fastp report
General
fastp version:0.23.1 (https://github.com/OpenGene/fastp)
sequencing:paired end (150 cycles + 150 cycles)
mean length before filtering:150bp, 150bp
mean length after filtering:143bp, 143bp
duplication rate:26.712159%
Insert size peak:263
Before filtering
total reads:41.576168 M
total bases:6.236425 G
Q20 bases:6.118344 G (98.106583%)
Q30 bases:5.905133 G (94.687783%)
GC content:49.483507%
After filtering
total reads:41.340254 M
total bases:5.947931 G
Q20 bases:5.859157 G (98.507492%)
Q30 bases:5.661366 G (95.182115%)
GC content:49.398333%
Filtering result
reads passed filters:41.340254 M (99.432574%)
reads with low quality:185.780000 K (0.446843%)
reads with too many N:29.754000 K (0.071565%)
reads too short:20.380000 K (0.049018%)
Adapter or bad ligation of read1
The input has little adapter percentage (~0.818534%), probably it's trimmed before.
SequenceOccurrences
A14693
AG15504
AGA15744
AGAT15512
AGATC14458
AGATCG15356
AGATCGG14137
AGATCGGA12973
AGATCGGAA12391
AGATCGGAAG12554
AGATCGGAAGA12331
AGATCGGAAGAG12967
AGATCGGAAGAGC13469
AGATCGGAAGAGCA14028
AGATCGGAAGAGCAC14610
AGATCGGAAGAGCACA14214
AGATCGGAAGAGCACAC12243
AGATCGGAAGAGCACACG11528
AGATCGGAAGAGCACACGT10615
AGATCGGAAGAGCACACGTC10431
AGATCGGAAGAGCACACGTCT11063
AGATCGGAAGAGCACACGTCTG11500
AGATCGGAAGAGCACACGTCTGA12039
AGATCGGAAGAGCACACGTCTGAA12190
AGATCGGAAGAGCACACGTCTGAAC12309
AGATCGGAAGAGCACACGTCTGAACT11643
AGATCGGAAGAGCACACGTCTGAACTC11128
AGATCGGAAGAGCACACGTCTGAACTCC10374
AGATCGGAAGAGCACACGTCTGAACTCCA9567
AGATCGGAAGAGCACACGTCTGAACTCCAG8955
AGATCGGAAGAGCACACGTCTGAACTCCAGT9089
AGATCGGAAGAGCACACGTCTGAACTCCAGTC10173
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA9949
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC10516
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACG10591
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGC10391
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCG10076
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGA9527
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAC12932
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGACG9640
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGACGA8086
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGACGAATTA22865
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGACGAATTAT8973
other adapter sequences265543
Adapter or bad ligation of read2
The input has little adapter percentage (~0.837843%), probably it's trimmed before.
SequenceOccurrences
A15342
AG15396
AGA15504
AGAT15550
AGATC14909
AGATCG16706
AGATCGG14223
AGATCGGA13619
AGATCGGAA11927
AGATCGGAAG12243
AGATCGGAAGA12233
AGATCGGAAGAG14546
AGATCGGAAGAGC13618
AGATCGGAAGAGCG14359
AGATCGGAAGAGCGT20032
AGATCGGAAGAGCGTC12782
AGATCGGAAGAGCGTCG18235
AGATCGGAAGAGCGTCGT12490
AGATCGGAAGAGCGTCGTG10011
AGATCGGAAGAGCGTCGTGTAG11507
AGATCGGAAGAGCGTCGTGTAGG17431
AGATCGGAAGAGCGTCGTGTAGGG14465
AGATCGGAAGAGCGTCGTGTAGGGA11489
AGATCGGAAGAGCGTCGTGTAGGGAA8414
AGATCGGAAGAGCGTCGTGTAGGGAAAGA8362
AGATCGGAAGAGCGTCGTGTAGGGAAAGAG8922
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGT8737
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG9031
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT10860
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTG10305
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGG13407
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGGA9796
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGGAC10052
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGGACA8532
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGGACAGTAACGTG9414
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGGACAGTAACGTGT8302
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGGACAGTAACGTGTAGATCTCGGTGGTCGC8733
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGGACAGTAACGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAA7994
other adapter sequences329018
This estimation is based on paired-end overlap analysis, and there are 64.820567% reads found not overlapped.
The nonoverlapped read pairs may have insert size <30 or >270, or contain too much sequencing errors to be detected as overlapped.
Value of each position will be shown on mouse over.
Value of each position will be shown on mouse over.
Darker background means larger counts. The count will be shown on mouse over.
AAATACAGTATTTCTGCACTCCCGGAGTGCGG
AAAAAAAAAAAATAAAACAAAAGAAATAAAATTAAATCAAATGAAACAAAACTAAACCAAACGAAAGAAAAGTAAAGCAAAGG
AATAATAAAATATAATACAATAGAATTAAATTTAATTCAATTGAATCAAATCTAATCCAATCGAATGAAATGTAATGCAATGG
AACAACAAAACATAACACAACAGAACTAAACTTAACTCAACTGAACCAAACCTAACCCAACCGAACGAAACGTAACGCAACGG
AAGAAGAAAAGATAAGACAAGAGAAGTAAAGTTAAGTCAAGTGAAGCAAAGCTAAGCCAAGCGAAGGAAAGGTAAGGCAAGGG
ATAATAAAATAATATAACATAAGATATAATATTATATCATATGATACAATACTATACCATACGATAGAATAGTATAGCATAGG
ATTATTAAATTATATTACATTAGATTTAATTTTATTTCATTTGATTCAATTCTATTCCATTCGATTGAATTGTATTGCATTGG
ATCATCAAATCATATCACATCAGATCTAATCTTATCTCATCTGATCCAATCCTATCCCATCCGATCGAATCGTATCGCATCGG
ATGATGAAATGATATGACATGAGATGTAATGTTATGTCATGTGATGCAATGCTATGCCATGCGATGGAATGGTATGGCATGGG
ACAACAAAACAATACAACACAAGACATAACATTACATCACATGACACAACACTACACCACACGACAGAACAGTACAGCACAGG
ACTACTAAACTATACTACACTAGACTTAACTTTACTTCACTTGACTCAACTCTACTCCACTCGACTGAACTGTACTGCACTGG
ACCACCAAACCATACCACACCAGACCTAACCTTACCTCACCTGACCCAACCCTACCCCACCCGACCGAACCGTACCGCACCGG
ACGACGAAACGATACGACACGAGACGTAACGTTACGTCACGTGACGCAACGCTACGCCACGCGACGGAACGGTACGGCACGGG
AGAAGAAAAGAATAGAACAGAAGAGATAAGATTAGATCAGATGAGACAAGACTAGACCAGACGAGAGAAGAGTAGAGCAGAGG
AGTAGTAAAGTATAGTACAGTAGAGTTAAGTTTAGTTCAGTTGAGTCAAGTCTAGTCCAGTCGAGTGAAGTGTAGTGCAGTGG
AGCAGCAAAGCATAGCACAGCAGAGCTAAGCTTAGCTCAGCTGAGCCAAGCCTAGCCCAGCCGAGCGAAGCGTAGCGCAGCGG
AGGAGGAAAGGATAGGACAGGAGAGGTAAGGTTAGGTCAGGTGAGGCAAGGCTAGGCCAGGCGAGGGAAGGGTAGGGCAGGGG
TAATAAAATAAATTAAACTAAAGTAATATAATTTAATCTAATGTAACATAACTTAACCTAACGTAAGATAAGTTAAGCTAAGG
TATTATAATATATTATACTATAGTATTATATTTTATTCTATTGTATCATATCTTATCCTATCGTATGATATGTTATGCTATGG
TACTACAATACATTACACTACAGTACTATACTTTACTCTACTGTACCATACCTTACCCTACCGTACGATACGTTACGCTACGG
TAGTAGAATAGATTAGACTAGAGTAGTATAGTTTAGTCTAGTGTAGCATAGCTTAGCCTAGCGTAGGATAGGTTAGGCTAGGG
TTATTAAATTAATTTAACTTAAGTTATATTATTTTATCTTATGTTACATTACTTTACCTTACGTTAGATTAGTTTAGCTTAGG
TTTTTTAATTTATTTTACTTTAGTTTTATTTTTTTTTCTTTTGTTTCATTTCTTTTCCTTTCGTTTGATTTGTTTTGCTTTGG
TTCTTCAATTCATTTCACTTCAGTTCTATTCTTTTCTCTTCTGTTCCATTCCTTTCCCTTCCGTTCGATTCGTTTCGCTTCGG
TTGTTGAATTGATTTGACTTGAGTTGTATTGTTTTGTCTTGTGTTGCATTGCTTTGCCTTGCGTTGGATTGGTTTGGCTTGGG
TCATCAAATCAATTCAACTCAAGTCATATCATTTCATCTCATGTCACATCACTTCACCTCACGTCAGATCAGTTCAGCTCAGG
TCTTCTAATCTATTCTACTCTAGTCTTATCTTTTCTTCTCTTGTCTCATCTCTTCTCCTCTCGTCTGATCTGTTCTGCTCTGG
TCCTCCAATCCATTCCACTCCAGTCCTATCCTTTCCTCTCCTGTCCCATCCCTTCCCCTCCCGTCCGATCCGTTCCGCTCCGG
TCGTCGAATCGATTCGACTCGAGTCGTATCGTTTCGTCTCGTGTCGCATCGCTTCGCCTCGCGTCGGATCGGTTCGGCTCGGG
TGATGAAATGAATTGAACTGAAGTGATATGATTTGATCTGATGTGACATGACTTGACCTGACGTGAGATGAGTTGAGCTGAGG
TGTTGTAATGTATTGTACTGTAGTGTTATGTTTTGTTCTGTTGTGTCATGTCTTGTCCTGTCGTGTGATGTGTTGTGCTGTGG
TGCTGCAATGCATTGCACTGCAGTGCTATGCTTTGCTCTGCTGTGCCATGCCTTGCCCTGCCGTGCGATGCGTTGCGCTGCGG
TGGTGGAATGGATTGGACTGGAGTGGTATGGTTTGGTCTGGTGTGGCATGGCTTGGCCTGGCGTGGGATGGGTTGGGCTGGGG
CAACAAAACAAATCAAACCAAAGCAATACAATTCAATCCAATGCAACACAACTCAACCCAACGCAAGACAAGTCAAGCCAAGG
CATCATAACATATCATACCATAGCATTACATTTCATTCCATTGCATCACATCTCATCCCATCGCATGACATGTCATGCCATGG
CACCACAACACATCACACCACAGCACTACACTTCACTCCACTGCACCACACCTCACCCCACCGCACGACACGTCACGCCACGG
CAGCAGAACAGATCAGACCAGAGCAGTACAGTTCAGTCCAGTGCAGCACAGCTCAGCCCAGCGCAGGACAGGTCAGGCCAGGG
CTACTAAACTAATCTAACCTAAGCTATACTATTCTATCCTATGCTACACTACTCTACCCTACGCTAGACTAGTCTAGCCTAGG
CTTCTTAACTTATCTTACCTTAGCTTTACTTTTCTTTCCTTTGCTTCACTTCTCTTCCCTTCGCTTGACTTGTCTTGCCTTGG
CTCCTCAACTCATCTCACCTCAGCTCTACTCTTCTCTCCTCTGCTCCACTCCTCTCCCCTCCGCTCGACTCGTCTCGCCTCGG
CTGCTGAACTGATCTGACCTGAGCTGTACTGTTCTGTCCTGTGCTGCACTGCTCTGCCCTGCGCTGGACTGGTCTGGCCTGGG
CCACCAAACCAATCCAACCCAAGCCATACCATTCCATCCCATGCCACACCACTCCACCCCACGCCAGACCAGTCCAGCCCAGG
CCTCCTAACCTATCCTACCCTAGCCTTACCTTTCCTTCCCTTGCCTCACCTCTCCTCCCCTCGCCTGACCTGTCCTGCCCTGG
CCCCCCAACCCATCCCACCCCAGCCCTACCCTTCCCTCCCCTGCCCCACCCCTCCCCCCCCCGCCCGACCCGTCCCGCCCCGG
CCGCCGAACCGATCCGACCCGAGCCGTACCGTTCCGTCCCGTGCCGCACCGCTCCGCCCCGCGCCGGACCGGTCCGGCCCGGG
CGACGAAACGAATCGAACCGAAGCGATACGATTCGATCCGATGCGACACGACTCGACCCGACGCGAGACGAGTCGAGCCGAGG
CGTCGTAACGTATCGTACCGTAGCGTTACGTTTCGTTCCGTTGCGTCACGTCTCGTCCCGTCGCGTGACGTGTCGTGCCGTGG
CGCCGCAACGCATCGCACCGCAGCGCTACGCTTCGCTCCGCTGCGCCACGCCTCGCCCCGCCGCGCGACGCGTCGCGCCGCGG
CGGCGGAACGGATCGGACCGGAGCGGTACGGTTCGGTCCGGTGCGGCACGGCTCGGCCCGGCGCGGGACGGGTCGGGCCGGGG
GAAGAAAAGAAATGAAACGAAAGGAATAGAATTGAATCGAATGGAACAGAACTGAACCGAACGGAAGAGAAGTGAAGCGAAGG
GATGATAAGATATGATACGATAGGATTAGATTTGATTCGATTGGATCAGATCTGATCCGATCGGATGAGATGTGATGCGATGG
GACGACAAGACATGACACGACAGGACTAGACTTGACTCGACTGGACCAGACCTGACCCGACCGGACGAGACGTGACGCGACGG
