTCTGAACTCCAG8598
AGATCGGAAGAGCACACGTCTGAACTCCAGT8697
AGATCGGAAGAGCACACGTCTGAACTCCAGTC9209
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA11033
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC10513
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACC10368
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCT11023
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTG9834
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGA8366
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAA8688
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAT8326
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAATAC9839
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAATACG10913
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAATACGC8885
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAATACGCA30841
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAATACGCAT9008
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAATACGCATC7659
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAATACGCATCTC10350
other adapter sequences199187
Adapter or bad ligation of read2
The input has little adapter percentage (~0.759127%), probably it's trimmed before.
SequenceOccurrences
A15444
AG15158
AGA15759
AGAT15527
AGATC15355
AGATCG19348
AGATCGG13808
AGATCGGA12835
AGATCGGAA10524
AGATCGGAAG10578
AGATCGGAAGA10688
AGATCGGAAGAG12912
AGATCGGAAGAGC13136
AGATCGGAAGAGCG14070
AGATCGGAAGAGCGT17618
AGATCGGAAGAGCGTC12811
AGATCGGAAGAGCGTCG17786
AGATCGGAAGAGCGTCGT12860
AGATCGGAAGAGCGTCGTG10162
AGATCGGAAGAGCGTCGTGT7744
AGATCGGAAGAGCGTCGTGTAG11810
AGATCGGAAGAGCGTCGTGTAGG16833
AGATCGGAAGAGCGTCGTGTAGGG13426
AGATCGGAAGAGCGTCGTGTAGGGA11187
AGATCGGAAGAGCGTCGTGTAGGGAA8185
AGATCGGAAGAGCGTCGTGTAGGGAAAGA8468
AGATCGGAAGAGCGTCGTGTAGGGAAAGAG8176
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGT8839
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG9114
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT9190
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTG10729
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGT9867
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTT10445
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTTC10100
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTTCT8562
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTTCTA7749
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTTCTACAC7729
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTTCTACACGG7946
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTTCTACACGGT8160
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTTCTACACGGTG9325
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTTCTACACGGTGT8105
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTTCTACACGGTGTAGATCTCGGT8489
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTTCTACACGGTGTAGATCTCGGTGGTCGC8460
other adapter sequences269657
This estimation is based on paired-end overlap analysis, and there are 66.239821% reads found not overlapped.
The nonoverlapped read pairs may have insert size <30 or >270, or contain too much sequencing errors to be detected as overlapped.
Value of each position will be shown on mouse over.
Value of each position will be shown on mouse over.
Darker background means larger counts. The count will be shown on mouse over.
AAATACAGTATTTCTGCACTCCCGGAGTGCGG
AAAAAAAAAAAATAAAACAAAAGAAATAAAATTAAATCAAATGAAACAAAACTAAACCAAACGAAAGAAAAGTAAAGCAAAGG
AATAATAAAATATAATACAATAGAATTAAATTTAATTCAATTGAATCAAATCTAATCCAATCGAATGAAATGTAATGCAATGG
AACAACAAAACATAACACAACAGAACTAAACTTAACTCAACTGAACCAAACCTAACCCAACCGAACGAAACGTAACGCAACGG
AAGAAGAAAAGATAAGACAAGAGAAGTAAAGTTAAGTCAAGTGAAGCAAAGCTAAGCCAAGCGAAGGAAAGGTAAGGCAAGGG
ATAATAAAATAATATAACATAAGATATAATATTATATCATATGATACAATACTATACCATACGATAGAATAGTATAGCATAGG
ATTATTAAATTATATTACATTAGATTTAATTTTATTTCATTTGATTCAATTCTATTCCATTCGATTGAATTGTATTGCATTGG
ATCATCAAATCATATCACATCAGATCTAATCTTATCTCATCTGATCCAATCCTATCCCATCCGATCGAATCGTATCGCATCGG
ATGATGAAATGATATGACATGAGATGTAATGTTATGTCATGTGATGCAATGCTATGCCATGCGATGGAATGGTATGGCATGGG
ACAACAAAACAATACAACACAAGACATAACATTACATCACATGACACAACACTACACCACACGACAGAACAGTACAGCACAGG
ACTACTAAACTATACTACACTAGACTTAACTTTACTTCACTTGACTCAACTCTACTCCACTCGACTGAACTGTACTGCACTGG
ACCACCAAACCATACCACACCAGACCTAACCTTACCTCACCTGACCCAACCCTACCCCACCCGACCGAACCGTACCGCACCGG
ACGACGAAACGATACGACACGAGACGTAACGTTACGTCACGTGACGCAACGCTACGCCACGCGACGGAACGGTACGGCACGGG
AGAAGAAAAGAATAGAACAGAAGAGATAAGATTAGATCAGATGAGACAAGACTAGACCAGACGAGAGAAGAGTAGAGCAGAGG
AGTAGTAAAGTATAGTACAGTAGAGTTAAGTTTAGTTCAGTTGAGTCAAGTCTAGTCCAGTCGAGTGAAGTGTAGTGCAGTGG
AGCAGCAAAGCATAGCACAGCAGAGCTAAGCTTAGCTCAGCTGAGCCAAGCCTAGCCCAGCCGAGCGAAGCGTAGCGCAGCGG
AGGAGGAAAGGATAGGACAGGAGAGGTAAGGTTAGGTCAGGTGAGGCAAGGCTAGGCCAGGCGAGGGAAGGGTAGGGCAGGGG
TAATAAAATAAATTAAACTAAAGTAATATAATTTAATCTAATGTAACATAACTTAACCTAACGTAAGATAAGTTAAGCTAAGG
TATTATAATATATTATACTATAGTATTATATTTTATTCTATTGTATCATATCTTATCCTATCGTATGATATGTTATGCTATGG
TACTACAATACATTACACTACAGTACTATACTTTACTCTACTGTACCATACCTTACCCTACCGTACGATACGTTACGCTACGG
TAGTAGAATAGATTAGACTAGAGTAGTATAGTTTAGTCTAGTGTAGCATAGCTTAGCCTAGCGTAGGATAGGTTAGGCTAGGG
TTATTAAATTAATTTAACTTAAGTTATATTATTTTATCTTATGTTACATTACTTTACCTTACGTTAGATTAGTTTAGCTTAGG
TTTTTTAATTTATTTTACTTTAGTTTTATTTTTTTTTCTTTTGTTTCATTTCTTTTCCTTTCGTTTGATTTGTTTTGCTTTGG
TTCTTCAATTCATTTCACTTCAGTTCTATTCTTTTCTCTTCTGTTCCATTCCTTTCCCTTCCGTTCGATTCGTTTCGCTTCGG
TTGTTGAATTGATTTGACTTGAGTTGTATTGTTTTGTCTTGTGTTGCATTGCTTTGCCTTGCGTTGGATTGGTTTGGCTTGGG
TCATCAAATCAATTCAACTCAAGTCATATCATTTCATCTCATGTCACATCACTTCACCTCACGTCAGATCAGTTCAGCTCAGG
TCTTCTAATCTATTCTACTCTAGTCTTATCTTTTCTTCTCTTGTCTCATCTCTTCTCCTCTCGTCTGATCTGTTCTGCTCTGG
TCCTCCAATCCATTCCACTCCAGTCCTATCCTTTCCTCTCCTGTCCCATCCCTTCCCCTCCCGTCCGATCCGTTCCGCTCCGG
TCGTCGAATCGATTCGACTCGAGTCGTATCGTTTCGTCTCGTGTCGCATCGCTTCGCCTCGCGTCGGATCGGTTCGGCTCGGG
TGATGAAATGAATTGAACTGAAGTGATATGATTTGATCTGATGTGACATGACTTGACCTGACGTGAGATGAGTTGAGCTGAGG
TGTTGTAATGTATTGTACTGTAGTGTTATGTTTTGTTCTGTTGTGTCATGTCTTGTCCTGTCGTGTGATGTGTTGTGCTGTGG
TGCTGCAATGCATTGCACTGCAGTGCTATGCTTTGCTCTGCTGTGCCATGCCTTGCCCTGCCGTGCGATGCGTTGCGCTGCGG
TGGTGGAATGGATTGGACTGGAGTGGTATGGTTTGGTCTGGTGTGGCATGGCTTGGCCTGGCGTGGGATGGGTTGGGCTGGGG
CAACAAAACAAATCAAACCAAAGCAATACAATTCAATCCAATGCAACACAACTCAACCCAACGCAAGACAAGTCAAGCCAAGG
CATCATAACATATCATACCATAGCATTACATTTCATTCCATTGCATCACATCTCATCCCATCGCATGACATGTCATGCCATGG
CACCACAACACATCACACCACAGCACTACACTTCACTCCACTGCACCACACCTCACCCCACCGCACGACACGTCACGCCACGG
CAGCAGAACAGATCAGACCAGAGCAGTACAGTTCAGTCCAGTGCAGCACAGCTCAGCCCAGCGCAGGACAGGTCAGGCCAGGG
CTACTAAACTAATCTAACCTAAGCTATACTATTCTATCCTATGCTACACTACTCTACCCTACGCTAGACTAGTCTAGCCTAGG
CTTCTTAACTTATCTTACCTTAGCTTTACTTTTCTTTCCTTTGCTTCACTTCTCTTCCCTTCGCTTGACTTGTCTTGCCTTGG
CTCCTCAACTCATCTCACCTCAGCTCTACTCTTCTCTCCTCTGCTCCACTCCTCTCCCCTCCGCTCGACTCGTCTCGCCTCGG
CTGCTGAACTGATCTGACCTGAGCTGTACTGTTCTGTCCTGTGCTGCACTGCTCTGCCCTGCGCTGGACTGGTCTGGCCTGGG
CCACCAAACCAATCCAACCCAAGCCATACCATTCCATCCCATGCCACACCACTCCACCCCACGCCAGACCAGTCCAGCCCAGG
CCTCCTAACCTATCCTACCCTAGCCTTACCTTTCCTTCCCTTGCCTCACCTCTCCTCCCCTCGCCTGACCTGTCCTGCCCTGG
CCCCCCAACCCATCCCACCCCAGCCCTACCCTTCCCTCCCCTGCCCCACCCCTCCCCCCCCCGCCCGACCCGTCCCGCCCCGG
CCGCCGAACCGATCCGACCCGAGCCGTACCGTTCCGTCCCGTGCCGCACCGCTCCGCCCCGCGCCGGACCGGTCCGGCCCGGG
CGACGAAACGAATCGAACCGAAGCGATACGATTCGATCCGATGCGACACGACTCGACCCGACGCGAGACGAGTCGAGCCGAGG
CGTCGTAACGTATCGTACCGTAGCGTTACGTTTCGTTCCGTTGCGTCACGTCTCGTCCCGTCGCGTGACGTGTCGTGCCGTGG
CGCCGCAACGCATCGCACCGCAGCGCTACGCTTCGCTCCGCTGCGCCACGCCTCGCCCCGCCGCGCGACGCGTCGCGCCGCGG
CGGCGGAACGGATCGGACCGGAGCGGTACGGTTCGGTCCGGTGCGGCACGGCTCGGCCCGGCGCGGGACGGGTCGGGCCGGGG
GAAGAAAAGAAATGAAACGAAAGGAATAGAATTGAATCGAATGGAACAGAACTGAACCGAACGGAAGAGAAGTGAAGCGAAGG
GATGATAAGATATGATACGATAGGATTAGATTTGATTCGATTGGATCAGATCTGATCCGATCGGATGAGATGTGATGCGATGG
GACGACAAGACATGACACGACAGGACTAGACTTGACTCGACTGGACCAGACCTGACCCGACCGGACGAGACGTGACGCGACGG
GAGGAGAAGAGATGAGACGAGAGGAGTAGAGTTGAGTCGAGTGGAGCAGAGCTGAGCCGAGCGGAGGAGAGGTGAGGCGAGGG
GTAGTAAAGTAATGTAACGTAAGGTATAGTATTGTATCGTATGGTACAGTACTGTACCGTACGGTAGAGTAGTGTAGCGTAGG
GTTGTTAAGTTATGTTACGTTAGGTTTAGTTTTGTTTCGTTTGGTTCAGTTCTGTTCCGTTCGGTTGAGTTGTGTTGCGTTGG
GTCGTCAAGTCATGTCACGTCAGGTCTAGTCTTGTCTCGTCTGGTCCAGTCCTGTCCCGTCCGGTCGAGTCGTGTCGCGTCGG
GTGGTGAAGTGATGTGACGTGAGGTGTAGTGTTGTGTCGTGTGGTGCAGTGCTGTGCCGTGCGGTGGAGTGGTGTGGCGTGGG
GCAGCAAAGCAATGCAACGCAAGGCATAGCATTGCATCGCATGGCACAGCACTGCACCGCACGGCAGAGCAGTGCAGCGCAGG
GCTGCTAAGCTATGCTACGCTAGGCTTAGCTTTGCTTCGCTTGGCTCAGCTCTGCTCCGCTCGGCTGAGCTGTGCTGCGCTGG
GCCGCCAAGCCATGCCACGCCAGGCCTAGCCTTGCCTCGCCTGGCCCAGCCCTGCCCCGCCCGGCCGAGCCGTGCCGCGCCGG
GCGGCGAAGCGATGCGACGCGAGGCGTAGCGTTGCGTCGCGTGGCGCAGCGCTGCGCCGCGCGGCGGAGCGGTGCGGCGCGGG
GGAGGAAAGGAATGGAACGGAAGGGATAGGATTGGATCGGATGGGACAGGACTGGACCGGACGGGAGAGGAGTGGAGCGGAGG
GGTGGTAAGGTATGGTACGGTAGGGTTAGGTTTGGTTCGGTTGGGTCAGGTCTGGTCCGGTCGGGTGAGGTGTGGTGCGGTGG
GGCGGCAAGGCATGGCACGGCAGGGCTAGGCTTGGCTCGGCTGGGCCAGGCCTGGCCCGGCCGGGCGAGGCGTGGCGCGGCGG
GGGGGGAAGGGATGGGACGGGAGGGGTAGGGTTGGGTCGGGTGGGGCAGGGCTGGGCCGGGCGGGGGAGGGGTGGGGCGGGGG
Sampling rate: 1 / 20
overrepresented sequencecount (% of bases)distribution: cycle 1 ~ cycle 150
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA148 (0.003684%)
AAAAAGACCTCTGAGGGATCCTGGGAGCCCTTTGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAG241 (0.014997%)
AAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCA41 (0.002551%)
AAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATG69 (0.004294%)
AAAAATACTTCCGAGACGATGAATAGAATTATACCATATCGTAGTCCTTTTTGTACAATAGGAGTGTGGTGGCCTTGGTAGGTTCCTTCACGAATTACGT3 (0.000187%)
AAAAATTGGTAAAGAAATATGTCACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGA35 (0.002178%)
AAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACC80 (0.004978%)
AAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCC4 (0.000249%)
AAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAA15 (0.000933%)
AAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATT7 (0.000436%)
AAAAGACTTCCAACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGG7 (0.000436%)
AAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCAT28 (0.001742%)
AAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGA25 (0.001556%)
AAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGA43 (0.002676%)
AAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTAC19 (0.001182%)
AAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGG43 (0.002676%)
AAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGG8 (0.000498%)
AAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGA131 (0.008152%)
AAAAGTCAGACTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGC14 (0.000871%)
AAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTAT21 (0.001307%)
AAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTG9 (0.000560%)
AAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTC21 (0.001307%)
AAAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCC310 (0.019291%)
AAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGAT5 (0.000311%)
AAAATTATGAGGTTTAGGGTTCCTACATGGTTTTGGATTAAGATGAGGGCAATTAGCAGTGGAATAGAACCGATTAGGGTATAAAATAGGAAATAAATCC23 (0.001431%)
AAAATTGGTAAAGAAATATGTCACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGAT12 (0.000747%)
AAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCT25 (0.001556%)
AAACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGC277 (0.017238%)
AAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGC10 (0.000622%)
AAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAA9 (0.000560%)
AAACCACATAAATCAAGCCCTACTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCA8 (0.000498%)
AAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGG7 (0.000436%)
AAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCT16 (0.000996%)
AAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAAT4 (0.000249%)
AAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGC7 (0.000436%)
AAACGAAACCACATAAATCAAGCCCTACTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCA212 (0.013193%)
AAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCA4 (0.000249%)
AAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTT11 (0.000685%)
AAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTC29 (0.001805%)
AAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTG16 (0.000996%)
AAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAA42 (0.002614%)
AAAGAAATATGTCACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTC9 (0.000560%)
AAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTG22 (0.001369%)
AAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAGGTCTGCAGGCTGGGTCATCCCCATTGGCTTG6 (0.000373%)
AAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAAC64 (0.003983%)
AAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATC14 (0.000871%)
AAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGG26 (0.001618%)
AAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAG6 (0.000373%)
AAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGC24 (0.001494%)
AAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATT32 (0.001991%)
AAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGAC8 (0.000498%)
AAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGC42 (0.002614%)
AAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGT16 (0.000996%)
AAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACT25 (0.001556%)
AAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACC4 (0.000249%)
AAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCATGGGCAGTTACGATAACATTGTAAATTTGGTCATCTCCTAAAAGTGCA9 (0.000560%)
AAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGA7 (0.000436%)
AAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGC5 (0.000311%)
AAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACA32 (0.001991%)
AAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTCC7 (0.000436%)
AAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGA10 (0.000622%)
AAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCT46 (0.002863%)
AAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTT24 (0.001494%)
AAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGA5 (0.000311%)
AAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGT32 (0.001991%)
AAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACT25 (0.001556%)
AAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAA7 (0.000436%)
AAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAA3 (0.000187%)
AAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAAT8 (0.000498%)
AAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCA13 (0.000809%)
AAAGTCAGACTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCA3 (0.000187%)
AAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGA8 (0.000498%)
AAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATT5 (0.000311%)
AAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGT4 (0.000249%)
AAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTTGACACCGGTA5 (0.000311%)
AAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTT326 (0.020287%)
AAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCA39 (0.002427%)
AAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGA11 (0.000685%)
AAATAATTCCAAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGG4 (0.000249%)
AAATAGTGAGTTTTTGAGCTTGTTGATTCTGTTTGTAAAATCCTGGTTGGCTTCGTCAATCAACCCTTTCATCCTGCAGCCTGAAGGGCATTTGTGGTTC4 (0.000249%)
AAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTT27 (0.001680%)
AAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTA7 (0.000436%)
AAATATGTCACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGAT6 (0.000373%)
AAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTA10 (0.000622%)
AAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCT7 (0.000436%)
AAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCA3 (0.000187%)
AAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCG33 (0.002054%)
AAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGATCAAAGAAA3 (0.000187%)
AAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGT633 (0.039391%)
AAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCC6 (0.000373%)
AAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTT10 (0.000622%)
AAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTA3 (0.000187%)
AAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGA46 (0.002863%)
AAATTATGAGGTTTAGGGTTCCTACATGGTTTTGGATTAAGATGAGGGCAATTAGCAGTGGAATAGAACCGATTAGGGTATAAAATAGGAAATAAATCCC6 (0.000373%)
AAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTG10 (0.000622%)
AAATTGGTAAAGAAATATGTCACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATA10 (0.000622%)
AAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACT17 (0.001058%)
AAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGC13 (0.000809%)
AAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGT6 (0.000373%)
AACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAA11 (0.000685%)
AACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTC11 (0.000685%)
AACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAAC11 (0.000685%)
AACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCA5 (0.000311%)
AACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACA7 (0.000436%)
AACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCC3 (0.000187%)
AACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATT19 (0.001182%)
AACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCT6 (0.000373%)
AACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAG15 (0.000933%)
AACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAAC167 (0.010392%)
AACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCA5 (0.000311%)
AACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCT10 (0.000622%)
AACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGA4 (0.000249%)
AACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTTTG4 (0.000249%)
AACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAG3 (0.000187%)
AACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATA4 (0.000249%)
AACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGC13 (0.000809%)
AACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCCATACACTACACATCAGATA4 (0.000249%)
AACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTC8 (0.000498%)
AACCAATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCAT6 (0.000373%)
AACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATT16 (0.000996%)
AACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGA6 (0.000373%)
AACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGA14 (0.000871%)
AACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTG10 (0.000622%)
AACCATTTGAACTATTCTACCAGCTGTAATCCTTATCATAATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTA9 (0.000560%)
AACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATG18 (0.001120%)
AACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAG3 (0.000187%)
AACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTTG3 (0.000187%)
AACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCA4 (0.000249%)
AACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTC9 (0.000560%)
AACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTG4 (0.000249%)
AACGAAACCACATAAATCAAGCCCTACTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCAT8 (0.000498%)
AACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAA14 (0.000871%)
AACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCG4 (0.000249%)
AACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGG6 (0.000373%)
AACTACATGTGAAATAATTCCAAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCT4 (0.000249%)
AACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAAT8 (0.000498%)
AACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTA3 (0.000187%)
AACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTC4 (0.000249%)
AACTATTCTACCAGCTGTAATCCTTATCATAATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAA5 (0.000311%)
AACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCA3 (0.000187%)
AACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCCCAGAT3 (0.000187%)
AACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGA5 (0.000311%)
AACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAAC4 (0.000249%)
AACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATT6 (0.000373%)
AACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAA6 (0.000373%)
AACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGA9 (0.000560%)
AACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGT3 (0.000187%)
AAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTG23 (0.001431%)
AAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAAC15 (0.000933%)
AAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGA15 (0.000933%)
AAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGC13 (0.000809%)
AAGAAATATGTCACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCG7 (0.000436%)
AAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGT26 (0.001618%)
AAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCG15 (0.000933%)
AAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCA11 (0.000685%)
AAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTG28 (0.001742%)
AAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGG24 (0.001494%)
AAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCA40 (0.002489%)
AAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGG93 (0.005787%)
AAGAATCCTGCAAAGAAAAATACTTCCGAGACGATGAATAGAATTATACCATATCGTAGTCCTTTTTGTACAATAGGAGTGTGGTGGCCTTGGTAGGTTC4 (0.000249%)
AAGACACAGTTTTCGCCCTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGA9 (0.000560%)
AAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGC63 (0.003920%)
AAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGA14 (0.000871%)
AAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCC15 (0.000933%)
AAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGC61 (0.003796%)
AAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCA15 (0.000933%)
AAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCC9 (0.000560%)
AAGACCTCAAATATGGTTGTGTGCTTGACAAAGGCCACATCCCCACCGCCATCTTTCAGACACTTGAATGCGCCTACGTAGCCAAAGAATGGTTGAGTGG7 (0.000436%)
AAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACT9 (0.000560%)
AAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCA3 (0.000187%)
AAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGA6 (0.000373%)
AAGACTTCCAACTGTTCAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGGCT8 (0.000498%)
AAGACTTGACAGAGGCTCCAGGGCGGTTACAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGG3 (0.000187%)
AAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCT82 (0.005103%)
AAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTT14 (0.000871%)
AAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTT15 (0.000933%)
AAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGC7 (0.000436%)
AAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAAC4 (0.000249%)
AAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCAT3 (0.000187%)
AAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCG8 (0.000498%)
AAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGT10 (0.000622%)
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAA2640 (0.065714%)
AAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCT3 (0.000187%)
AAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTT10 (0.000622%)
AAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACA11 (0.000685%)
AAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCT7 (0.000436%)
AAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATG10 (0.000622%)
AAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCC47 (0.002925%)
AAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGT5 (0.000311%)
AAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAA7 (0.000436%)
AAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTG3 (0.000187%)
AAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTT15 (0.000933%)
AAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCT3 (0.000187%)
AAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTG7 (0.000436%)
AAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGA11 (0.000685%)
AAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCA4 (0.000249%)
AAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTAT4 (0.000249%)
AAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAG18 (0.001120%)
AAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCA3 (0.000187%)
AAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAA8 (0.000498%)
AAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAG4 (0.000249%)
AAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGT4 (0.000249%)
AAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTG15 (0.000933%)
AAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTCGGAAGCCTGTAATTACGGCTCCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGATAGTTGG9 (0.000560%)
AAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTG3 (0.000187%)
AAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTT6 (0.000373%)
AAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGC23 (0.001431%)
AAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCA3 (0.000187%)
AAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCA24 (0.001494%)
AAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAA13 (0.000809%)
AAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGC18 (0.001120%)
AAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTC8 (0.000498%)
AAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAA4 (0.000249%)
AAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTG17 (0.001058%)
AAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTT30 (0.001867%)
AAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGT53 (0.003298%)
AAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTG8 (0.000498%)
AAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAAC3 (0.000187%)
AAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCAT6 (0.000373%)
AAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGA7 (0.000436%)
AAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGG4 (0.000249%)
AAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGC4 (0.000249%)
AAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGC14 (0.000871%)
AAGTAGTGGGACTTCTAGAGGGTTAAGTGGTGAAATTCCTGTTGGAGGTCAGCAGCCTCCTAGATCATGTGTTGGTACGAGGCTAGAATGATAGAACGCT5 (0.000311%)
AAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAG8 (0.000498%)
AAGTCAGACTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAA9 (0.000560%)
AAGTCCATGACCATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGC24 (0.001494%)
AAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCA5 (0.000311%)
AAGTGAGCTTTTTAGTTTGTGTCGGAAGCCTGTAATTACGGCTCCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGTA6 (0.000373%)
AAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCA31 (0.001929%)
AAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCA28 (0.001742%)
AAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCA3 (0.000187%)
AAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCT3 (0.000187%)
AAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAG11 (0.000685%)
AAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAG6 (0.000373%)
AAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGCTT7 (0.000436%)
AAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACA7 (0.000436%)
AAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACC3 (0.000187%)
AAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCC5 (0.000311%)
AATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACA8 (0.000498%)
AATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTC14 (0.000871%)
AATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCAC4 (0.000249%)
AATAATTCCAAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGA8 (0.000498%)
AATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATG14 (0.000871%)
AATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATG10 (0.000622%)
AATACTTCCGAGACGATGAATAGAATTATACCATATCGTAGTCCTTTTTGTACAATAGGAGTGTGGTGGCCTTGGTAGGTTCCTTCACGAATTACGTCTC3 (0.000187%)
AATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACA8 (0.000498%)
AATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCC5 (0.000311%)
AATATATCAATGATGACGAGACGTAATTCGTGAAGGAACCTACCAAGGCCACCACACTCCTATTGTACAAAAAGGACTACGATATGGTATAATTCTATTC4 (0.000249%)
AATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAA4 (0.000249%)
AATATGTCACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATC5 (0.000311%)
AATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAA3 (0.000187%)
AATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAG3 (0.000187%)
AATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTAC8 (0.000498%)
AATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTC4 (0.000249%)
AATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTG5 (0.000311%)
AATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGT5 (0.000311%)
AATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGT6 (0.000373%)
AATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAA9 (0.000560%)
AATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCT4 (0.000249%)
AATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGA39 (0.002427%)
AATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTC10 (0.000622%)
AATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGAC5 (0.000311%)
AATCCTTATCATAATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATAGGGCACCAATGA5 (0.000311%)
AATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAA7 (0.000436%)
AATGAAGTGGGTAACCTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATT119 (0.010960%)
AATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCT3 (0.000187%)
AATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTAT3 (0.000187%)
AATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTG5 (0.000311%)
AATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCA4 (0.000249%)
AATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTAT13 (0.000809%)
AATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAG10 (0.000622%)
AATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCAC8 (0.000498%)
AATTAGTTTAACCAGCCTAACACTTCTATGACAAACCGACGAAAATTATAAAAACTTTTCAAATATATTCTCCTCAGACCCCCTATCCACACCATTAATT4 (0.000249%)
AATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGC3 (0.000187%)
AATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTC8 (0.000498%)
AATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGG7 (0.000436%)
AATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTAC53 (0.003298%)
AATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGA3 (0.000187%)
AATTGGTAAAGAAATATGTCACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAA18 (0.001120%)
AATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTA18 (0.001120%)
AATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCT7 (0.000436%)
AATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCA6 (0.000373%)
AATTTGCAGTGGTTGATCCTGTTGTACAGCATGCCCATAGGGATGTTCCAACCAGCGGTTCTGTCTACCCCAGTGTGGCAGGACTTCTTGCCTTTCAGGT170 (0.010579%)
AATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGG5 (0.000311%)
AATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTT42 (0.002614%)
AATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTA8 (0.000498%)
AATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAAT4 (0.000249%)
ACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCA15 (0.000933%)
ACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAG8 (0.000498%)
ACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTA6 (0.000373%)
ACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCC4 (0.000249%)
ACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGT14 (0.000871%)
ACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCA21 (0.001307%)
ACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGA10 (0.000622%)
ACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAA6 (0.000373%)
ACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGG4 (0.000249%)
ACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAG5 (0.000311%)
ACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCC9 (0.000560%)
ACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTT14 (0.000871%)
ACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACT4 (0.000249%)
ACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGT5 (0.000311%)
ACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACT21 (0.001307%)
ACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAG18 (0.001120%)
ACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGC7 (0.000436%)
ACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCT3 (0.000187%)
ACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTG3 (0.000187%)
ACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTT3 (0.000187%)
ACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTG14 (0.000871%)
ACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCA3 (0.000187%)
ACACCCTTCAGGATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCC5 (0.000311%)
ACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTG13 (0.000809%)
ACACGTCTGAACTCCAGTCACCTGAATACGCATCTCGTAT7 (0.000174%)
ACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGT4 (0.000249%)
ACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGA4 (0.000249%)
ACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAG5 (0.000311%)
ACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTT7 (0.000436%)
ACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGG5 (0.000311%)
ACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACC6 (0.000373%)
ACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTT16 (0.000996%)
ACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTC5 (0.000311%)
ACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCA7 (0.000436%)
ACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGG5 (0.000311%)
ACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAA872 (0.054264%)
ACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATAC3 (0.000187%)
ACATCCCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATAT8 (0.000498%)
ACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCT3 (0.000187%)
ACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAAT7 (0.000436%)
ACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACA7 (0.000436%)
ACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGA5 (0.000311%)
ACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCA9 (0.000560%)
ACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCT9 (0.000560%)
ACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGT12 (0.000747%)
ACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCC10 (0.000622%)
ACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCA7 (0.000436%)
ACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTTG10 (0.000622%)
ACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCT30 (0.001867%)
ACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCC21 (0.001307%)
ACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAG4 (0.000249%)
ACCAATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATT7 (0.000436%)
ACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACGAG5 (0.000311%)
ACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACT3 (0.000187%)
ACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTC11 (0.000685%)
ACCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACT5 (0.000311%)
ACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGG4 (0.000249%)
ACCAGCTGTAATCCTTATCATAATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATAGGG5 (0.000311%)
ACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTACCAG4 (0.000249%)
ACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGG4 (0.000249%)
ACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGT6 (0.000373%)
ACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGA6 (0.000373%)
ACCATTTGAACTATTCTACCAGCTGTAATCCTTATCATAATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAA3 (0.000187%)
ACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGA8 (0.000498%)
ACCCACACCCTTCAGGATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAG5 (0.000311%)
ACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGA4 (0.000249%)
ACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGA9 (0.000560%)
ACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCA7 (0.000436%)
ACCCTATTTATCTTATTTCAACTAAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAG493 (0.030679%)
ACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAG3 (0.000187%)
ACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGG4 (0.000249%)
ACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAA11 (0.000685%)
ACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGA4 (0.000249%)
ACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCG13 (0.000809%)
ACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAG8 (0.000498%)
ACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCT19 (0.001182%)
ACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGAT4 (0.000249%)
ACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAA3 (0.000187%)
ACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGG10 (0.000622%)
ACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATG4 (0.000249%)
ACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGAC3 (0.000187%)
ACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCT17 (0.001058%)
ACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACC3 (0.000187%)
ACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCT3 (0.000187%)
ACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAG6 (0.000373%)
ACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGT8 (0.000498%)
ACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTC12 (0.000747%)
ACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGA15 (0.000933%)
ACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTC3 (0.000187%)
ACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATG9 (0.000560%)
ACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGG13 (0.000809%)
ACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATA9 (0.000560%)
ACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAG3 (0.000187%)
ACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAG7 (0.000436%)
ACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTG3 (0.000187%)
ACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCA5 (0.000311%)
ACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCG5 (0.000311%)
ACTACATGTGAAATAATTCCAAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTC3 (0.000187%)
ACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACT5 (0.000311%)
ACTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAA8 (0.000498%)
ACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATT6 (0.000373%)
ACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAAC25 (0.001556%)
ACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCA3 (0.000187%)
ACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGC26 (0.001618%)
ACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAG5 (0.000311%)
ACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATA3 (0.000187%)
ACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAA10 (0.000622%)
ACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGA6 (0.000373%)
ACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATT6 (0.000373%)
ACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGA4 (0.000249%)
ACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTG8 (0.000498%)
ACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAA12 (0.000747%)
ACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCA3 (0.000187%)
ACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCA4 (0.000249%)
ACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCT8 (0.000498%)
ACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATT5 (0.000311%)
ACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCAC3 (0.000187%)
ACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTC6 (0.000373%)
ACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTG5 (0.000311%)
ACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTT3 (0.000187%)
ACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCAT9 (0.000560%)
ACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTT3 (0.000187%)
ACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGG3 (0.000187%)
ACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGA5 (0.000311%)
ACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTG3 (0.000187%)
ACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTC3 (0.000187%)
ACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGAT5 (0.000311%)
ACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGT11 (0.000685%)
ACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTG9 (0.000560%)
ACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTC9 (0.000560%)
ACTTGACAGAGGCTCCAGGGCGGTTACAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGG5 (0.000311%)
ACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAG4 (0.000249%)
ACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCA4 (0.000249%)
ACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTA6 (0.000373%)
ACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTC6 (0.000373%)
ACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATC6 (0.000373%)
ACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTC8 (0.000498%)
ACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTG14 (0.000871%)
ACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGGT8 (0.000498%)
ACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCG5 (0.000311%)
ACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTT6 (0.000373%)
ACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACT3 (0.000187%)
AGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGT34 (0.002116%)
AGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACC6 (0.000373%)
AGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACT13 (0.000809%)
AGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAA42 (0.002614%)
AGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCC6 (0.000373%)
AGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAG9 (0.000560%)
AGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATC15 (0.000933%)
AGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTG54 (0.003360%)
AGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGT8 (0.000498%)
AGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCAT10 (0.000622%)
AGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTG12 (0.000747%)
AGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGT9 (0.000560%)
AGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCAT52 (0.003236%)
AGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCT32 (0.001991%)
AGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGT17 (0.001058%)
AGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATG36 (0.002240%)
AGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAA16 (0.000996%)
AGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTA26 (0.001618%)
AGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCC9 (0.000560%)
AGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACA44 (0.002738%)
AGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGAT4 (0.000249%)
AGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTT5 (0.000311%)
AGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGT13 (0.000809%)
AGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGA9 (0.000560%)
AGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCC24 (0.001494%)
AGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGG4 (0.000249%)
AGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAG11 (0.000685%)
AGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAG12 (0.000747%)
AGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATT11 (0.000685%)
AGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTC17 (0.001058%)
AGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGT16 (0.000996%)
AGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCT14 (0.000871%)
AGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAG9 (0.000560%)
AGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTT6 (0.000373%)
AGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCC7 (0.000436%)
AGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGA808 (0.050281%)
AGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCC31 (0.001929%)
AGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCAC5 (0.000311%)
AGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGC51 (0.003174%)
AGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATA9 (0.000560%)
AGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCC14 (0.000871%)
AGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCT43 (0.002676%)
AGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCAC4 (0.000249%)
AGACTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAAT4 (0.000249%)
AGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAA30 (0.001867%)
AGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTCA4 (0.000249%)
AGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCA3 (0.000187%)
AGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCT5 (0.000311%)
AGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTG5 (0.000311%)
AGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTT10 (0.000622%)
AGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTC13 (0.000809%)
AGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTG4 (0.000249%)
AGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGG29 (0.001805%)
AGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGC63 (0.003920%)
AGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTC24 (0.001494%)
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG96 (0.002390%)
AGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAA7 (0.000436%)
AGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGT3 (0.000187%)
AGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGAT5 (0.000311%)
AGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGT13 (0.000809%)
AGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGT5 (0.000311%)
AGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAGCAGCT4 (0.000249%)
AGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCA4 (0.000249%)
AGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATA16 (0.000996%)
AGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACA5 (0.000311%)
AGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAG6 (0.000373%)
AGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAG13 (0.000809%)
AGAGGCTCCAGGGCGGTTACAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCT4 (0.000249%)
AGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATG4 (0.000249%)
AGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCC8 (0.000498%)
AGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGG7 (0.000436%)
AGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGG9 (0.000560%)
AGAGGGTTAAGTGGTGAAATTCCTGTTGGAGGTCAGCAGCCTCCTAGATCATGTGTTGGTACGAGGCTAGAATGATAGAACGCTCAGAAGAATCCTGCAA11 (0.000685%)
AGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGG3 (0.000187%)
AGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCA6 (0.000373%)
AGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATG17 (0.001058%)
AGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGT16 (0.000996%)
AGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTG12 (0.000747%)
AGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAA8 (0.000498%)
AGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAA5 (0.000311%)
AGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCA3 (0.000187%)
AGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGT13 (0.000809%)
AGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGG34 (0.002116%)
AGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAG7 (0.000436%)
AGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATT15 (0.000933%)
AGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGC10 (0.000622%)
AGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCG34 (0.002116%)
AGATCCACTTCCCCAGACTGTCCATCTCTGGAGAATATAACTTGAAGACACTCATGAGTCCACTGGGCATCACCCGGATCTTCAACAATGGGGCTGACCT3 (0.000187%)
AGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCA8 (0.000498%)
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAT1647 (0.040997%)
AGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTG28 (0.001742%)
AGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGA4 (0.000249%)
AGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTT27 (0.001680%)
AGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTAC6 (0.000373%)
AGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGAC4 (0.000249%)
AGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTG7 (0.000436%)
AGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAA20 (0.001245%)
AGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTA15 (0.000933%)
AGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCT4 (0.000249%)
AGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGA8 (0.000498%)
AGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCA23 (0.001431%)
AGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTG4 (0.000249%)
AGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTG8 (0.000498%)
AGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGC15 (0.000933%)
AGCACACGTCTGAACTCCAGTCACCTGAATACGCATCTCG17 (0.000423%)
AGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCC16 (0.000996%)
AGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCT17 (0.001058%)
AGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTG7 (0.000436%)
AGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTA24 (0.001494%)
AGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTC8 (0.000498%)
AGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTT10 (0.000622%)
AGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGT6 (0.000373%)
AGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCA11 (0.000685%)
AGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGAC22 (0.001369%)
AGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGG12 (0.000747%)
AGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTC4 (0.000249%)
AGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGA7 (0.000436%)
AGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGG4 (0.000249%)
AGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGG4 (0.000249%)
AGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGC24 (0.001494%)
AGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGC5 (0.000311%)
AGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGC4 (0.000249%)
AGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGA8 (0.000498%)
AGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGA4 (0.000249%)
AGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTG23 (0.001431%)
AGCCAGGCCAGCCTGTGTTTAATGGAAGGAACCCAATTCAGAAGGAAGGATGACATCGTAGGGTGGTCATTTATGTGTGGGATCTACCACTTTTCCCACA10 (0.000622%)
AGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCG54 (0.003360%)
AGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTA12 (0.000747%)
AGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCC7 (0.000436%)
AGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGT4 (0.000249%)
AGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGA3 (0.000187%)
AGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGA6 (0.000373%)
AGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCA4 (0.000249%)
AGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGC9 (0.000560%)
AGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGA9 (0.000560%)
AGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCC7 (0.000436%)
AGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTA7 (0.000436%)
AGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCA4 (0.000249%)
AGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATG7 (0.000436%)
AGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACT8 (0.000498%)
AGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGA11 (0.000685%)
AGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACA4 (0.000249%)
AGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTG9 (0.000560%)
AGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAA6 (0.000373%)
AGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGAG3 (0.000187%)
AGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCA25 (0.001556%)
AGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTA4 (0.000249%)
AGCGGGCACCTCACTGGGCAGTCAGAGTCTCGCTGGCCTTGTCGATCACACTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCG159 (0.009894%)
AGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTC5 (0.000311%)
AGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACA3 (0.000187%)
AGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACA6 (0.000373%)
AGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCAT7 (0.000436%)
AGCTCCTCCGATTAGGTGTATTAATAAGTGTCCTGCAGTAATGTTAGCTGTAAGCCGGACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCA4 (0.000249%)
AGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGAC7 (0.000436%)
AGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATA4 (0.000249%)
AGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAG6 (0.000373%)
AGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGA14 (0.000871%)
AGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCAC5 (0.000311%)
AGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAG13 (0.000809%)
AGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAA501 (0.031177%)
AGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCT10 (0.000622%)
AGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAAC9 (0.000560%)
AGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTA3 (0.000187%)
AGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAA12 (0.000747%)
AGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGG27 (0.001680%)
AGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAG4 (0.000249%)
AGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATG10 (0.000622%)
AGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTG5 (0.000311%)
AGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACT13 (0.000809%)
AGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTT14 (0.000871%)
AGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATC6 (0.000373%)
AGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCAC8 (0.000498%)
AGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATC3 (0.000187%)
AGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGA10 (0.000622%)
AGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAA5 (0.000311%)
AGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGG7 (0.000436%)
AGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCA7 (0.000436%)
AGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCAT3 (0.000187%)
AGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCG5 (0.000311%)
AGGATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACA3 (0.000187%)
AGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAG3 (0.000187%)
AGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCAC42 (0.002614%)
AGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAAT12 (0.000747%)
AGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCA6 (0.000373%)
AGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGAT12 (0.000747%)
AGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATA6 (0.000373%)
AGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTC6 (0.000373%)
AGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCT16 (0.000996%)
AGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTT4 (0.000249%)
AGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTACCAGCATCTGTTCTGATTC4 (0.000249%)
AGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCT4 (0.000249%)
AGGCCATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGAC12 (0.000747%)
AGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACT13 (0.000809%)
AGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTT4 (0.000249%)
AGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGT3 (0.000187%)
AGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGA6 (0.000373%)
AGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCA388 (0.024145%)
AGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGC3 (0.000187%)
AGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCA12 (0.000747%)
AGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTC7 (0.000436%)
AGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTC10 (0.000622%)
AGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGC6 (0.000373%)
AGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGA4 (0.000249%)
AGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACC4 (0.000249%)
AGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAGGTCTGCAGGCTGGGTCATCCCCATTGGCTTGCTCTT3 (0.000187%)
AGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAG4 (0.000249%)
AGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGT3 (0.000187%)
AGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTT4 (0.000249%)
AGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCA9 (0.000560%)
AGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGG3 (0.000187%)
AGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCT5 (0.000311%)
AGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAG5 (0.000311%)
AGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGT3 (0.000187%)
AGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACT368 (0.022900%)
AGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCA7 (0.000436%)
AGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTG5 (0.000311%)
AGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGG5 (0.000311%)
AGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGA4 (0.000249%)
AGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTC14 (0.000871%)
AGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACA18 (0.001120%)
AGTAACTACATGTGAAATAATTCCAAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCC7 (0.000436%)
AGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTT3 (0.000187%)
AGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATC14 (0.000871%)
AGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCA21 (0.001307%)
AGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCG3 (0.000187%)
AGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGT13 (0.000809%)
AGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTG11 (0.000685%)
AGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGC4 (0.000249%)
AGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGC7 (0.000436%)
AGTCAGACTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAA9 (0.000560%)
AGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACG8 (0.000498%)
AGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTC7 (0.000436%)
AGTCCATGACCATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCC6 (0.000373%)
AGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGG5 (0.000311%)
AGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCT3 (0.000187%)
AGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCT3 (0.000187%)
AGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAG3 (0.000187%)
AGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTA5 (0.000311%)
AGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAG13 (0.000809%)
AGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCAC5 (0.000311%)
AGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACT19 (0.001182%)
AGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCA4 (0.000249%)
AGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTG4 (0.000249%)
AGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTG3 (0.000187%)
AGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCT44 (0.002738%)
AGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAA9 (0.000560%)
AGTTCCCCTACCAATACCACACCCATTAATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCCATTCTATGATCA3 (0.000187%)
AGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTT6 (0.000373%)
AGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAA34 (0.002116%)
AGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAG9 (0.000560%)
AGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCATGGGCAGTTACGATAACATTGTAAATTTGGTCATCTCCTAA3 (0.000187%)
AGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGT3 (0.000187%)
AGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCT5 (0.000311%)
ATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCA17 (0.001058%)
ATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGA17 (0.001058%)
ATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAA12 (0.000747%)
ATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAA10 (0.000622%)
ATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTA12 (0.000747%)
ATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCA29 (0.001805%)
ATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACA7 (0.000436%)
ATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAG5 (0.000311%)
ATAATACTAGGGTTATGAGAATTAAGAATATGATTAGGATACCTAGGATATCTTTGATTGTATAGTAGGGGTGAAATGGAATTTTATCTGCATCTGAGTT6 (0.000373%)
ATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACC9 (0.000560%)
ATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATT7 (0.000436%)
ATAATTCCAAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGAT3 (0.000187%)
ATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCATT4 (0.000249%)
ATAATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCT11 (0.000685%)
ATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCA9 (0.000560%)
ATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGGAATG3 (0.000187%)
ATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGA6 (0.000373%)
ATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAG4 (0.000249%)
ATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACT16 (0.000996%)
ATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAG7 (0.000436%)
ATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTCGGGC4 (0.000249%)
ATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACAC3 (0.000187%)
ATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTA15 (0.000933%)
ATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTC3 (0.000187%)
ATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGC3 (0.000187%)
ATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAG14 (0.000871%)
ATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCAC5 (0.000311%)
ATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTA3 (0.000187%)
ATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTT4 (0.000249%)
ATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGAT16 (0.000996%)
ATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTT12 (0.000747%)
ATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTG9 (0.000560%)
ATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCT3 (0.000187%)
ATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTC22 (0.001369%)
ATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAA3 (0.000187%)
ATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAG7 (0.000436%)
ATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTT5 (0.000311%)
ATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCA12 (0.000747%)
ATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCT4 (0.000249%)
ATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCAT23 (0.001431%)
ATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGA9 (0.000560%)
ATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCC3 (0.000187%)
ATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCA9 (0.000560%)
ATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAAT10 (0.000622%)
ATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGC11 (0.000685%)
ATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAG12 (0.000747%)
ATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTC12 (0.000747%)
ATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCA17 (0.001058%)
ATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGAT9 (0.000560%)
ATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGC7 (0.000436%)
ATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCC9 (0.000560%)
ATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTA3 (0.000187%)
ATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCA715 (0.044494%)
ATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGG17 (0.001058%)
ATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCAGAACGACTCGG14 (0.000871%)
ATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACT6 (0.000373%)
ATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCA3 (0.000187%)
ATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCC6 (0.000373%)
ATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCCATACACTACACATCAGATACAATAACA3 (0.000187%)
ATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGG32 (0.001991%)
ATCCACTTCCCCAGACTGTCCATCTCTGGAGAATATAACTTGAAGACACTCATGAGTCCACTGGGCATCACCCGGATCTTCAACAATGGGGCTGACCTCT5 (0.000311%)
ATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTA3 (0.000187%)
ATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAG5 (0.000311%)
ATCCCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTA7 (0.000436%)
ATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAA11 (0.000685%)
ATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAA12 (0.000747%)
ATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTC3 (0.000187%)
ATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACC3 (0.000187%)
ATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCT16 (0.000996%)
ATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCA4 (0.000249%)
ATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCA28 (0.001742%)
ATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCG13 (0.000809%)
ATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGA18 (0.001120%)
ATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTGGAGAGCATAC8 (0.000498%)
ATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAATAC15 (0.000373%)
ATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGG21 (0.001307%)
ATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATT12 (0.000747%)
ATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCC16 (0.000996%)
ATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCC6 (0.000373%)
ATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCC7 (0.000436%)
ATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAA6 (0.000373%)
ATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTAT5 (0.000311%)
ATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACT3 (0.000187%)
ATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTT275 (0.017113%)
ATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGC17 (0.001058%)
ATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTG12 (0.000747%)
ATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCA3 (0.000187%)
ATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTG6 (0.000373%)
ATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGA8 (0.000498%)
ATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATA6 (0.000373%)
ATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGG15 (0.000933%)
ATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCG4 (0.000249%)
ATCTTCCTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAG310 (0.019291%)
ATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTA16 (0.000996%)
ATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAA3 (0.000187%)
ATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACAC4 (0.000249%)
ATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAAC10 (0.000622%)
ATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCCATACACTACACATCAGATACAATAACAGCCTTT4 (0.000249%)
ATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAG3 (0.000187%)
ATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGT4 (0.000249%)
ATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAA42 (0.002614%)
ATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGA10 (0.000622%)
ATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCA11 (0.000685%)
ATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACG10 (0.000622%)
ATGACCATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTC16 (0.000996%)
ATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATA10 (0.000622%)
ATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTG11 (0.000685%)
ATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCG11 (0.000685%)
ATGAGCAATAATGTCTATTGGCTTTCTAGGCTTTATTGTATGAGCCCACCACATATTCACAGTAGGATTAGATGTAGACACACGAGCTTACTTTACATCA3 (0.000187%)
ATGAGGTTTAGGGTTCCTACATGGTTTTGGATTAAGATGAGGGCAATTAGCAGTGGAATAGAACCGATTAGGGTATAAAATAGGAAATAAATCCCTGCGT14 (0.000871%)
ATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGA3 (0.000187%)
ATGAGTTCCCCTACCAATACCACACCCATTAATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCCATTCTATGA3 (0.000187%)
ATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGA5 (0.000311%)
ATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCA9 (0.000560%)
ATGCAACCTGCTGGCAGAGAAGCAACATGGCTTCTGCAAGGCAAATCTCATGCATAATCTTGGTGGGGAAGAAGTTTCAGTGGCCTGCAAGTTATTCCAA5 (0.000311%)
ATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAA3 (0.000187%)
ATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGG10 (0.000622%)
ATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTG8 (0.000498%)
ATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGA8 (0.000498%)
ATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCT6 (0.000373%)
ATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGG3 (0.000187%)
ATGCTATATCTGGGGCTCCGATTATTAGTGGGACAAGTCAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCATG3 (0.000187%)
ATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGT10 (0.000622%)
ATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTAC3 (0.000187%)
ATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAA4 (0.000249%)
ATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGC3 (0.000187%)
ATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAG18 (0.001120%)
ATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTT3 (0.000187%)
ATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCT6 (0.000373%)
ATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCA4 (0.000249%)
ATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGG3 (0.000187%)
ATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCT18 (0.001120%)
ATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCA7 (0.000436%)
ATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGG13 (0.000809%)
ATGGCATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCAGAACGA7 (0.000436%)
ATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAA16 (0.000996%)
ATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGA17 (0.001058%)
ATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGC28 (0.001742%)
ATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCAC8 (0.000498%)
ATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGT11 (0.000685%)
ATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGC25 (0.001556%)
ATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAG4 (0.000249%)
ATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGA13 (0.000809%)
ATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTC4 (0.000249%)
ATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCAC7 (0.000436%)
ATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGA14 (0.000871%)
ATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTTTGTTT4 (0.000249%)
ATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATG4 (0.000249%)
ATGTCACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCAT3 (0.000187%)
ATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGC5 (0.000311%)
ATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCT17 (0.001058%)
ATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGT11 (0.000685%)
ATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGT5 (0.000311%)
ATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTT21 (0.001307%)
ATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATAT4 (0.000249%)
ATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACA3 (0.000187%)
ATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGG5 (0.000311%)
ATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGA10 (0.000622%)
ATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGG4 (0.000249%)
ATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGA4 (0.000249%)
ATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAAT35 (0.002178%)
ATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGG4 (0.000249%)
ATTAAGTAGTGGGACTTCTAGAGGGTTAAGTGGTGAAATTCCTGTTGGAGGTCAGCAGCCTCCTAGATCATGTGTTGGTACGAGGCTAGAATGATAGAAC5 (0.000311%)
ATTAAGTCTATGAGTTCCCCTACCAATACCACACCCATTAATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCC6 (0.000373%)
ATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGC3 (0.000187%)
ATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCG10 (0.000622%)
ATTACGGGTGACTAATCCGATATATACACGCAAACGGAGCCTCAATATTTTTTATTTGCTTATTCCTTCATGTCGGACGAGGCTTATATTATGGATCATA8 (0.000498%)
ATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGT10 (0.000622%)
ATTAGGTGTATTAATAAGTGTCCTGCAGTAATGTTAGCTGTAAGCCGGACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAATAA6 (0.000373%)
ATTAGTTTAACCAGCCTAACACTTCTATGACAAACCGACGAAAATTATAAAAACTTTTCAAATATATTCTCCTCAGACCCCCTATCCACACCATTAATTA7 (0.000436%)
ATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAA8 (0.000498%)
ATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATT10 (0.000622%)
ATTATGAGGTTTAGGGTTCCTACATGGTTTTGGATTAAGATGAGGGCAATTAGCAGTGGAATAGAACCGATTAGGGTATAAAATAGGAAATAAATCCCTG5 (0.000311%)
ATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCC48 (0.002987%)
ATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTC21 (0.001307%)
ATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGAC28 (0.001742%)
ATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATC33 (0.002054%)
ATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACC8 (0.000498%)
ATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTC8 (0.000498%)
ATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCT212 (0.013193%)
ATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGA12 (0.000747%)
ATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGAT33 (0.002054%)
ATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTC6 (0.000373%)
ATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCT11 (0.000685%)
ATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGA14 (0.000871%)
ATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATA20 (0.001245%)
ATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCATTATC16 (0.000996%)
ATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTAC6 (0.000373%)
ATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGA6 (0.000373%)
ATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGT21 (0.001307%)
ATTCTACCAGCTGTAATCCTTATCATAATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCA11 (0.000685%)
ATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACAC24 (0.001494%)
ATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGC5 (0.000311%)
ATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATT4 (0.000249%)
ATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGA5 (0.000311%)
ATTCTGTCCAGGGCTCTGGGACAGAGTCTGCATATGGATCTCTATATACATCCTGTCATTCAAGCTCTGATTGGCTGTTCCAAAGTTGGCTTAGACAGCT69 (0.004294%)
ATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGA9 (0.000560%)
ATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAAT53 (0.003298%)
ATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCAC13 (0.000809%)
ATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGA13 (0.000809%)
ATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGT18 (0.001120%)
ATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGC5 (0.000311%)
ATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTACG11 (0.000685%)
ATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGAC6 (0.000373%)
ATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAA22 (0.001369%)
ATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAA8 (0.000498%)
ATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGT74 (0.004605%)
ATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGAT9 (0.000560%)
ATTGGTAAAGAAATATGTCACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAG6 (0.000373%)
ATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTT8 (0.000498%)
ATTGTCACCTTCCAGCTTGACGACTGCCTTGACTTTTTCCCCAGTCATGGTCTCCAGTTCGCACTCCTCCCCCAGGGTGAACTCATTGCGGACCACTTTG5 (0.000311%)
ATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAA9 (0.000560%)
ATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGA54 (0.003360%)
ATTTAGTCGGCCTGGGATGGCATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGT57 (0.003547%)
ATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCATTCTC17 (0.001058%)
ATTTATCTTATTTCAACTAAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTA5 (0.000311%)
ATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAA26 (0.001618%)
ATTTCAACTAAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACG12 (0.000747%)
ATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTT29 (0.001805%)
ATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCCATACACTACACATCAGATACAA3 (0.000187%)
ATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCAC16 (0.000996%)
ATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACT29 (0.001805%)
ATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCA13 (0.000809%)
ATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCT27 (0.001680%)
ATTTGAACTATTCTACCAGCTGTAATCCTTATCATAATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCG17 (0.001058%)
ATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGA33 (0.002054%)
ATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCC5 (0.000311%)
ATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGA3 (0.000187%)
ATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTG19 (0.001182%)
ATTTGTCGAGACGTAAATTACGGGTGACTAATCCGATATATACACGCAAACGGAGCCTCAATATTTTTTATTTGCTTATTCCTTCATGTCGGACGAGGCT7 (0.000436%)
ATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAAC11 (0.000685%)
ATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTG23 (0.001431%)
ATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGT44 (0.002738%)
ATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTAC10 (0.000622%)
ATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAA16 (0.000996%)
ATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAATA12 (0.000747%)
ATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACT48 (0.002987%)
ATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTA33 (0.002054%)
CAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTC44 (0.002738%)
CAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCAC34 (0.002116%)
CAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTA153 (0.009521%)
CAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACG27 (0.001680%)
CAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGT32 (0.001991%)
CAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGA5 (0.000311%)
CAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAG54 (0.003360%)
CAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCT17 (0.001058%)
CAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAA161 (0.010019%)
CAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTG13 (0.000809%)
CAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTAT56 (0.003485%)
CAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTC3 (0.000187%)
CAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACG147 (0.009148%)
CAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCC15 (0.000933%)
CAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTG28 (0.001742%)
CAAATAGTGAGTTTTTGAGCTTGTTGATTCTGTTTGTAAAATCCTGGTTGGCTTCGTCAATCAACCCTTTCATCCTGCAGCCTGAAGGGCATTTGTGGTT7 (0.000436%)
CAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCT13 (0.000809%)
CAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGG10 (0.000622%)
CAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCC41 (0.002551%)
CAAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGATCAAAGAA13 (0.000809%)
CAAATGCAACCTGCTGGCAGAGAAGCAACATGGCTTCTGCAAGGCAAATCTCATGCATAATCTTGGTGGGGAAGAAGTTTCAGTGGCCTGCAAGTTATTC54 (0.003360%)
CAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTT23 (0.001431%)
CAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTG55 (0.003423%)
CAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGT29 (0.001805%)
CAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCAC34 (0.002116%)
CAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCA7 (0.000436%)
CAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAA24 (0.001494%)
CAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGAC11 (0.000685%)
CAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAG16 (0.000996%)
CAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTC18 (0.001120%)
CAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCAT80 (0.004978%)
CAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATC12 (0.000747%)
CAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCA12 (0.000747%)
CAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCC37 (0.002302%)
CAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTGT8 (0.000498%)
CAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTTT13 (0.000809%)
CAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTG337 (0.020971%)
CAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCCATACACTACACATCAGAT11 (0.000685%)
CAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTT17 (0.001058%)
CAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGAT25 (0.001556%)
CAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAG18 (0.001120%)
CAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAA13 (0.000809%)
CAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTA12 (0.000747%)
CAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAA37 (0.002302%)
CAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTT5 (0.000311%)
CAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGC9 (0.000560%)
CAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGT10 (0.000622%)
CAACCTGCTGGCAGAGAAGCAACATGGCTTCTGCAAGGCAAATCTCATGCATAATCTTGGTGGGGAAGAAGTTTCAGTGGCCTGCAAGTTATTCCAAACA3 (0.000187%)
CAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCC25 (0.001556%)
CAACTAAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAA4 (0.000249%)
CAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTC16 (0.000996%)
CAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCT15 (0.000933%)
CAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTC33 (0.002054%)
CAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTG13 (0.000809%)
CAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTTGAC9 (0.000560%)
CAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACA23 (0.001431%)
CAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAA21 (0.001307%)
CAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAAT16 (0.000996%)
CAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGG30 (0.001867%)
CAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATG59 (0.003672%)
CAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGT4 (0.000249%)
CAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCC52 (0.003236%)
CAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGC131 (0.008152%)
CAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTT84 (0.005227%)
CAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGC149 (0.009272%)
CAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGG223 (0.013877%)
CAAGACACAGTTTTCGCCCTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGG14 (0.000871%)
CAAGACCTCAAATATGGTTGTGTGCTTGACAAAGGCCACATCCCCACCGCCATCTTTCAGACACTTGAATGCGCCTACGTAGCCAAAGAATGGTTGAGTG216 (0.013442%)
CAAGACTTGACAGAGGCTCCAGGGCGGTTACAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGG14 (0.000871%)
CAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCT16 (0.000996%)
CAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTC53 (0.003298%)
CAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCG5 (0.000311%)
CAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATA51 (0.003174%)
CAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGG32 (0.001991%)
CAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTT11 (0.000685%)
CAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGA7 (0.000436%)
CAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTG12 (0.000747%)
CAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCC133 (0.008276%)
CAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTG9 (0.000560%)
CAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACT46 (0.002863%)
CAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTT9 (0.000560%)
CAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGG7 (0.000436%)
CAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAG36 (0.002240%)
CAAGTCAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCATGGGCAGTTACGATAACATTGTAAATTTGGTCATC3 (0.000187%)
CAAGTCCATGACCATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGG16 (0.000996%)
CAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGC72 (0.004481%)
CAAGTGAGCTTTTTAGTTTGTGTCGGAAGCCTGTAATTACGGCTCCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGT5 (0.000311%)
CAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTC13 (0.000809%)
CAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCA20 (0.001245%)
CAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAA10 (0.000622%)
CAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGCT23 (0.001431%)
CAATAATGTCTATTGGCTTTCTAGGCTTTATTGTATGAGCCCACCACATATTCACAGTAGGATTAGATGTAGACACACGAGCTTACTTTACATCAGCCAC8 (0.000498%)
CAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTAT8 (0.000498%)
CAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACAC4 (0.000249%)
CAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTT70 (0.004356%)
CAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTC3 (0.000187%)
CAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGG12 (0.000747%)
CAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCT25 (0.001556%)
CAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTT7 (0.000436%)
CAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATC12 (0.000747%)
CAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAG3 (0.000187%)
CAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTT4 (0.000249%)
CAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTG732 (0.045552%)
CAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTG5 (0.000311%)
CAATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCT22 (0.001369%)
CACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACT41 (0.002551%)
CACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTG7 (0.000436%)
CACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGC8 (0.000498%)
CACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTA29 (0.001805%)
CACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCT35 (0.002178%)
CACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGG32 (0.001991%)
CACAATATATCAATGATGACGAGACGTAATTCGTGAAGGAACCTACCAAGGCCACCACACTCCTATTGTACAAAAAGGACTACGATATGGTATAATTCTA5 (0.000311%)
CACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCAC10 (0.000622%)
CACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGA7 (0.000436%)
CACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAG38 (0.002365%)
CACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTC14 (0.000871%)
CACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCAC12 (0.000747%)
CACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTT134 (0.008339%)
CACACATTTGTCGAGACGTAAATTACGGGTGACTAATCCGATATATACACGCAAACGGAGCCTCAATATTTTTTATTTGCTTATTCCTTCATGTCGGACG96 (0.005974%)
CACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCT14 (0.000871%)
CACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGC6 (0.000373%)
CACACCCTTCAGGATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCC23 (0.001431%)
CACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGC10 (0.000622%)
CACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCG9 (0.000560%)
CACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTT20 (0.001245%)
CACACGTCTGAACTCCAGTCACCTGAATACGCATCTCGTA6 (0.000149%)
CACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCC5 (0.000311%)
CACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAA6 (0.000373%)
CACACTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCTCCAGCGCAGGTCTGGCTTTCTCGCCAAGTGTCTTCAGG5 (0.000311%)
CACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACG14 (0.000871%)
CACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTC42 (0.002614%)
CACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACA107 (0.006659%)
CACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTC3 (0.000187%)
CACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTT725 (0.045116%)
CACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTAC8 (0.000498%)
CACAGATCCAGCCAAATGCAACCTGCTGGCAGAGAAGCAACATGGCTTCTGCAAGGCAAATCTCATGCATAATCTTGGTGGGGAAGAAGTTTCAGTGGCC33 (0.002054%)
CACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTC19 (0.001182%)
CACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTA28 (0.001742%)
CACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATA20 (0.001245%)
CACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCA22 (0.001369%)
CACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGGA3 (0.000187%)
CACATCCCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATA21 (0.001307%)
CACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTC12 (0.000747%)
CACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAA4 (0.000249%)
CACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTAC17 (0.001058%)
CACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGG14 (0.000871%)
CACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTC4 (0.000249%)
CACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATG4 (0.000249%)
CACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGC46 (0.002863%)
CACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTT7 (0.000436%)
CACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACC13 (0.000809%)
CACCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCAC23 (0.001431%)
CACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATG6 (0.000373%)
CACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTG24 (0.001494%)
CACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACA8 (0.000498%)
CACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGG19 (0.001182%)
CACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAG10 (0.000622%)
CACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACA18 (0.001120%)
CACCCACACCCTTCAGGATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCA309 (0.019229%)
CACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAG10 (0.000622%)
CACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACG9 (0.000560%)
CACCCTTCAGGATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCA13 (0.000809%)
CACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAG11 (0.000685%)
CACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGC4 (0.000249%)
CACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCA11 (0.000685%)
CACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTG9 (0.000560%)
CACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCG10 (0.000622%)
CACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTAT11 (0.000685%)
CACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTC12 (0.000747%)
CACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCG4 (0.000249%)
CACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCC4 (0.000249%)
CACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACA6 (0.000373%)
CACCTTCCAGCTTGACGACTGCCTTGACTTTTTCCCCAGTCATGGTCTCCAGTTCGCACTCCTCCCCCAGGGTGAACTCATTGCGGACCACTTTGGGTCC5 (0.000311%)
CACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTG10 (0.000622%)
CACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGT12 (0.000747%)
CACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTT26 (0.001618%)
CACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAG25 (0.001556%)
CACGAGCCAGGCCAGCCTGTGTTTAATGGAAGGAACCCAATTCAGAAGGAAGGATGACATCGTAGGGTGGTCATTTATGTGTGGGATCTACCACTTTTCC37 (0.002302%)
CACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTT6 (0.000373%)
CACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTG76 (0.004729%)
CACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAA13 (0.000809%)
CACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTT35 (0.002178%)
CACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGC79 (0.004916%)
CACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGT6 (0.000373%)
CACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTT7 (0.000436%)
CACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGC18 (0.001120%)
CACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTC9 (0.000560%)
CACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAG19 (0.001182%)
CACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTA4 (0.000249%)
CACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTG9 (0.000560%)
CACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCT420 (0.026136%)
CACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAG5 (0.000311%)
CACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTT12 (0.000747%)
CACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACA23 (0.001431%)
CACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTC3 (0.000187%)
CACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATAT15 (0.000933%)
CACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAA9 (0.000560%)
CACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAG13 (0.000809%)
CACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCAT5 (0.000311%)
CACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCA5 (0.000311%)
CACTGGGCAGTCAGAGTCTCGCTGGCCTTGTCGATCACACTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCTCCA3 (0.000187%)
CACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACAC9 (0.000560%)
CACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGT8 (0.000498%)
CACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCT11 (0.000685%)
CACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCAT9 (0.000560%)
CACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGT10 (0.000622%)
CACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATG5 (0.000311%)
CACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGC9 (0.000560%)
CACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGAT12 (0.000747%)
CACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTT5 (0.000311%)
CACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGG3 (0.000187%)
CAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAG10 (0.000622%)
CAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGAC54 (0.003360%)
CAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAA62 (0.003858%)
CAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAAT104 (0.006472%)
CAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGT18 (0.001120%)
CAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGC14 (0.000871%)
CAGAAGGAAGGATGACATCGTAGGGTGGTCATTTATGTGTGGGATCTACCACTTTTCCCACAAAGATGGGGCTCTGAGTGTGTTCTTCAAATATTATAAA5 (0.000311%)
CAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAG9 (0.000560%)
CAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTC3 (0.000187%)
CAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTG25 (0.001556%)
CAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGAGGCTCAGGCCATTCTTCAT5 (0.000311%)
CAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGG141 (0.008774%)
CAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGT29 (0.001805%)
CAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCG122 (0.007592%)
CAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGC13 (0.000809%)
CAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCC22 (0.001369%)
CAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCA10 (0.000622%)
CAGACTACGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAA17 (0.001058%)
CAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTC5 (0.000311%)
CAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGC51 (0.003174%)
CAGACTGTCCATCTCTGGAGAATATAACTTGAAGACACTCATGAGTCCACTGGGCATCACCCGGATCTTCAACAATGGGGCTGACCTCTCCGGAATCACA30 (0.001867%)
CAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATT57 (0.003547%)
CAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCT20 (0.001245%)
CAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAG28 (0.001742%)
CAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGA9 (0.000560%)
CAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTG51 (0.003174%)
CAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTT124 (0.007716%)
CAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGA44 (0.002738%)
CAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTG5 (0.000311%)
CAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGG8 (0.000498%)
CAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAGCAGC14 (0.000871%)
CAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCAT9 (0.000560%)
CAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAA3 (0.000187%)
CAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTAT36 (0.002240%)
CAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGC36 (0.002240%)
CAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCG12 (0.000747%)
CAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGG56 (0.003485%)
CAGAGTCTCGCTGGCCTTGTCGATCACACTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCTCCAGCGCAGGTCTG4 (0.000249%)
CAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCC24 (0.001494%)
CAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGG13 (0.000809%)
CAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGG10 (0.000622%)
CAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCA482 (0.029995%)
CAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTC46 (0.002863%)
CAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGC8 (0.000498%)
CAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAA3270 (0.081396%)
CAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTA7 (0.000436%)
CAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCC23 (0.001431%)
CAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATT23 (0.001431%)
CAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCT20 (0.001245%)
CAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGC50 (0.003111%)
CAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTT48 (0.002987%)
CAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCT18 (0.001120%)
CAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCT13 (0.000809%)
CAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAG20 (0.001245%)
CAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGC42 (0.002614%)
CAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTG52 (0.003236%)
CAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGA63 (0.003920%)
CAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAG95 (0.005912%)
CAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGA9 (0.000560%)
CAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTG10 (0.000622%)
CAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGAC36 (0.002240%)
CAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATG6 (0.000373%)
CAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATC23 (0.001431%)
CAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCA6 (0.000373%)
CAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGG6 (0.000373%)
CAGCCTAACACTTCTATGACAAACCGACGAAAATTATAAAAACTTTTCAAATATATTCTCCTCAGACCCCCTATCCACACCATTAATTATTTTAACAGCC7 (0.000436%)
CAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAG4 (0.000249%)
CAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGC28 (0.001742%)
CAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATG14 (0.000871%)
CAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTG9 (0.000560%)
CAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGC36 (0.002240%)
CAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCT13 (0.000809%)
CAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCC60 (0.003734%)
CAGCCTGTGTTTAATGGAAGGAACCCAATTCAGAAGGAAGGATGACATCGTAGGGTGGTCATTTATGTGTGGGATCTACCACTTTTCCCACAAAGATGGG6 (0.000373%)
CAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAG72 (0.004481%)
CAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCA17 (0.001058%)
CAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCC11 (0.000685%)
CAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCC25 (0.001556%)
CAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTG16 (0.000996%)
CAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTA23 (0.001431%)
CAGCTGTAATCCTTATCATAATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATAGGGCA6 (0.000373%)
CAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATG33 (0.002054%)
CAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTC23 (0.001431%)
CAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCA9 (0.000560%)
CAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAAT4 (0.000249%)
CAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGC16 (0.000996%)
CAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAAC28 (0.001742%)
CAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGT63 (0.003920%)
CAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCAT112 (0.006970%)
CAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCA8 (0.000498%)
CAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGC7 (0.000436%)
CAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAA4 (0.000249%)
CAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTT5 (0.000311%)
CAGGATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGAC13 (0.000809%)
CAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCAACACTGGA4 (0.000249%)
CAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCC54 (0.003360%)
CAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGAT26 (0.001618%)
CAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGT9 (0.000560%)
CAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTT78 (0.004854%)
CAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTACCAGCATCTGTTCTGATT7 (0.000436%)
CAGGCCAGCCTGTGTTTAATGGAAGGAACCCAATTCAGAAGGAAGGATGACATCGTAGGGTGGTCATTTATGTGTGGGATCTACCACTTTTCCCACAAAG5 (0.000311%)
CAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCT19 (0.001182%)
CAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAA21 (0.001307%)
CAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTG24 (0.001494%)
CAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCC3 (0.000187%)
CAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGG6 (0.000373%)
CAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCT4 (0.000249%)
CAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACA128 (0.007965%)
CAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACA7 (0.000436%)
CAGGGCGGTTACAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGT3 (0.000187%)
CAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTT11 (0.000685%)
CAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCT11 (0.000685%)
CAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGC13 (0.000809%)
CAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGA10 (0.000622%)
CAGGTGCTCAGGAGAACGTGGTCTTCAACTTCTCCTTCACTTTGCCAAATGCCTCTGAGAACCAGGCCCGGGTCTTGGTCAAAATTTCCTTCTGTTTGAT3 (0.000187%)
CAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGG39 (0.002427%)
CAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTC25 (0.001556%)
CAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGC16 (0.000996%)
CAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGG8 (0.000498%)
CAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGATCCAATAA4 (0.000249%)
CAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACT3 (0.000187%)
CAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTG8 (0.000498%)
CAGTCAGAGTCTCGCTGGCCTTGTCGATCACACTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCTCCAGCGCAGG3 (0.000187%)
CAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACT31 (0.001929%)
CAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTC11 (0.000685%)
CAGTGACATAGTTATGGCCAAGGTACAGCCTGTAGTCCATCCTTGGGGGGACCCTTAACAGCCCAAAGGCAGAATCTTTAAACAGCAGGTCTTTCCCAAG10 (0.000622%)
CAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACTCA13 (0.000809%)
CAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGA45 (0.002800%)
CAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAA8 (0.000498%)
CAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCA81 (0.005041%)
CAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGC17 (0.001058%)
CAGTGTTCTCAGGATCGAATGGCTTCTTCCATTTGCCTTTAAAGAGAATGTAATTTGCCAGGGCGAAAACTGTGTCTTGGTCCAGTTTTTTCACCGCCTC3 (0.000187%)
CAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGT20 (0.001245%)
CAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGAT7 (0.000436%)
CAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCA7 (0.000436%)
CAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAA3 (0.000187%)
CAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAA11 (0.000685%)
CAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACT3 (0.000187%)
CAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCATGGGCAGTTACGATAACATTGTAAATTTGGTCATCTCCTA3 (0.000187%)
CAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCAGAACGACTCGGTT8 (0.000498%)
CATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGG7 (0.000436%)
CATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGA10 (0.000622%)
CATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGGAATGTTG3 (0.000187%)
CATAATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGC30 (0.001867%)
CATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACAC10 (0.000622%)
CATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGA9 (0.000560%)
CATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGC12 (0.000747%)
CATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGT8 (0.000498%)
CATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCT20 (0.001245%)
CATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTC8 (0.000498%)
CATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACA3 (0.000187%)
CATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAG7 (0.000436%)
CATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGC12 (0.000747%)
CATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAA3 (0.000187%)
CATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGG6 (0.000373%)
CATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCC7 (0.000436%)
CATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAAC3 (0.000187%)
CATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGC7 (0.000436%)
CATCCCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATT5 (0.000311%)
CATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCG3 (0.000187%)
CATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGT450 (0.028003%)
CATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAG3 (0.000187%)
CATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTC7 (0.000436%)
CATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTGGAGAGCATA449 (0.027941%)
CATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAG10 (0.000622%)
CATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAAT33 (0.002054%)
CATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTC4 (0.000249%)
CATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTG7 (0.000436%)
CATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCA4 (0.000249%)
CATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACA16 (0.000996%)
CATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTG12 (0.000747%)
CATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTG23 (0.001431%)
CATGACCATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACT15 (0.000933%)
CATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACAT4 (0.000249%)
CATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAG20 (0.001245%)
CATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTC9 (0.000560%)
CATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCT9 (0.000560%)
CATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTC48 (0.002987%)
CATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAG4 (0.000249%)
CATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTA12 (0.000747%)
CATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAA31 (0.001929%)
CATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCT3 (0.000187%)
CATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATA10 (0.000622%)
CATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACAC3 (0.000187%)
CATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAA3 (0.000187%)
CATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAG14 (0.000871%)
CATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAG23 (0.001431%)
CATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTG10 (0.000622%)
CATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCA12 (0.000747%)
CATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTG9 (0.000560%)
CATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTGTGTT17 (0.001058%)
CATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTTTGTT30 (0.001867%)
CATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTG5 (0.000311%)
CATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCG6 (0.000373%)
CATGTGAAATAATTCCAAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCC3 (0.000187%)
CATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTT9 (0.000560%)
CATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATA3 (0.000187%)
CATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGAC7 (0.000436%)
CATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTG10 (0.000622%)
CATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCA11 (0.000685%)
CATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAA12 (0.000747%)
CATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAG11 (0.000685%)
CATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATT6 (0.000373%)
CATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGA7 (0.000436%)
CATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACA6 (0.000373%)
CATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGG4 (0.000249%)
CATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCA12 (0.000747%)
CATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGA18 (0.001120%)
CATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTT5 (0.000311%)
CATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCG3 (0.000187%)
CATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAA4 (0.000249%)
CATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCAC11 (0.000685%)
CATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCAC7 (0.000436%)
CCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCT3 (0.000187%)
CCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCAC12 (0.000747%)
CCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCA14 (0.000871%)
CCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCT5 (0.000311%)
CCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCATGGGCAGTTACGATAACATTGTAAATTTGGTCATCTCCTAAAAGTG3 (0.000187%)
CCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTC30 (0.001867%)
CCAAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCCTCCAGCGGGATCAAAGA5 (0.000311%)
CCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTG7 (0.000436%)
CCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCA7 (0.000436%)
CCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCAT7 (0.000436%)
CCAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCCATACACTACACATCAGA5 (0.000311%)
CCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGA4 (0.000249%)
CCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCG15 (0.000933%)
CCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGT5 (0.000311%)
CCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTTGA3 (0.000187%)
CCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAA13 (0.000809%)
CCAAGACACAGTTTTCGCCCTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTG287 (0.017860%)
CCAAGACTTGACAGAGGCTCCAGGGCGGTTACAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAG124 (0.007716%)
CCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAG18 (0.001120%)
CCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGC25 (0.001556%)
CCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGAC9 (0.000560%)
CCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGA6 (0.000373%)
CCAAGTCCATGACCATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTG23 (0.001431%)
CCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTT15 (0.000933%)
CCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCC3 (0.000187%)
CCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGC9 (0.000560%)
CCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAG31 (0.001929%)
CCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGC4 (0.000249%)
CCAATTCAGAAGGAAGGATGACATCGTAGGGTGGTCATTTATGTGTGGGATCTACCACTTTTCCCACAAAGATGGGGCTCTGAGTGTGTTCTTCAAATAT3 (0.000187%)
CCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACT15 (0.000933%)
CCAATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTC6 (0.000373%)
CCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTG8 (0.000498%)
CCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGA3 (0.000187%)
CCACACCCTTCAGGATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTC14 (0.000871%)
CCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTT3 (0.000187%)
CCACCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCA6 (0.000373%)
CCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTC9 (0.000560%)
CCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGAC7 (0.000436%)
CCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGC6 (0.000373%)
CCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGC7 (0.000436%)
CCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCT8 (0.000498%)
CCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAG4 (0.000249%)
CCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCT13 (0.000809%)
CCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACA3 (0.000187%)
CCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCA15 (0.000933%)
CCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAA7 (0.000436%)
CCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAG5 (0.000311%)
CCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGT18 (0.001120%)
CCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATA5 (0.000311%)
CCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCC5 (0.000311%)
CCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAG14 (0.000871%)
CCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCGG4 (0.000249%)
CCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGAT5 (0.000311%)
CCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGA33 (0.002054%)
CCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAA9 (0.000560%)
CCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTG14 (0.000871%)
CCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAG8 (0.000498%)
CCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGC8 (0.000498%)
CCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATG8 (0.000498%)
CCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCT4 (0.000249%)
CCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATG9 (0.000560%)
CCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTG12 (0.000747%)
CCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAG7 (0.000436%)
CCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAG9 (0.000560%)
CCAGCCCTCACCCCAGAGCAGAAGAAGGAGCTCTCTGAAATTGCCCAGCGCATTGTTGCCAATGGGAAGGGCATCCTGGCTGCAGATGAATCTGTGGGTA5 (0.000311%)
CCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGT26 (0.001618%)
CCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGC9 (0.000560%)
CCAGCCTGTGTTTAATGGAAGGAACCCAATTCAGAAGGAAGGATGACATCGTAGGGTGGTCATTTATGTGTGGGATCTACCACTTTTCCCACAAAGATGG13 (0.000809%)
CCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGA18 (0.001120%)
CCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGC3 (0.000187%)
CCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCC11 (0.000685%)
CCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTG3 (0.000187%)
CCAGCTGTAATCCTTATCATAATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATAGGGC4 (0.000249%)
CCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAA5 (0.000311%)
CCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATG3 (0.000187%)
CCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTG15 (0.000933%)
CCAGGCCAGCCTGTGTTTAATGGAAGGAACCCAATTCAGAAGGAAGGATGACATCGTAGGGTGGTCATTTATGTGTGGGATCTACCACTTTTCCCACAAA7 (0.000436%)
CCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATC10 (0.000622%)
CCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCT7 (0.000436%)
CCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTT19 (0.001182%)
CCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAAC27 (0.001680%)
CCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATT33 (0.002054%)
CCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAG7 (0.000436%)
CCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTACCAGC4 (0.000249%)
CCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGC4 (0.000249%)
CCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAG20 (0.001245%)
CCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGA5 (0.000311%)
CCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGC8 (0.000498%)
CCATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGG57 (0.003547%)
CCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACG3 (0.000187%)
CCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGC6 (0.000373%)
CCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTG3 (0.000187%)
CCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAA9 (0.000560%)
CCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACAC7 (0.000436%)
CCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAG13 (0.000809%)
CCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACC8 (0.000498%)
CCATGACCATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTAC12 (0.000747%)
CCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATA9 (0.000560%)
CCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAA3 (0.000187%)
CCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGA27 (0.001680%)
CCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGC8 (0.000498%)
CCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCCCAGATATAGCA3 (0.000187%)
CCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGC6 (0.000373%)
CCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCT7 (0.000436%)
CCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAA11 (0.000685%)
CCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAAT4 (0.000249%)
CCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTAC5 (0.000311%)
CCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAG3 (0.000187%)
CCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGC8 (0.000498%)
CCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAG22 (0.001369%)
CCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGT4 (0.000249%)
CCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCT18 (0.001120%)
CCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTG79 (0.004916%)
CCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGA56 (0.003485%)
CCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACA7 (0.000436%)
CCCAATTCAGAAGGAAGGATGACATCGTAGGGTGGTCATTTATGTGTGGGATCTACCACTTTTCCCACAAAGATGGGGCTCTGAGTGTGTTCTTCAAATA4 (0.000249%)
CCCACACCCTTCAGGATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGT28 (0.001742%)
CCCACATAGGATGAATATTAGCAATTCTTCCTTACAACCCATCCCTCACTCTACTCAACCTCATAATCTATATTATTCTTACAGCCCCTATATTCATAGC4 (0.000249%)
CCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACA8 (0.000498%)
CCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCAT21 (0.001307%)
CCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCG6 (0.000373%)
CCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGA24 (0.001494%)
CCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAG5 (0.000311%)
CCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGT20 (0.001245%)
CCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCA383 (0.023834%)
CCCAGATCCACTTCCCCAGACTGTCCATCTCTGGAGAATATAACTTGAAGACACTCATGAGTCCACTGGGCATCACCCGGATCTTCAACAATGGGGCTGA220 (0.013690%)
CCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCG14 (0.000871%)
CCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTG25 (0.001556%)
CCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCC5 (0.000311%)
CCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATA4 (0.000249%)
CCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCAT18 (0.001120%)
CCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCG5 (0.000311%)
CCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAA7 (0.000436%)
CCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAA14 (0.000871%)
CCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCA3 (0.000187%)
CCCATCCAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCCATACACTACACA315 (0.019602%)
CCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAA20 (0.001245%)
CCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAA4 (0.000249%)
CCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAG13 (0.000809%)
CCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAG7 (0.000436%)
CCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATG6 (0.000373%)
CCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCT11 (0.000685%)
CCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGAC44 (0.002738%)
CCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGG3 (0.000187%)
CCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTT41 (0.002551%)
CCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAA16 (0.000996%)
CCCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAAC5 (0.000311%)
CCCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAG6 (0.000373%)
CCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTAT6 (0.000373%)
CCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGG11 (0.000685%)
CCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTA32 (0.001991%)
CCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCA25 (0.001556%)
CCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACC3 (0.000187%)
CCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACA13 (0.000809%)
CCCTATTTATCTTATTTCAACTAAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGA5 (0.000311%)
CCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTT3 (0.000187%)
CCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGT25 (0.001556%)
CCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATG4 (0.000249%)
CCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCC4 (0.000249%)
CCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGC20 (0.001245%)
CCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATC3 (0.000187%)
CCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATAT35 (0.002178%)
CCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATT12 (0.000747%)
CCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAG6 (0.000373%)
CCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCA4 (0.000249%)
CCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGA24 (0.001494%)
CCGAATGGCAGTGACATAGTTATGGCCAAGGTACAGCCTGTAGTCCATCCTTGGGGGGACCCTTAACAGCCCAAAGGCAGAATCTTTAAACAGCAGGTCT3 (0.000187%)
CCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCAC115 (0.007156%)
CCGACCTCAGGCAGCTCATGGACAATGAGGTGTTGATGGCCTTTACCTCCTATGCAACGATCATTCTTACCAAGATGATGTTCATGAGCTCTGCGACCGC7 (0.000436%)
CCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAG24 (0.001494%)
CCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAG17 (0.001058%)
CCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGT5 (0.000311%)
CCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGC7 (0.000436%)
CCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCT12 (0.000747%)
CCGATTAGGTGTATTAATAAGTGTCCTGCAGTAATGTTAGCTGTAAGCCGGACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAA7 (0.000436%)
CCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGAT44 (0.002738%)
CCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTAC23 (0.001431%)
CCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAA14 (0.000871%)
CCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTAC19 (0.001182%)
CCGCCAGGTGCTCAGGAGAACGTGGTCTTCAACTTCTCCTTCACTTTGCCAAATGCCTCTGAGAACCAGGCCCGGGTCTTGGTCAAAATTTCCTTCTGTT13 (0.000809%)
CCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGC29 (0.001805%)
CCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGC13 (0.000809%)
CCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCC6 (0.000373%)
CCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGA35 (0.002178%)
CCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGT54 (0.003360%)
CCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTAC5 (0.000311%)
CCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGG11 (0.000685%)
CCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGC5 (0.000311%)
CCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAA24 (0.001494%)
CCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGG14 (0.000871%)
CCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGAC13 (0.000809%)
CCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAG39 (0.002427%)
CCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGC6 (0.000373%)
CCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGT4 (0.000249%)
CCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTG9 (0.000560%)
CCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATT5 (0.000311%)
CCTACATGGTTTTGGATTAAGATGAGGGCAATTAGCAGTGGAATAGAACCGATTAGGGTATAAAATAGGAAATAAATCCCTGCGTTTAGGCGTTCAGTTT5 (0.000311%)
CCTACCAATACCACACCCATTAATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCCATTCTATGATCAGGATGA3 (0.000187%)
CCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCC3 (0.000187%)
CCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTAT8 (0.000498%)
CCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTC9 (0.000560%)
CCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCA4 (0.000249%)
CCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTG9 (0.000560%)
CCTAGGCCATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACG35 (0.002178%)
CCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGAC5 (0.000311%)
CCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCT3 (0.000187%)
CCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAA12 (0.000747%)
CCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTT14 (0.000871%)
CCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCA6 (0.000373%)
CCTATTTATCTTATTTCAACTAAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAA11 (0.000685%)
CCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCA36 (0.002240%)
CCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTA9 (0.000560%)
CCTCACAATATATCAATGATGACGAGACGTAATTCGTGAAGGAACCTACCAAGGCCACCACACTCCTATTGTACAAAAAGGACTACGATATGGTATAATT125 (0.007779%)
CCTCACCCCAGAGCAGAAGAAGGAGCTCTCTGAAATTGCCCAGCGCATTGTTGCCAATGGGAAGGGCATCCTGGCTGCAGATGAATCTGTGGGTACCATG3 (0.000187%)
CCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAG25 (0.001556%)
CCTCACTGGGCAGTCAGAGTCTCGCTGGCCTTGTCGATCACACTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCT13 (0.000809%)
CCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACA45 (0.002800%)
CCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTTGTGGA4 (0.000249%)
CCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTG7 (0.000436%)
CCTCAGTGTTCTCAGGATCGAATGGCTTCTTCCATTTGCCTTTAAAGAGAATGTAATTTGCCAGGGCGAAAACTGTGTCTTGGTCCAGTTTTTTCACCGC6 (0.000373%)
CCTCATGGAAGGACGTAGCCTATAAATGCTGTGGCTATGACTGCGAACAGTAGAAGTACTCCAATGTTTCAGGTTTCTATAAATGTATATGATCCATAAT3 (0.000187%)
CCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATC4 (0.000249%)
CCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGAC5 (0.000311%)
CCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTC25 (0.001556%)
CCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTG3 (0.000187%)
CCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTA4 (0.000249%)
CCTCCTCTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATC5 (0.000311%)
CCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGA7 (0.000436%)
CCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGC12 (0.000747%)
CCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCG7 (0.000436%)
CCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTC13 (0.000809%)
CCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGAT71 (0.004418%)
CCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATAC3 (0.000187%)
CCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAA11 (0.000685%)
CCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAG3 (0.000187%)
CCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTAT4 (0.000249%)
CCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGC6 (0.000373%)
CCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCT100 (0.006223%)
CCTGAACTGGCCGTCTTGTTTCAGGATGTGGAAGTCACAGTCTCCCTCCACCGCGTGCTCAGTCAGCTGCCTCACAGAACAGTTTGCCAGCGGGGTGGGG117 (0.007281%)
CCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACT20 (0.001245%)
CCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCT10 (0.000622%)
CCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTT25 (0.001556%)
CCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGA38 (0.002365%)
CCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCA29 (0.001805%)
CCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGAT16 (0.000996%)
CCTGCAAAGAAAAATACTTCCGAGACGATGAATAGAATTATACCATATCGTAGTCCTTTTTGTACAATAGGAGTGTGGTGGCCTTGGTAGGTTCCTTCAC3 (0.000187%)
CCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCCCAAATCATT3 (0.000187%)
CCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGA13 (0.000809%)
CCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAA3 (0.000187%)
CCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCT4 (0.000249%)
CCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGT3 (0.000187%)
CCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGT6 (0.000373%)
CCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTC681 (0.042378%)
CCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACAT11 (0.000685%)
CCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGG13 (0.000809%)
CCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTG18 (0.001120%)
CCTGGGATGGCATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCA3 (0.000187%)
CCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAG18 (0.001120%)
CCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACA5 (0.000311%)
CCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGC6 (0.000373%)
CCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTT13 (0.000809%)
CCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATC8 (0.000498%)
CCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGT5 (0.000311%)
CCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAG47 (0.002925%)
CCTGTGTTTAATGGAAGGAACCCAATTCAGAAGGAAGGATGACATCGTAGGGTGGTCATTTATGTGTGGGATCTACCACTTTTCCCACAAAGATGGGGCT4 (0.000249%)
CCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTT14 (0.000871%)
CCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTT6 (0.000373%)
CCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTT10 (0.000622%)
CCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTA3 (0.000187%)
CCTTATCATAATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATAGGGCACCAATGATAC12 (0.000747%)
CCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAG11 (0.000685%)
CCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGA37 (0.002302%)
CCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGC20 (0.001245%)
CCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCGGCTTACA3 (0.000187%)
CCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGC5 (0.000311%)
CCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGA16 (0.000996%)
CCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCAC17 (0.001058%)
CCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGC7 (0.000436%)
CCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACT7 (0.000436%)
CCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAAC26 (0.001618%)
CCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGA9 (0.000560%)
CCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGAC4 (0.000249%)
CCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAG10 (0.000622%)
CCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACT8 (0.000498%)
CCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAAT7 (0.000436%)
CCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGC8 (0.000498%)
CGAAACCACATAAATCAAGCCCTACTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTT19 (0.001182%)
CGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAA11 (0.000685%)
CGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACG25 (0.001556%)
CGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAA6 (0.000373%)
CGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACC434 (0.027008%)
CGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAG96 (0.005974%)
CGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCT6 (0.000373%)
CGAATGGCAGTGACATAGTTATGGCCAAGGTACAGCCTGTAGTCCATCCTTGGGGGGACCCTTAACAGCCCAAAGGCAGAATCTTTAAACAGCAGGTCTT4 (0.000249%)
CGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCA27 (0.001680%)
CGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACC39 (0.002427%)
CGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACA21 (0.001307%)
CGACCTCAGGCAGCTCATGGACAATGAGGTGTTGATGGCCTTTACCTCCTATGCAACGATCATTCTTACCAAGATGATGTTCATGAGCTCTGCGACCGCA4 (0.000249%)
CGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTA39 (0.002427%)
CGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCT103 (0.006410%)
CGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGC10 (0.000622%)
CGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGA25 (0.001556%)
CGAGACGTAAATTACGGGTGACTAATCCGATATATACACGCAAACGGAGCCTCAATATTTTTTATTTGCTTATTCCTTCATGTCGGACGAGGCTTATATT3 (0.000187%)
CGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTT51 (0.003174%)
CGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCA27 (0.001680%)
CGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAG3 (0.000187%)
CGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGAC41 (0.002551%)
CGATCACACTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCTCCAGCGCAGGTCTGGCTTTCTCGCCAAGTGTCTT8 (0.000498%)
CGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACAC10 (0.000622%)
CGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAG9 (0.000560%)
CGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTT16 (0.000996%)
CGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCT27 (0.001680%)
CGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGG6 (0.000373%)
CGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTC11 (0.000685%)
CGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCA80 (0.004978%)
CGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGC7 (0.000436%)
CGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATG14 (0.000871%)
CGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGA3 (0.000187%)
CGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCC5 (0.000311%)
CGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATAC21 (0.001307%)
CGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATT21 (0.001307%)
CGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGG83 (0.005165%)
CGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACC30 (0.001867%)
CGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGC16 (0.000996%)
CGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCT49 (0.003049%)
CGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATG16 (0.000996%)
CGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTC8 (0.000498%)
CGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTACCAGCATCTGTTCTGA12 (0.000747%)
CGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGAGTCGGTTGCGTAGATCCT3 (0.000187%)
CGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACT6 (0.000373%)
CGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAAC15 (0.000933%)
CGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGAGTCGGTTGC6 (0.000373%)
CGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACA52 (0.003236%)
CGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGG52 (0.003236%)
CGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTAC13 (0.000809%)
CGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTG8 (0.000498%)
CGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCC229 (0.014251%)
CGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAG10 (0.000622%)
CGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCA12 (0.000747%)
CGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCC9 (0.000560%)
CGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCC11 (0.000685%)
CGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGC3 (0.000187%)
CGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCC11 (0.000685%)
CGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCT4 (0.000249%)
CGCCTTCCTGCTGATTCCGAATGGCAGTGACATAGTTATGGCCAAGGTACAGCCTGTAGTCCATCCTTGGGGGGACCCTTAACAGCCCAAAGGCAGAATC240 (0.014935%)
CGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGAT250 (0.015557%)
CGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCAC22 (0.001369%)
CGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGG28 (0.001742%)
CGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCG20 (0.001245%)
CGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGG33 (0.002054%)
CGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTG13 (0.000809%)
CGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGA45 (0.002800%)
CGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGC8 (0.000498%)
CGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAG8 (0.000498%)
CGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAA12 (0.000747%)
CGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGC9 (0.000560%)
CGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTG10 (0.000622%)
CGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTGGAGAGCATACCG19 (0.001182%)
CGCTGGCCTTGTCGATCACACTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCTCCAGCGCAGGTCTGGCTTTCTC5 (0.000311%)
CGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTA10 (0.000622%)
CGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAGGTCTGCAGGCTGGGTC3 (0.000187%)
CGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCA26 (0.001618%)
CGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGAGTC11 (0.000685%)
CGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACC158 (0.009832%)
CGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAG41 (0.002551%)
CGGAAGCCTGTAATTACGGCTCCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTA16 (0.000996%)
CGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCAT10 (0.000622%)
CGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGC6 (0.000373%)
CGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAA15 (0.000933%)
CGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAAGTTGCCATTATCTTC16 (0.000996%)
CGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTC16 (0.000996%)
CGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAAT11 (0.000685%)
CGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGC66 (0.004107%)
CGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGC6 (0.000373%)
CGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGAC148 (0.009210%)
CGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAA28 (0.001742%)
CGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTT63 (0.003920%)
CGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAG105 (0.006534%)
CGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCG12 (0.000747%)
CGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGA75 (0.004667%)
CGGCTATATAGGAATAGTATGAGCAATAATGTCTATTGGCTTTCTAGGCTTTATTGTATGAGCCCACCACATATTCACAGTAGGATTAGATGTAGACACA299 (0.018607%)
CGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGG269 (0.016740%)
CGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAAC28 (0.001742%)
CGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGC9 (0.000560%)
CGGGCACCTCACTGGGCAGTCAGAGTCTCGCTGGCCTTGTCGATCACACTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCA57 (0.003547%)
CGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTG21 (0.001307%)
CGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGT180 (0.011201%)
CGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTT72 (0.004481%)
CGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAA21 (0.001307%)
CGGGTGACTAATCCGATATATACACGCAAACGGAGCCTCAATATTTTTTATTTGCTTATTCCTTCATGTCGGACGAGGCTTATATTATGGATCATATACA12 (0.000747%)
CGGTTACAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGA11 (0.000685%)
CGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCT3 (0.000187%)
CGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAG6 (0.000373%)
CGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTG3 (0.000187%)
CGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTC10 (0.000622%)
CGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCCCA15 (0.000933%)
CGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGA11 (0.000685%)
CGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTT5 (0.000311%)
CGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAAC3 (0.000187%)
CGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCT5 (0.000311%)
CGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCA6 (0.000373%)
CGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGAT3 (0.000187%)
CGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCAT5 (0.000311%)
CGTCTACAAAATGTCAGTATCATGCTGCGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAA5 (0.000311%)
CGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGC7 (0.000436%)
CGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATC104 (0.006472%)
CGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCAC6 (0.000373%)
CGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGG5 (0.000311%)
CGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCG8 (0.000498%)
CGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTG5 (0.000311%)
CGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCC14 (0.000871%)
CGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCA5 (0.000311%)
CGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATC7 (0.000436%)
CGTGGATGTCCTTGATGCTTCGAGGTGGCCCGCCAGGTGCTCAGGAGAACGTGGTCTTCAACTTCTCCTTCACTTTGCCAAATGCCTCTGAGAACCAGGC388 (0.024145%)
CGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTG9 (0.000560%)
CGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTA5 (0.000311%)
CGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGA25 (0.001556%)
CGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGG16 (0.000996%)
CGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGC33 (0.002054%)
CGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTG17 (0.001058%)
CTAAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCT13 (0.000809%)
CTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGATGACGAG7 (0.000436%)
CTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGA13 (0.000809%)
CTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCA16 (0.000996%)
CTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTT31 (0.001929%)
CTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCG20 (0.001245%)
CTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAA146 (0.009085%)
CTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAA7 (0.000436%)
CTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAAG5 (0.000311%)
CTAATTAGTTTAACCAGCCTAACACTTCTATGACAAACCGACGAAAATTATAAAAACTTTTCAAATATATTCTCCTCAGACCCCCTATCCACACCATTAA94 (0.005850%)
CTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTC4 (0.000249%)
CTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGAT13 (0.000809%)
CTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTC14 (0.000871%)
CTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGG34 (0.002116%)
CTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGGAGTAGTAAGTAACTACATGTGAAATAATTCCAAA14 (0.001289%)
CTACATGTGAAATAATTCCAAATCCTGGGAGGATAAGAATATAAACTTCTGGGTGCCCAAAGAATCAGAACAGATGCTGGTAGAGAATTGGGTCCCCTCC9 (0.000560%)
CTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCC5 (0.000311%)
CTACCAGCTGTAATCCTTATCATAATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATAG8 (0.000498%)
CTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGA6 (0.000373%)
CTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAGGTCTGCAGGCTGG13 (0.000809%)
CTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCA18 (0.001120%)
CTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGGAAGGTCTGCAGGC254 (0.015806%)
CTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAA6 (0.000373%)
CTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACC37 (0.002302%)
CTAGAAGTACTGAAGTATTAAGTAGTGGGACTTCTAGAGGGTTAAGTGGTGAAATTCCTGTTGGAGGTCAGCAGCCTCCTAGATCATGTGTTGGTACGAG3 (0.000187%)
CTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTC163 (0.010143%)
CTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCA15 (0.000933%)
CTAGAGGGTTAAGTGGTGAAATTCCTGTTGGAGGTCAGCAGCCTCCTAGATCATGTGTTGGTACGAGGCTAGAATGATAGAACGCTCAGAAGAATCCTGC10 (0.000622%)
CTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCAC6 (0.000373%)
CTAGCATTAAGTCTATGAGTTCCCCTACCAATACCACACCCATTAATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTT101 (0.006285%)
CTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTA15 (0.000933%)
CTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTACCAGCATCTGT12 (0.000747%)
CTAGCGGTGGCCAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCT17 (0.001058%)
CTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGC8 (0.000498%)
CTAGGCCATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGG212 (0.013193%)
CTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACC14 (0.000871%)
CTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCC25 (0.001556%)
CTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGC5 (0.000311%)
CTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCAGAACGACTCGGTTATCAACTTCTAG5 (0.000311%)
CTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTAC15 (0.000933%)
CTAGGGTTATGAGAATTAAGAATATGATTAGGATACCTAGGATATCTTTGATTGTATAGTAGGGGTGAAATGGAATTTTATCTGCATCTGAGTTTAATCC5 (0.000311%)
CTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAG21 (0.001307%)
CTAGTATGTCTGGGAAAAATAATACTAGGGTTATGAGAATTAAGAATATGATTAGGATACCTAGGATATCTTTGATTGTATAGTAGGGGTGAAATGGAAT14 (0.000871%)
CTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTG14 (0.000871%)
CTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGGAATGTTGATGATAG9 (0.000560%)
CTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTC31 (0.001929%)
CTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACC13 (0.000809%)
CTATATCTGGGGCTCCGATTATTAGTGGGACAAGTCAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCATGGGC5 (0.000311%)
CTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGAC5 (0.000311%)
CTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCC12 (0.000747%)
CTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGG15 (0.000933%)
CTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATAC7 (0.000436%)
CTATGAGTTCCCCTACCAATACCACACCCATTAATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCCATTCTAT3 (0.000187%)
CTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTCAGAC8 (0.000498%)
CTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTT23 (0.001431%)
CTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCA11 (0.000685%)
CTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAG36 (0.002240%)
CTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAA25 (0.001556%)
CTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCT5 (0.000311%)
CTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAAC5 (0.000311%)
CTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAA12 (0.000747%)
CTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTT8 (0.000498%)
CTATTCTACCAGCTGTAATCCTTATCATAATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAAC5 (0.000311%)
CTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAA6 (0.000373%)
CTCAAATATGGTTGTGTGCTTGACAAAGGCCACATCCCCACCGCCATCTTTCAGACACTTGAATGCGCCTACGTAGCCAAAGAATGGTTGAGTGGAGGAG22 (0.001369%)
CTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAG9 (0.000560%)
CTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTAT14 (0.000871%)
CTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTTG9 (0.000560%)
CTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGAC7 (0.000436%)
CTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGC57 (0.003547%)
CTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGC14 (0.000871%)
CTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGC13 (0.000809%)
CTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGT9 (0.000560%)
CTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTA44 (0.002738%)
CTCACTGGGCAGTCAGAGTCTCGCTGGCCTTGTCGATCACACTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCTC9 (0.000560%)
CTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAAC15 (0.000933%)
CTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTG42 (0.002614%)
CTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTA18 (0.001120%)
CTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCT57 (0.003547%)
CTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAG8 (0.000498%)
CTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAG19 (0.001182%)
CTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCA99 (0.006161%)
CTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACA146 (0.009085%)
CTCAGGATCGAATGGCTTCTTCCATTTGCCTTTAAAGAGAATGTAATTTGCCAGGGCGAAAACTGTGTCTTGGTCCAGTTTTTTCACCGCCTCAGCTATC8 (0.000498%)
CTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTC112 (0.006970%)
CTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGT49 (0.003049%)
CTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCCACT12 (0.000747%)
CTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCAC5 (0.000311%)
CTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCT6 (0.000373%)
CTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATC37 (0.002302%)
CTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACT15 (0.000933%)
CTCATGGAAGGACGTAGCCTATAAATGCTGTGGCTATGACTGCGAACAGTAGAAGTACTCCAATGTTTCAGGTTTCTATAAATGTATATGATCCATAATA5 (0.000311%)
CTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAA26 (0.001618%)
CTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTC9 (0.000560%)
CTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGG6 (0.000373%)
CTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATG3 (0.000187%)
CTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGG40 (0.002489%)
CTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCC16 (0.000996%)
CTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTG111 (0.006907%)
CTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCA26 (0.001618%)
CTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACA4 (0.000249%)
CTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCC28 (0.001742%)
CTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGC5 (0.000311%)
CTCCAGGGCGGTTACAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAA4 (0.000249%)
CTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAA53 (0.003298%)
CTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGC34 (0.002116%)
CTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCA16 (0.000996%)
CTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATA9 (0.000560%)
CTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATG33 (0.002054%)
CTCCGATTAGGTGTATTAATAAGTGTCCTGCAGTAATGTTAGCTGTAAGCCGGACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAAT31 (0.001929%)
CTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTG3 (0.000187%)
CTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGC19 (0.001182%)
CTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAG9 (0.000560%)
CTCCTAGTATGTCTGGGAAAAATAATACTAGGGTTATGAGAATTAAGAATATGATTAGGATACCTAGGATATCTTTGATTGTATAGTAGGGGTGAAATGG6 (0.000373%)
CTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACC6 (0.000373%)
CTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCC3 (0.000187%)
CTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTAC15 (0.000933%)
CTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCC17 (0.001058%)
CTCCTCTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCC14 (0.000871%)
CTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGA33 (0.002054%)
CTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGAT3 (0.000187%)
CTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCT19 (0.001182%)
CTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCA106 (0.006596%)
CTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCT77 (0.004792%)
CTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAAT17 (0.001058%)
CTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGC17 (0.001058%)
CTCGCTGGCCTTGTCGATCACACTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCTCCAGCGCAGGTCTGGCTTTC3 (0.000187%)
CTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGC745 (0.046361%)
CTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCG17 (0.001058%)
CTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTG24 (0.001494%)
CTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCT23 (0.001431%)
CTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCT3 (0.000187%)
CTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCT47 (0.002925%)
CTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAA22 (0.001369%)
CTCTAGCGGTGGCCAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTG12 (0.000747%)
CTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCA7 (0.000436%)
CTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCG4 (0.000249%)
CTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATA14 (0.000871%)
CTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGC24 (0.001494%)
CTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACT12 (0.000747%)
CTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGAT35 (0.002178%)
CTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAA25 (0.001556%)
CTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGG34 (0.002116%)
CTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAA12 (0.000747%)
CTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCA6 (0.000373%)
CTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAG68 (0.004232%)
CTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAA4 (0.000249%)
CTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGT16 (0.000996%)
CTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTGTATGT14 (0.000871%)
CTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGG28 (0.001742%)
CTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTT23 (0.001431%)
CTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTC25 (0.001556%)
CTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTGGAGAGCATACCGGA3 (0.000187%)
CTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACAC4 (0.000249%)
CTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCA7 (0.000436%)
CTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACT12 (0.000747%)
CTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATG12 (0.000747%)
CTGAAAATAATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATC3 (0.000187%)
CTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCC35 (0.002178%)
CTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTG141 (0.008774%)
CTGAACTGGCCGTCTTGTTTCAGGATGTGGAAGTCACAGTCTCCCTCCACCGCGTGCTCAGTCAGCTGCCTCACAGAACAGTTTGCCAGCGGGGTGGGGT10 (0.000622%)
CTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCA24 (0.001494%)
CTGAAGTATTAAGTAGTGGGACTTCTAGAGGGTTAAGTGGTGAAATTCCTGTTGGAGGTCAGCAGCCTCCTAGATCATGTGTTGGTACGAGGCTAGAATG5 (0.000311%)
CTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCT86 (0.005352%)
CTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCA5 (0.000311%)
CTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAA17 (0.001058%)
CTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCT5 (0.000311%)
CTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTA52 (0.003236%)
CTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTA10 (0.000622%)
CTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAA74 (0.004605%)
CTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTG128 (0.011789%)
CTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGA21 (0.001307%)
CTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGA27 (0.001680%)
CTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCC114 (0.007094%)
CTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTC90 (0.005601%)
CTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGT24 (0.001494%)
CTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGG37 (0.002302%)
CTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATC5 (0.000311%)
CTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTC10 (0.000622%)
CTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATA95 (0.005912%)
CTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGA29 (0.001805%)
CTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTA81 (0.005041%)
CTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCA12 (0.000747%)
CTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGAC13 (0.000809%)
CTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACT57 (0.003547%)
CTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACT30 (0.001867%)
CTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGA56 (0.003485%)
CTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTG35 (0.002178%)
CTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCAC15 (0.000933%)
CTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATG14 (0.000871%)
CTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGA13 (0.000809%)
CTGCAAAGAAAAATACTTCCGAGACGATGAATAGAATTATACCATATCGTAGTCCTTTTTGTACAATAGGAGTGTGGTGGCCTTGGTAGGTTCCTTCACG4 (0.000249%)
CTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCT16 (0.000996%)
CTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGG31 (0.001929%)
CTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCG16 (0.000996%)
CTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATG138 (0.008588%)
CTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATA20 (0.001245%)
CTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACT11 (0.000685%)
CTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGT12 (0.000747%)
CTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTG13 (0.000809%)
CTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTG3 (0.000187%)
CTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTG15 (0.000933%)
CTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACT5 (0.000311%)
CTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCC29 (0.001805%)
CTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAA12 (0.000747%)
CTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGC5 (0.000311%)
CTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAA8 (0.000498%)
CTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCA26 (0.001618%)
CTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGC32 (0.001991%)
CTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAG25 (0.001556%)
CTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATC14 (0.000871%)
CTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTG25 (0.001556%)
CTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGA17 (0.001058%)
CTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATT40 (0.002489%)
CTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTC25 (0.001556%)
CTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTG595 (0.037026%)
CTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAG25 (0.001556%)
CTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACA5 (0.000311%)
CTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTC5 (0.000311%)
CTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCAGAACGACTCGGTTATCAACTTCTAGCAGTCGTAGTTC8 (0.000498%)
CTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGG3 (0.000187%)
CTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTC6 (0.000373%)
CTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCA49 (0.003049%)
CTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAG5 (0.000311%)
CTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTA10 (0.000622%)
CTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATG18 (0.001120%)
CTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCAC13 (0.000809%)
CTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGA15 (0.000933%)
CTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCC27 (0.001680%)
CTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTCC3 (0.000187%)
CTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAA16 (0.000996%)
CTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGG5 (0.000311%)
CTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGT110 (0.006845%)
CTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGT68 (0.004232%)
CTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCTCCAGCGCAGGTCTGGCTTTCTCGCCAAGTGTCTTCAGGTGGGTT20 (0.001245%)
CTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTT19 (0.001182%)
CTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAG12 (0.000747%)
CTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCT7 (0.000436%)
CTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATC16 (0.000996%)
CTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCT20 (0.001245%)
CTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGC36 (0.002240%)
CTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGG74 (0.004605%)
CTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTA11 (0.000685%)
CTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCC359 (0.022340%)
CTGGCCTTGTCGATCACACTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCTCCAGCGCAGGTCTGGCTTTCTCGC4 (0.000249%)
CTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTC37 (0.002302%)
CTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATC8 (0.000498%)
CTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCT36 (0.002240%)
CTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGG20 (0.001245%)
CTGGCTTCCTGCAGTGCGATGAGGACGAAGGCTGTGAGTGACACATCTGCCTCCTTGGCGTTCCGGAAGCCACCAATCATTTCTTGGTGAATCACGGGCC10 (0.000622%)
CTGGGAAAAATAATACTAGGGTTATGAGAATTAAGAATATGATTAGGATACCTAGGATATCTTTGATTGTATAGTAGGGGTGAAATGGAATTTTATCTGC3 (0.000187%)
CTGGGATGGCATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCAG16 (0.000996%)
CTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGT25 (0.001556%)
CTGGGCAGTCAGAGTCTCGCTGGCCTTGTCGATCACACTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCTCCAGC3 (0.000187%)
CTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCC34 (0.002116%)
CTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGAC49 (0.003049%)
CTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAG18 (0.001120%)
CTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCA18 (0.001120%)
CTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCC16 (0.000996%)
CTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGA17 (0.001058%)
CTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCA23 (0.001431%)
CTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTT69 (0.004294%)
CTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTT32 (0.001991%)
CTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTG37 (0.002302%)
CTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGC19 (0.001182%)
CTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATA5 (0.000311%)
CTGGGTCTCCTAGTATGTCTGGGAAAAATAATACTAGGGTTATGAGAATTAAGAATATGATTAGGATACCTAGGATATCTTTGATTGTATAGTAGGGGTG20 (0.001245%)
CTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCT6 (0.000373%)
CTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACA18 (0.001120%)
CTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTG19 (0.001182%)
CTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTA46 (0.002863%)
CTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTGTATGTGG5 (0.000311%)
CTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGG14 (0.000871%)
CTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCT42 (0.002614%)
CTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGC6 (0.000373%)
CTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTT95 (0.005912%)
CTGTAATCCTTATCATAATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATAGGGCACCA9 (0.000560%)
CTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATG7 (0.000436%)
CTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTC36 (0.002240%)
CTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGC36 (0.002240%)
CTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGG10 (0.000622%)
CTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACAC4 (0.000249%)
CTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGG25 (0.001556%)
CTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATG65 (0.004045%)
CTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGC18 (0.001120%)
CTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTC11 (0.000685%)
CTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAA12 (0.000747%)
CTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTT139 (0.008650%)
CTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGG4 (0.000249%)
CTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGA7 (0.000436%)
CTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTA12 (0.000747%)
CTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTG4 (0.000249%)
CTGTTCCTAGGCCATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGC492 (0.030617%)
CTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGT5 (0.000311%)
CTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTG5 (0.000311%)
CTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTC12 (0.000747%)
CTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGA4 (0.000249%)
CTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCT11 (0.000685%)
CTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGC113 (0.007032%)
CTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAA20 (0.001245%)
CTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCG29 (0.001805%)
CTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTT8 (0.000498%)
CTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCA57 (0.003547%)
CTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCA11 (0.000685%)
CTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATATTCTGTGACGTAT21 (0.001307%)
CTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTG120 (0.007468%)
CTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATC10 (0.000622%)
CTTATTTCAACTAAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGA11 (0.000685%)
CTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATAT38 (0.002365%)
CTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCAT119 (0.007405%)
CTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTC63 (0.003920%)
CTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGT68 (0.004232%)
CTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAA95 (0.005912%)
CTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGA52 (0.003236%)
CTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCT99 (0.006161%)
CTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTAT27 (0.001680%)
CTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCG13 (0.000809%)
CTTCAGGATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGG9 (0.000560%)
CTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATA4 (0.000249%)
CTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTT33 (0.002054%)
CTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAG39 (0.002427%)
CTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCGGCTTACAG5 (0.000311%)
CTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACAC66 (0.004107%)
CTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCG27 (0.001680%)
CTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGG3 (0.000187%)
CTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCA54 (0.003360%)
CTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTC11 (0.000685%)
CTTCCTCAGTGTTCTCAGGATCGAATGGCTTCTTCCATTTGCCTTTAAAGAGAATGTAATTTGCCAGGGCGAAAACTGTGTCTTGGTCCAGTTTTTTCAC5 (0.000311%)
CTTCCTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTC7 (0.000436%)
CTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAA21 (0.001307%)
CTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGG44 (0.002738%)
CTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTCCGGCTT18 (0.001120%)
CTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGAT25 (0.001556%)
CTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCT44 (0.002738%)
CTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAA29 (0.001805%)
CTTCTAGAGGGTTAAGTGGTGAAATTCCTGTTGGAGGTCAGCAGCCTCCTAGATCATGTGTTGGTACGAGGCTAGAATGATAGAACGCTCAGAAGAATCC8 (0.000498%)
CTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTCCTGGTGAGAAGTCTCC4 (0.000249%)
CTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCC10 (0.000622%)
CTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATT51 (0.003174%)
CTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTG4 (0.000249%)
CTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAG148 (0.009210%)
CTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATG9 (0.000560%)
CTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCA54 (0.003360%)
CTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGG6 (0.000373%)
CTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGG26 (0.001618%)
CTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAG75 (0.004667%)
CTTGACAAAGGCCACATCCCCACCGCCATCTTTCAGACACTTGAATGCGCCTACGTAGCCAAAGAATGGTTGAGTGGAGGAGCAGCCACAGCCTGGGCAC5 (0.000311%)
CTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACT9 (0.000560%)
CTTGACGACTGCCTTGACTTTTTCCCCAGTCATGGTCTCCAGTTCGCACTCCTCCCCCAGGGTGAACTCATTGCGGACCACTTTGGGTCCATAGGTGATG10 (0.000622%)
CTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGT16 (0.000996%)
CTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGC11 (0.000685%)
CTTGATGCTTCGAGGTGGCCCGCCAGGTGCTCAGGAGAACGTGGTCTTCAACTTCTCCTTCACTTTGCCAAATGCCTCTGAGAACCAGGCCCGGGTCTTG12 (0.000747%)
CTTGATTTAGTCGGCCTGGGATGGCATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGG22 (0.001369%)
CTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCC55 (0.003423%)
CTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTC33 (0.002054%)
CTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGT59 (0.003672%)
CTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGG17 (0.001058%)
CTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAG10 (0.000622%)
CTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAG15 (0.000933%)
CTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCA7 (0.000436%)
CTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGT17 (0.001058%)
CTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCA158 (0.009832%)
CTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTTGCTGACAAAACAGAAAAGGCTGGTGAATAT6 (0.000373%)
CTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAA36 (0.002240%)
CTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCT19 (0.001182%)
CTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTA54 (0.003360%)
CTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGGTCATTG16 (0.000996%)
CTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCTCCAGCGCAGGTCTGGCTTTCTCGCCAAGTGTCTTCAGGTGGGTTTTGGC16 (0.000996%)
CTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCT17 (0.001058%)
CTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCA25 (0.001556%)
CTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGG26 (0.001618%)
CTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCT34 (0.002116%)
CTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCC11 (0.000685%)
CTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAA38 (0.002365%)
CTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACT35 (0.002178%)
CTTGTCGATCACACTCTGGACTTGGGTCTTAAGCGTCTCCAGCATGGGCATCAGACTATGGCGCAGGTCCTCCAGCGCAGGTCTGGCTTTCTCGCCAAGT10 (0.000622%)
CTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTCGGAAGCCTGTAATTACGGCTCCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGA3 (0.000187%)
CTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATC63 (0.003920%)
CTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACA12 (0.000747%)
CTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGG8 (0.000498%)
CTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTC48 (0.002987%)
CTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAG40 (0.002489%)
CTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGA113 (0.007032%)
CTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCCGAATTATCTATGGTT23 (0.001431%)
CTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACC23 (0.001431%)
CTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCAT22 (0.001369%)
CTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAG6 (0.000373%)
CTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGT59 (0.003672%)
CTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGG57 (0.003547%)
CTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGG72 (0.004481%)
CTTTCTAGGCTTTATTGTATGAGCCCACCACATATTCACAGTAGGATTAGATGTAGACACACGAGCTTACTTTACATCAGCCACTATAATTATCGCAATT7 (0.000436%)
CTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTC36 (0.002240%)
CTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTG31 (0.001929%)
CTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGC32 (0.001991%)
CTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGGTC41 (0.002551%)
CTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAA6 (0.000373%)
CTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTA31 (0.001929%)
CTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTT11 (0.000685%)
CTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCAT82 (0.005103%)
CTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGG52 (0.003236%)
CTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGC128 (0.007965%)
CTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAA58 (0.003609%)
CTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAA14 (0.000871%)
CTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCG46 (0.002863%)