GAGGAGAAGAGATGAGACGAGAGGAGTAGAGTTGAGTCGAGTGGAGCAGAGCTGAGCCGAGCGGAGGAGAGGTGAGGCGAGGG
GTAGTAAAGTAATGTAACGTAAGGTATAGTATTGTATCGTATGGTACAGTACTGTACCGTACGGTAGAGTAGTGTAGCGTAGG
GTTGTTAAGTTATGTTACGTTAGGTTTAGTTTTGTTTCGTTTGGTTCAGTTCTGTTCCGTTCGGTTGAGTTGTGTTGCGTTGG
GTCGTCAAGTCATGTCACGTCAGGTCTAGTCTTGTCTCGTCTGGTCCAGTCCTGTCCCGTCCGGTCGAGTCGTGTCGCGTCGG
GTGGTGAAGTGATGTGACGTGAGGTGTAGTGTTGTGTCGTGTGGTGCAGTGCTGTGCCGTGCGGTGGAGTGGTGTGGCGTGGG
GCAGCAAAGCAATGCAACGCAAGGCATAGCATTGCATCGCATGGCACAGCACTGCACCGCACGGCAGAGCAGTGCAGCGCAGG
GCTGCTAAGCTATGCTACGCTAGGCTTAGCTTTGCTTCGCTTGGCTCAGCTCTGCTCCGCTCGGCTGAGCTGTGCTGCGCTGG
GCCGCCAAGCCATGCCACGCCAGGCCTAGCCTTGCCTCGCCTGGCCCAGCCCTGCCCCGCCCGGCCGAGCCGTGCCGCGCCGG
GCGGCGAAGCGATGCGACGCGAGGCGTAGCGTTGCGTCGCGTGGCGCAGCGCTGCGCCGCGCGGCGGAGCGGTGCGGCGCGGG
GGAGGAAAGGAATGGAACGGAAGGGATAGGATTGGATCGGATGGGACAGGACTGGACCGGACGGGAGAGGAGTGGAGCGGAGG
GGTGGTAAGGTATGGTACGGTAGGGTTAGGTTTGGTTCGGTTGGGTCAGGTCTGGTCCGGTCGGGTGAGGTGTGGTGCGGTGG
GGCGGCAAGGCATGGCACGGCAGGGCTAGGCTTGGCTCGGCTGGGCCAGGCCTGGCCCGGCCGGGCGAGGCGTGGCGCGGCGG
GGGGGGAAGGGATGGGACGGGAGGGGTAGGGTTGGGTCGGGTGGGGCAGGGCTGGGCCGGGCGGGGGAGGGGTGGGGCGGGGG
Sampling rate: 1 / 20
overrepresented sequencecount (% of bases)distribution: cycle 1 ~ cycle 150
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA280 (0.007184%)
AAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCA28 (0.001796%)
AAAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTGAGCGTTCTATCATTCTAGCCTCGTACCAAC23 (0.001475%)
AAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTC40 (0.002566%)
AAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACC70 (0.004490%)
AAAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCA295 (0.018921%)
AAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAA25 (0.001603%)
AAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCC13 (0.000834%)
AAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTG34 (0.002181%)
AAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAA13 (0.000834%)
AAAAGAGAAGGCAGCCCGGGTTAAGGCTGTACTGACTAGCCAGGAGACTTTATTTGGGGGAAGTGACTGCACCGGCAATTTCTGTTTGTTCAAGTCCACC210 (0.013469%)
AAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCAT26 (0.001668%)
AAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCA23 (0.001475%)
AAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTAC44 (0.002822%)
AAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGG40 (0.002566%)
AAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTC46 (0.002950%)
AAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTGAGCGTTCTATCATTCTAGCCTCGTACCAACA23 (0.001475%)
AAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGA10 (0.000641%)
AAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTAT22 (0.001411%)
AAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAA51 (0.003271%)
AAAAGTGTTCAAAAAGACCTCTGAGGGATCCTGGGAGCCCTTTGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAG7 (0.000449%)
AAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGAC13 (0.000834%)
AAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCCAA26 (0.001668%)
AAAATCCCTAGGTTTAAATTAATTAATGGGTGTGGTATTGGTAGGGGAACTCATAGACTTAATGCTAGTGTGAGTGATAGGGTAGGTGCAATAATAAATA29 (0.001860%)
AAAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAA3 (0.000192%)
AAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTG39 (0.002501%)
AAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCA22 (0.001411%)
AAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACAT84 (0.005388%)
AAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATCCTAATCATATTCTTAATT30 (0.001924%)
AAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCT33 (0.002117%)
AAACACCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATC65 (0.004169%)
AAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACGAGAAGTAATA24 (0.001539%)
AAACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCAT18 (0.001155%)
AAACAGTGCTCCAAAGAAGATGGTGGTGGCTGGTGGTATAACAGATGCCATGCAGCCAATCCAAATGGCAGATACTACTGGGGTGGCCTTTACAGCTGGG12 (0.000770%)
AAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATT9 (0.000577%)
AAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAA7 (0.000449%)
AAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAAC9 (0.000577%)
AAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGG7 (0.000449%)
AAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCT25 (0.001603%)
AAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGG13 (0.000834%)
AAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAAT3 (0.000192%)
AAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCA9 (0.000577%)
AAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTG35 (0.002245%)
AAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTC45 (0.002886%)
AAACTGACTTGTCCCACTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTC3 (0.000192%)
AAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTG8 (0.000513%)
AAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTTGGCCTGGCTCTGAA6 (0.000385%)
AAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTG11 (0.000706%)
AAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAA34 (0.002181%)
AAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACG20 (0.001283%)
AAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATT67 (0.004297%)
AAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACAT11 (0.000706%)
AAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCC39 (0.002501%)
AAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATC9 (0.000577%)
AAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGC24 (0.001539%)
AAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATT34 (0.002181%)
AAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCAT5 (0.000321%)
AAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAGCAGCTGACACCCCTTGTCAGGTCAG4 (0.000257%)
AAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTGCAGAGCTC36 (0.002309%)
AAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGC56 (0.003592%)
AAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGT15 (0.000962%)
AAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCC59 (0.003784%)
AAAGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGGAGTAGTAAGTAACTACATGTGAAATAATTCCAAATCCT240 (0.015393%)
AAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACT18 (0.001155%)
AAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACC10 (0.000641%)
AAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTTGACACCGGTAGGAATTGCGATA3 (0.000192%)
AAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGA9 (0.000577%)
AAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGATTTAGTCGGCCTGGGATGGCA4 (0.000257%)
AAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCA14 (0.000898%)
AAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGA13 (0.000834%)
AAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGA3 (0.000192%)
AAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTGAGCGTTCTATCATTCTAGCCTCGTACCAACAC11 (0.000706%)
AAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCT41 (0.002630%)
AAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACT28 (0.001796%)
AAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAA3 (0.000192%)
AAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAA4 (0.000257%)
AAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAAT4 (0.000257%)
AAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATT16 (0.001026%)
AAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCA7 (0.000449%)
AAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGA12 (0.000770%)
AAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATT4 (0.000257%)
AAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAAC14 (0.000898%)
AAAGTGTTCAAAAAGACCTCTGAGGGATCCTGGGAGCCCTTTGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGT6 (0.000385%)
AAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATC3 (0.000192%)
AAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTTGACACCGGTA4 (0.000257%)
AAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCA72 (0.004618%)
AAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAA8 (0.000513%)
AAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTCGG21 (0.001347%)
AAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTT20 (0.001283%)
AAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTA7 (0.000449%)
AAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTA12 (0.000770%)
AAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCCAAT6 (0.000385%)
AAATCCCTAGGTTTAAATTAATTAATGGGTGTGGTATTGGTAGGGGAACTCATAGACTTAATGCTAGTGTGAGTGATAGGGTAGGTGCAATAATAAATAA3 (0.000192%)
AAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCG35 (0.002245%)
AAATCGTACTGGAAGACACTTGGCATTTCCCCGTTCCATGAATTCGCGGATGTGGTTTTCACAGCCAACGACTCTGGCCATCGCCACTACACCATCGCAG9 (0.000577%)
AAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACT3 (0.000192%)
AAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAA3 (0.000192%)
AAATGAAGTGGGTAACCTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCA378 (0.024245%)
AAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCG23 (0.001475%)
AAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGT15 (0.000962%)
AAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTT6 (0.000385%)
AAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTA6 (0.000385%)
AAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGAAGCCTGAAAATAATGGGA3 (0.000192%)
AAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGA56 (0.003592%)
AAATTCATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATT15 (0.000962%)
AAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTG17 (0.001090%)
AAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAG14 (0.000898%)
AAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCAC216 (0.013854%)
AAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACT18 (0.001155%)
AAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAA9 (0.000577%)
AACAAACAGAAATTGCCGGTGCAGTCACTTCCCCCAAATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCA3 (0.000192%)
AACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATG6 (0.000385%)
AACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCCAATCGTTGTAG8 (0.000513%)
AACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATCCTAATCATATTCTTAATTC3 (0.000192%)
AACAACCCCGTATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCC397 (0.025463%)
AACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTC4 (0.000257%)
AACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAAC7 (0.000449%)
AACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACA5 (0.000321%)
AACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACGAGAAGTAATAT4 (0.000257%)
AACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATT24 (0.001539%)
AACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATT5 (0.000321%)
AACAGAAATTGCCGGTGCAGTCACTTCCCCCAAATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAAC3 (0.000192%)
AACAGAAGGTCCTTGGTGGTGGACTTGAACAAACAGAAATTGCCGGTGCAGTCACTTCCCCCAAATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCC3 (0.000192%)
AACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAA23 (0.001475%)
AACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAG21 (0.001347%)
AACAGATGCGCGAGAGCCTGGCCCAGCGCCTGGCTGAGCTCAAGAGCAACCCTACCTTGAACGAGTACCACACCAGGGCCAAAACCCACCTGAAGACACT3 (0.000192%)
AACAGGAAGAGGAAGAAATTCATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGT8 (0.000513%)
AACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCA9 (0.000577%)
AACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGA9 (0.000577%)
AACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTGTG3 (0.000192%)
AACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTTTG10 (0.000641%)
AACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGAT3 (0.000192%)
AACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTGCAGAGCTCCCAAG13 (0.000834%)
AACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACT14 (0.000898%)
AACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATT10 (0.000641%)
AACCACTCATTCATTGACCTACCTGCCCCATCCAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAG7 (0.000449%)
AACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGA3 (0.000192%)
AACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCA7 (0.000449%)
AACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGA7 (0.000449%)
AACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTG13 (0.000834%)
AACCATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCT4 (0.000257%)
AACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATG18 (0.001155%)
AACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTAT5 (0.000321%)
AACCCCGTATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAA3 (0.000192%)
AACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTGCAGAGCTCCCAAGTCAC6 (0.000385%)
AACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCA12 (0.000770%)
AACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTC8 (0.000513%)
AACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTA5 (0.000321%)
AACCTACCAAGGCCACCACACTCCTATTGTACAAAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTC9 (0.000577%)
AACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTG3 (0.000192%)
AACCTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGAT13 (0.000834%)
AACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAA6 (0.000385%)
AACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCG11 (0.000706%)
AACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGC62 (0.003977%)
AACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGG9 (0.000577%)
AACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAAT7 (0.000449%)
AACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTA3 (0.000192%)
AACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTC4 (0.000257%)
AACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGAT10 (0.000641%)
AACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCT3 (0.000192%)
AACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCA3 (0.000192%)
AACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCCCAGAT5 (0.000321%)
AACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACAC4 (0.000257%)
AACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAAC4 (0.000257%)
AACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCG3 (0.000192%)
AACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGG4 (0.000257%)
AACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGT8 (0.000513%)
AACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAA4 (0.000257%)
AACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGA8 (0.000513%)
AACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGT5 (0.000321%)
AAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATA17 (0.001090%)
AAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTG32 (0.002052%)
AAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAAC13 (0.000834%)
AAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGA13 (0.000834%)
AAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATA24 (0.001539%)
AAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGG12 (0.000770%)
AAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGC18 (0.001155%)
AAGAAATTCATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGA64 (0.004105%)
AAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCA23 (0.001475%)
AAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTG23 (0.001475%)
AAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGG39 (0.002501%)
AAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCA48 (0.003079%)
AAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGG174 (0.011160%)
AAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTT19 (0.001219%)
AAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTTGGCCTGGCTCTGAATCTCTGAGG7 (0.000449%)
AAGAATTAAGATGATTGAGAAGTATGAGATGGAGGCTAGTTGGCCAATGATAATAAATGGGTGTTCTACTGGTTGGCCCCCAATTCAGGTTAAGATAAGT7 (0.000449%)
AAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGC62 (0.003977%)
AAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGA7 (0.000449%)
AAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCC26 (0.001668%)
AAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGC50 (0.003207%)
AAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCC16 (0.001026%)
AAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGA14 (0.000898%)
AAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTA11 (0.000706%)
AAGAGAAGGCAGCCCGGGTTAAGGCTGTACTGACTAGCCAGGAGACTTTATTTGGGGGAAGTGACTGCACCGGCAATTTCTGTTTGTTCAAGTCCACCAC3 (0.000192%)
AAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCT4 (0.000257%)
AAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTT14 (0.000898%)
AAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGC8 (0.000513%)
AAGAGGAAGAAATTCATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAG26 (0.001668%)
AAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCA36 (0.002309%)
AAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCG9 (0.000577%)
AAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAA5 (0.000321%)
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAC3028 (0.077686%)
AAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCT7 (0.000449%)
AAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTT8 (0.000513%)
AAGATGATTGAGAAGTATGAGATGGAGGCTAGTTGGCCAATGATAATAAATGGGTGTTCTACTGGTTGGCCCCCAATTCAGGTTAAGATAAGTAGGTTGG3 (0.000192%)
AAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTA3 (0.000192%)
AAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCC7 (0.000449%)
AAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTGCAGAGCTCC31 (0.001988%)
AAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCT4 (0.000257%)
AAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATG8 (0.000513%)
AAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCC66 (0.004233%)
AAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGT7 (0.000449%)
AAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGT10 (0.000641%)
AAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTG4 (0.000257%)
AAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCA9 (0.000577%)
AAGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGGAGTAGTAAGTAACTACATGTGAAATAATTCCAAATCCTG3 (0.000192%)
AAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTT19 (0.001219%)
AAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCT7 (0.000449%)
AAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCC4 (0.000257%)
AAGCCCTACTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGG5 (0.000321%)
AAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGA4 (0.000257%)
AAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGAT3 (0.000192%)
AAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGATTTAGTCGGCCTGGGATGGCAT4 (0.000257%)
AAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTAT8 (0.000513%)
AAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAG17 (0.001090%)
AAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAA5 (0.000321%)
AAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAG7 (0.000449%)
AAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGA5 (0.000321%)
AAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGT4 (0.000257%)
AAGGAACCCAATTCAGAAGGAAGGATGACATCTTAGGGTGGTCATTTATGTGTGGGATCTACCACTTTTCCCACAAAGAGGGGGCTCTGAGTGTGTTCTT208 (0.013341%)
AAGGAACCTACCAAGGCCACCACACTCCTATTGTACAAAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATT16 (0.001026%)
AAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCT22 (0.001411%)
AAGGACCTTCTGTTCAGGGATGACACCAAATGTTTCGTTAAACTTCCAGAGGGTACCACACCTGAAAAATACTTAGGAGCGGAGTACATGCAATCTGTCG7 (0.000449%)
AAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCA16 (0.001026%)
AAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTC3 (0.000192%)
AAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTG6 (0.000385%)
AAGGAGCTGACTGGCCAATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGA27 (0.001732%)
AAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGA5 (0.000321%)
AAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTT7 (0.000449%)
AAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGC22 (0.001411%)
AAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCA41 (0.002630%)
AAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAA16 (0.001026%)
AAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAG3 (0.000192%)
AAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGC17 (0.001090%)
AAGGCCACCACACTCCTATTGTACAAAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTGAGCGTT13 (0.000834%)
AAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTT45 (0.002886%)
AAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGT63 (0.004041%)
AAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTG30 (0.001924%)
AAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCAT3 (0.000192%)
AAGGGCTATTAGTGTTAGTTCTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAATAATTATGTATATTGAG5 (0.000321%)
AAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACCCCATCATCACCC4 (0.000257%)
AAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGA9 (0.000577%)
AAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGG7 (0.000449%)
AAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGC10 (0.000641%)
AAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAAC3 (0.000192%)
AAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAG3 (0.000192%)
AAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATG4 (0.000257%)
AAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGC25 (0.001603%)
AAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTC14 (0.000898%)
AAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGC15 (0.000962%)
AAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAG3 (0.000192%)
AAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGAC3 (0.000192%)
AAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTT10 (0.000641%)
AAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTT3 (0.000192%)
AAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATA4 (0.000257%)
AAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCA76 (0.004875%)
AAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACT10 (0.000641%)
AAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCA28 (0.001796%)
AAGTGGGTAACCTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGT33 (0.002117%)
AAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAG11 (0.000706%)
AAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATA12 (0.000770%)
AAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAG4 (0.000257%)
AAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGCTT4 (0.000257%)
AAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCA3 (0.000192%)
AATAAAATTAATTGCACCTAAAATAGATGACACTCCAGCTAAATGAAGGGAGAAAATTGTTAGGTCTACTGATGCTCCTGCATGGGCTAGATTTCCGGCT3 (0.000192%)
AATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGT6 (0.000385%)
AATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATA5 (0.000321%)
AATAAGTGGAATTATGTGAAGGGCTATTAGTGTTAGTTCTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTA3 (0.000192%)
AATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCAC8 (0.000513%)
AATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTA4 (0.000257%)
AATAATTGTTTCCCTAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGT4 (0.000257%)
AATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATG20 (0.001283%)
AATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATG11 (0.000706%)
AATACGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTA13 (0.000834%)
AATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACA7 (0.000449%)
AATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGGAGTAGTAAGTAACTACATGTGAAATAATTCCAAATCCTGGGAGG7 (0.000449%)
AATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAA7 (0.000449%)
AATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCC4 (0.000257%)
AATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTT3 (0.000192%)
AATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTC3 (0.000192%)
AATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAA5 (0.000321%)
AATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGGAGTAGT4 (0.000257%)
AATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCC4 (0.000257%)
AATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAA3 (0.000192%)
AATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAG5 (0.000321%)
AATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTC11 (0.000706%)
AATCAGCTTACAAATTCTCCTAATCATAACCTTTTCAGCAACTGAACTAATTATATTTTATATTTTATTTGAAGCAACCTTAATCCCAACACTTATTATT7 (0.000449%)
AATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATC23 (0.001475%)
AATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGT10 (0.000641%)
AATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAA10 (0.000641%)
AATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGA33 (0.002117%)
AATCCTATTCCCTACCAAAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGG15 (0.000962%)
AATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGC13 (0.000834%)
AATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTC20 (0.001283%)
AATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTT6 (0.000385%)
AATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATA10 (0.000641%)
AATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAA7 (0.000449%)
AATCGTACTGGAAGACACTTGGCATTTCCCCGTTCCATGAATTCGCGGATGTGGTTTTCACAGCCAACGACTCTGGCCATCGCCACTACACCATCGCAGC3 (0.000192%)
AATCGTTCACCTCCTCTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATC7 (0.000449%)
AATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTC4 (0.000257%)
AATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTT698 (0.044769%)
AATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAG3 (0.000192%)
AATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAA10 (0.000641%)
AATGAAGTGGGTAACCTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCAT53 (0.003399%)
AATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTT13 (0.000834%)
AATGATAGAACGCTCAGAAGAATCCTGCAAAGAAAAATACTTCCGAGACGATGAATAGAATTATACCATATCGTAGTCCTTTTTGTACAATAGGAGTGTG3 (0.000192%)
AATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGT5 (0.000321%)
AATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTA11 (0.000706%)
AATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTT4 (0.000257%)
AATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTC3 (0.000192%)
AATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCAT9 (0.000577%)
AATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCA7 (0.000449%)
AATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTGTGATCT4 (0.000257%)
AATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAA7 (0.000449%)
AATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTT8 (0.000513%)
AATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTT6 (0.000385%)
AATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGC3 (0.000192%)
AATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTAT13 (0.000834%)
AATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCA6 (0.000385%)
AATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAA3 (0.000192%)
AATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAG16 (0.001026%)
AATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCAC15 (0.000962%)
AATTAAGATGATTGAGAAGTATGAGATGGAGGCTAGTTGGCCAATGATAATAAATGGGTGTTCTACTGGTTGGCCCCCAATTCAGGTTAAGATAAGTAGG10 (0.000641%)
AATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCT45 (0.002886%)
AATTAATGGGTGTGGTATTGGTAGGGGAACTCATAGACTTAATGCTAGTGTGAGTGATAGGGTAGGTGCAATAATAAATAAGGATATAGAGGTTGTTAAA9 (0.000577%)
AATTACGGCTCCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTT3 (0.000192%)
AATTAGTATCAGGGTTTAACGTAGAATACGCAGCCGGCCCATTCGCGTTATTCTTTATAGCAGAGTACACTAACATTATTCTAATAAACGCCCTAACAAC4 (0.000257%)
AATTCATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTG24 (0.001539%)
AATTCCTGAGATTGGTATAAGAATTAAGATGATTGAGAAGTATGAGATGGAGGCTAGTTGGCCAATGATAATAAATGGGTGTTCTACTGGTTGGCCCCCA9 (0.000577%)
AATTGCAGCACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCAT70 (0.004490%)
AATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGG11 (0.000706%)
AATTGCGATAATTATAGTGGCTGATGTAAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAG4 (0.000257%)
AATTGGGTCCCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAAT26 (0.001668%)
AATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGT6 (0.000385%)
AATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTCGGAAGCCTGTA3 (0.000192%)
AATTGTTTCCCTAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATA18 (0.001155%)
AATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCT4 (0.000257%)
AATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACA4 (0.000257%)
AATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTA13 (0.000834%)
AATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGT3 (0.000192%)
AATTTCGCGACCGCATGCGCACACACGTAGACTCTCTGCGCACACAGCTAGCGCCCCACAGCGAACAGATGCGCGAGAGCCTGGCCCAGCGCCTGGCTGA5 (0.000321%)
AATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAA12 (0.000770%)
AATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTA13 (0.000834%)
ACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCA12 (0.000770%)
ACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGT4 (0.000257%)
ACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTA7 (0.000449%)
ACAAATTCTCCTAATCATAACCTTTTCAGCAACTGAACTAATTATATTTTATATTTTATTTGAAGCAACCTTAATCCCAACACTTATTATTATTACCCGA3 (0.000192%)
ACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCA13 (0.000834%)
ACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGG6 (0.000385%)
ACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAG9 (0.000577%)
ACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCC6 (0.000385%)
ACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTT14 (0.000898%)
ACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGT10 (0.000641%)
ACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTT6 (0.000385%)
ACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACT11 (0.000706%)
ACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAG17 (0.001090%)
ACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCT4 (0.000257%)
ACACCAAATCGTACTGGAAGACACTTGGCATTTCCCCGTTCCATGAATTCGCGGATGTGGTTTTCACAGCCAACGACTCTGGCCATCGCCACTACACCAT3 (0.000192%)
ACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTT4 (0.000257%)
ACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTG11 (0.000706%)
ACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCA7 (0.000449%)
ACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCA5 (0.000321%)
ACACCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTT3 (0.000192%)
ACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAAC3 (0.000192%)
ACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGG4 (0.000257%)
ACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTG7 (0.000449%)
ACACGTCTGAACTCCAGTCACGCGACGAATTATCTCGTAT8 (0.000205%)
ACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGT3 (0.000192%)
ACACTGGCCTGCAATGTAGGCATGTCCTCCATCCAAAGTCATGGCGTCCGCTTCTCCGTTCACAATCTTTTCAATGCAGTCCTCAGTGGTCTCTGCTGAC3 (0.000192%)
ACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCA3 (0.000192%)
ACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGC4 (0.000257%)
ACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAG9 (0.000577%)
ACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTT3 (0.000192%)
ACAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTA3 (0.000192%)
ACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGG9 (0.000577%)
ACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTT25 (0.001603%)
ACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAA3 (0.000192%)
ACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTC8 (0.000513%)
ACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCA5 (0.000321%)
ACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACA5 (0.000321%)
ACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTC3 (0.000192%)
ACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATA15 (0.000962%)
ACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAA7 (0.000449%)
ACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAA3 (0.000192%)
ACATGAACCCTAATAATTGTTTCCCTAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCA3 (0.000192%)
ACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACT3 (0.000192%)
ACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAAT3 (0.000192%)
ACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACA4 (0.000257%)
ACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGT3 (0.000192%)
ACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACC4 (0.000257%)
ACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAG6 (0.000385%)
ACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCC4 (0.000257%)
ACCAAAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAG3 (0.000192%)
ACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCT11 (0.000706%)
ACCAAATCGTACTGGAAGACACTTGGCATTTCCCCGTTCCATGAATTCGCGGATGTGGTTTTCACAGCCAACGACTCTGGCCATCGCCACTACACCATCG10 (0.000641%)
ACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGT20 (0.001283%)
ACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCC6 (0.000385%)
ACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTGCAGAGCTCCCAAGT7 (0.000449%)
ACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTTG9 (0.000577%)
ACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTC12 (0.000770%)
ACCAAGGCCACCACACTCCTATTGTACAAAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTGAGC18 (0.001155%)
ACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCT28 (0.001796%)
ACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCC24 (0.001539%)
ACCAATACCACACCCATTAATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCCATTCTATGATCAGGATGAGCC4 (0.000257%)
ACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACT4 (0.000257%)
ACCAATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATT8 (0.000513%)
ACCACACCCATTAATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCCATTCTATGATCAGGATGAGCCTCAAAC8 (0.000513%)
ACCACACTGGCCTGCAATGTAGGCATGTCCTCCATCCAAAGTCATGGCGTCCGCTTCTCCGTTCACAATCTTTTCAATGCAGTCCTCAGTGGTCTCTGCT3 (0.000192%)
ACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTC8 (0.000513%)
ACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATC3 (0.000192%)
ACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGG3 (0.000192%)
ACCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACT8 (0.000513%)
ACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCAC7 (0.000449%)
ACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGAGGACTTTCAGACCACCGAACTTACCACGACCTACGCCACGCCTTCTCT4 (0.000257%)
ACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCT3 (0.000192%)
ACCAGGATGAGGCTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCG4 (0.000257%)
ACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGAT3 (0.000192%)
ACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGC4 (0.000257%)
ACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCA10 (0.000641%)
ACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGG10 (0.000641%)
ACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATG6 (0.000385%)
ACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACT6 (0.000385%)
ACCATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTT22 (0.001411%)
ACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGA8 (0.000513%)
ACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGA3 (0.000192%)
ACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGA7 (0.000449%)
ACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCA7 (0.000449%)
ACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAG5 (0.000321%)
ACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGG6 (0.000385%)
ACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAA19 (0.001219%)
ACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGA13 (0.000834%)
ACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCG10 (0.000641%)
ACCGCCTCAGCTATCTTTCCTTGGGTTCCCTTCTCCACAAAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCA5 (0.000475%)
ACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCT19 (0.001219%)
ACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGAT7 (0.000449%)
ACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCC5 (0.000321%)
ACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAAACCCTCAACAGACCAGACAGTGAGCTGCAGCTGAGCACAGGCAA4 (0.000257%)
ACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGT3 (0.000192%)
ACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGC12 (0.000770%)
ACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGG6 (0.000385%)
ACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATG3 (0.000192%)
ACCTCGTTGCGGTACTGCCCGAGTCGGTTGCGTAGATCCTCCATGTCGGCTCCGAGTCGGGCCTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTG3 (0.000192%)
ACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCA3 (0.000192%)
ACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGAC3 (0.000192%)
ACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCT23 (0.001475%)
ACCTGCCCCATCCAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCCATACAC3 (0.000192%)
ACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACC6 (0.000385%)
ACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTGAGAAA3 (0.000192%)
ACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCT3 (0.000192%)
ACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAG6 (0.000385%)
ACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGA3 (0.000192%)
ACCTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATT6 (0.000385%)
ACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGT10 (0.000641%)
ACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTC10 (0.000641%)
ACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGA6 (0.000385%)
ACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATG12 (0.000770%)
ACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGG16 (0.001026%)
ACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATA5 (0.000321%)
ACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTC3 (0.000192%)
ACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAG5 (0.000321%)
ACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACA3 (0.000192%)
ACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATT23 (0.001475%)
ACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCA14 (0.000898%)
ACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTG4 (0.000257%)
ACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTG4 (0.000257%)
ACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCA4 (0.000257%)
ACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCA11 (0.000706%)
ACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTT5 (0.000321%)
ACGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATA4 (0.000257%)
ACGTCTGAACTCCAGTCACGCGACGAATTATCTCGTATGC8 (0.000205%)
ACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCCAATCGTTG3 (0.000192%)
ACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCT3 (0.000192%)
ACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGT3 (0.000192%)
ACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGC5 (0.000321%)
ACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATT8 (0.000513%)
ACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCA3 (0.000192%)
ACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGC21 (0.001347%)
ACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAG8 (0.000513%)
ACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTCAGA4 (0.000257%)
ACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGC3 (0.000192%)
ACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAA25 (0.001603%)
ACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATT4 (0.000257%)
ACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGC3 (0.000192%)
ACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGA8 (0.000513%)
ACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAA24 (0.001539%)
ACTCATTCATTGACCTACCTGCCCCATCCAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCT7 (0.000449%)
ACTCGTTCAAGGTAGGGTTGCTCTTGAGCTCAGCCAGGCGCTGGGCCAGGCTCTCGCGCATCTGTTCGCTGTGGGGCGCTAGCTGTGTGCGCAGAGAGTC5 (0.000321%)
ACTCTAAGTATTCTTAATTCTTTAGTTTACCTGTCAATCAACCCTCAGATCAAGGATATGAACAATAAAGTTCACATCCAGATTCTTATTCTCAGTGTGG3 (0.000192%)
ACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCT13 (0.000834%)
ACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCAC3 (0.000192%)
ACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTC3 (0.000192%)
ACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGT16 (0.001026%)
ACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCC15 (0.000962%)
ACTGACTTGTCCCACTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCT3 (0.000192%)
ACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGATTA3 (0.000192%)
ACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTG7 (0.000449%)
ACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCAT7 (0.000449%)
ACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGT25 (0.001603%)
ACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAA5 (0.000321%)
ACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCT18 (0.001155%)
ACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCA6 (0.000385%)
ACTGGCCAATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGA4 (0.000257%)
ACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCAT4 (0.000257%)
ACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACGAGAAGTAATATCAG11 (0.000706%)
ACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATC3 (0.000192%)
ACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGA4 (0.000257%)
ACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGG3 (0.000192%)
ACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTG4 (0.000257%)
ACTGTTCCTAGGCCATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGG35 (0.002245%)
ACTTAGATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATT3 (0.000192%)
ACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGT12 (0.000770%)
ACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTG7 (0.000449%)
ACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGAC6 (0.000385%)
ACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCAT11 (0.000706%)
ACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTG6 (0.000385%)
ACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGC4 (0.000257%)
ACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTC3 (0.000192%)
ACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATT3 (0.000192%)
ACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAG5 (0.000321%)
ACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTA3 (0.000192%)
ACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTG6 (0.000385%)
ACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTC8 (0.000513%)
ACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATC6 (0.000385%)
ACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTC5 (0.000321%)
ACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTG12 (0.000770%)
ACTTGTCCCACTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCA8 (0.000513%)
ACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTT12 (0.000770%)
ACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTC4 (0.000257%)
AGAAAACAGTGCTCCAAAGAAGATGGTGGTGGCTGGTGGTATAACAGATGCCATGCAGCCAATCCAAATGGCAGATACTACTGGGGTGGCCTTTACAGCT9 (0.000577%)
AGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAAC35 (0.002245%)
AGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGG9 (0.000577%)
AGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGT5 (0.000321%)
AGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACC3 (0.000192%)
AGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACT8 (0.000513%)
AGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAG14 (0.000898%)
AGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAA42 (0.002694%)
AGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAG5 (0.000321%)
AGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGA29 (0.001860%)
AGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCC11 (0.000706%)
AGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAG4 (0.000257%)
AGAAATTCATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAA19 (0.001219%)
AGAAATTGCCGGTGCAGTCACTTCCCCCAAATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATG7 (0.000449%)
AGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATC3 (0.000192%)
AGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGT43 (0.002758%)
AGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCAT10 (0.000641%)
AGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGC4 (0.000257%)
AGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTG13 (0.000834%)
AGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGT10 (0.000641%)
AGAAGAATAAGTGGAATTATGTGAAGGGCTATTAGTGTTAGTTCTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGG14 (0.000898%)
AGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCAT63 (0.004041%)
AGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCT41 (0.002630%)
AGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGT37 (0.002373%)
AGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAA18 (0.001155%)
AGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTCCATACTGTAAGAGATGAAGAGTGCTCC97 (0.006222%)
AGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTT5 (0.000321%)
AGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGAT19 (0.001219%)
AGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAA8 (0.000513%)
AGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTT7 (0.000449%)
AGAAGGTCCTTGGTGGTGGACTTGAACAAACAGAAATTGCCGGTGCAGTCACTTCCCCCAAATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGG4 (0.000257%)
AGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCT8 (0.000513%)
AGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGT21 (0.001347%)
AGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTA15 (0.000962%)
AGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGA8 (0.000513%)
AGAATAAGTGGAATTATGTGAAGGGCTATTAGTGTTAGTTCTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGG4 (0.000257%)
AGAATACGCAGCCGGCCCATTCGCGTTATTCTTTATAGCAGAGTACACTAACATTATTCTAATAAACGCCCTAACAACTATTATCTTCCTAGGACCCCTA9 (0.000577%)
AGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGA5 (0.000321%)
AGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCC96 (0.006157%)
AGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAG8 (0.000513%)
AGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAG16 (0.001026%)
AGAATTGGGTCCCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATA6 (0.000385%)
AGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAGC3 (0.000192%)
AGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTC37 (0.002373%)
AGACAATCCTATTCCCTACCAAAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGG485 (0.031108%)
AGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGT38 (0.002437%)
AGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCT10 (0.000641%)
AGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAG6 (0.000385%)
AGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTT11 (0.000706%)
AGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAG6 (0.000385%)
AGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCC16 (0.001026%)
AGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCC21 (0.001347%)
AGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGC49 (0.003143%)
AGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATA13 (0.000834%)
AGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCC15 (0.000962%)
AGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCT47 (0.003015%)
AGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAG6 (0.000385%)
AGACGGTCCAGGATGCGCTAAGTAGCGTGCAGGAGTCCGATATAGCTGTGGTGGCCAGGGGCTGGATGGACAATCACTTCAGATCCCTGAAAGGCTACTG238 (0.015265%)
AGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCAC5 (0.000321%)
AGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAG127 (0.008146%)
AGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAA53 (0.003399%)
AGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTCA3 (0.000192%)
AGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTA50 (0.003207%)
AGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAG15 (0.000962%)
AGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCG11 (0.000706%)
AGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTG3 (0.000192%)
AGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTT12 (0.000770%)
AGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGG22 (0.001411%)
AGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGAC9 (0.000577%)
AGAGAAGGCAGCCCGGGTTAAGGCTGTACTGACTAGCCAGGAGACTTTATTTGGGGGAAGTGACTGCACCGGCAATTTCTGTTTGTTCAAGTCCACCACC7 (0.000449%)
AGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGC64 (0.004105%)
AGAGAATTGGGTCCCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGA335 (0.021487%)
AGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTC44 (0.002822%)
AGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTG65 (0.004169%)
AGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAA5 (0.000321%)
AGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGAT7 (0.000449%)
AGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGT9 (0.000577%)
AGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAGCAGCT3 (0.000192%)
AGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAA5 (0.000321%)
AGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCA8 (0.000513%)
AGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATA9 (0.000577%)
AGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCA6 (0.000385%)
AGAGGAAGAAATTCATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGA9 (0.000577%)
AGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAG116 (0.007440%)
AGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAG16 (0.001026%)
AGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCAT9 (0.000577%)
AGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCC569 (0.036495%)
AGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGG6 (0.000385%)
AGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGG11 (0.000706%)
AGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAG6 (0.000385%)
AGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATAT5 (0.000321%)
AGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACA8 (0.000513%)
AGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCA14 (0.000898%)
AGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATG27 (0.001732%)
AGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGT6 (0.000385%)
AGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGT9 (0.000577%)
AGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGG43 (0.002758%)
AGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGA5 (0.000321%)
AGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAG12 (0.000770%)
AGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGC6 (0.000385%)
AGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAG45 (0.002886%)
AGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCG30 (0.001924%)
AGATCCTCCATGTCGGCTCCGAGTCGGGCCTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCA6 (0.000385%)
AGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCA12 (0.000770%)
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGACG1830 (0.046950%)
AGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGC104 (0.006670%)
AGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTG20 (0.001283%)
AGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGA4 (0.000257%)
AGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCC30 (0.001924%)
AGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTT40 (0.002566%)
AGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGT18 (0.001155%)
AGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAA1111 (0.071259%)
AGATGATTGAGAAGTATGAGATGGAGGCTAGTTGGCCAATGATAATAAATGGGTGTTCTACTGGTTGGCCCCCAATTCAGGTTAAGATAAGTAGGTTGGC15 (0.000962%)
AGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAA5 (0.000321%)
AGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCA4 (0.000257%)
AGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCT6 (0.000385%)
AGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGT4 (0.000257%)
AGATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTAGGG5 (0.000321%)
AGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGC7 (0.000449%)
AGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGAC6 (0.000385%)
AGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTG15 (0.000962%)
AGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGA16 (0.001026%)
AGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTGCAGAGCTCCC9 (0.000577%)
AGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTA10 (0.000641%)
AGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCT14 (0.000898%)
AGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAG3 (0.000192%)
AGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGA15 (0.000962%)
AGCAAGTCTAGCTAATCTAGCTCTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATT5 (0.000321%)
AGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCA26 (0.001668%)
AGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTG10 (0.000641%)
AGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGC11 (0.000706%)
AGCACACGTCTGAACTCCAGTCACGCGACGAATTATCTCG9 (0.000231%)
AGCACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTT41 (0.002630%)
AGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCC14 (0.000898%)
AGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCT33 (0.002117%)
AGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGC4 (0.000257%)
AGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACA4 (0.000257%)
AGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTG6 (0.000385%)
AGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTA25 (0.001603%)
AGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTC19 (0.001219%)
AGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTT19 (0.001219%)
AGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCA21 (0.001347%)
AGCAGCGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGG4 (0.000257%)
AGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGAC32 (0.002052%)
AGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATA4 (0.000257%)
AGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGG47 (0.003015%)
AGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTGCAGAGCTCCCAAGTCACACAAGAACT4 (0.000257%)
AGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGAC14 (0.000898%)
AGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTG30 (0.001924%)
AGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTC5 (0.000321%)
AGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAA3 (0.000192%)
AGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGA5 (0.000321%)
AGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATA7 (0.000449%)
AGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCT4 (0.000257%)
AGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTG23 (0.001475%)
AGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGC35 (0.002245%)
AGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGC17 (0.001090%)
AGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGC10 (0.000641%)
AGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGA14 (0.000898%)
AGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAG4 (0.000257%)
AGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGGAGTAGTAAGTAACTACATGTGAAATAATTCCAAATCCTGG15 (0.000962%)
AGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAG19 (0.001219%)
AGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTG23 (0.001475%)
AGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCG45 (0.002886%)
AGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAAC6 (0.000385%)
AGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTAT3 (0.000192%)
AGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCA3 (0.000192%)
AGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATC4 (0.000257%)
AGCCCGTGCAGCTCTCCAGACTCCGCGGTCTTCCCAGAGGCAAAGGGCTCCCAGGATCCCTCAGAGGTCTTTTTGAACACTTTTACAGCCACGTCTACAG3 (0.000192%)
AGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTC6 (0.000385%)
AGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCC8 (0.000513%)
AGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTG3 (0.000192%)
AGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCA18 (0.001155%)
AGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTC4 (0.000257%)
AGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGA7 (0.000449%)
AGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTGTGATCTGCATTCCAT5 (0.000321%)
AGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAAT19 (0.001804%)
AGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCC6 (0.000385%)
AGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTA5 (0.000321%)
AGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAG4 (0.000257%)
AGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACT11 (0.000706%)
AGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGA10 (0.000641%)
AGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTG14 (0.000898%)
AGCGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAA4 (0.000257%)
AGCGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGAGGACTTTCAGACCACCGAACTTACCACGACCTA14 (0.000898%)
AGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTG52 (0.003335%)
AGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCT3 (0.000192%)
AGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGA10 (0.000641%)
AGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCG3 (0.000192%)
AGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCA30 (0.001924%)
AGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTA3 (0.000192%)
AGCGGTGGCCAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGA3 (0.000192%)
AGCTAATCTAGCTCTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATTCTTATAGGA13 (0.000834%)
AGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACA4 (0.000257%)
AGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGG3 (0.000192%)
AGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGAT7 (0.000449%)
AGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTA3 (0.000192%)
AGCTCAGCCAGGCGCTGGGCCAGGCTCTCGCGCATCTGTTCGCTGTGGGGCGCTAGCTGTGTGCGCAGAGAGTCTACGTGTGTGCGCATGCGGTCGCGAA3 (0.000192%)
AGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGA6 (0.000385%)
AGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGAC6 (0.000385%)
AGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATA7 (0.000449%)
AGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGG5 (0.000321%)
AGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGAGGACTTTCAGACCACCGAACTTACCACGACCTACGCCACGCCTTCTCTCCT6 (0.000385%)
AGCTGACTGGCCAATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTG42 (0.002694%)
AGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCAC3 (0.000192%)
AGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAG16 (0.001026%)
AGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAA20 (0.001283%)
AGCTTCTGGCGCGCGCTCTCCTGCAGCTCGGCGCCCAGAGGCGCCACCTTCTGGCGGTAGAGCTCCACATCCTCTTTCCATTTCTTCTGGAATTCGTCCA3 (0.000192%)
AGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCT3 (0.000192%)
AGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAAC12 (0.000770%)
AGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAA22 (0.001411%)
AGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAG3 (0.000192%)
AGGAAGAGGAAGAAATTCATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGA15 (0.000962%)
AGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTG10 (0.000641%)
AGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACT25 (0.001603%)
AGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTT18 (0.001155%)
AGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATC13 (0.000834%)
AGGAATTGCGATAATTATAGTGGCTGATGTAAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGA4 (0.000257%)
AGGAATTTCGCGACCGCATGCGCACACACGTAGACTCTCTGCGCACACAGCTAGCGCCCCACAGCGAACAGATGCGCGAGAGCCTGGCCCAGCGCCTGGC3 (0.000192%)
AGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGATTTAGTC14 (0.000898%)
AGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTG36 (0.002309%)
AGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATC5 (0.000321%)
AGGACCTTCTGTTCAGGGATGACACCAAATGTTTCGTTAAACTTCCAGAGGGTACCACACCTGAAAAATACTTAGGAGCGGAGTACATGCAATCTGTCGG5 (0.000321%)
AGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCAT5 (0.000321%)
AGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGC6 (0.000385%)
AGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAA6 (0.000385%)
AGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGC4 (0.000257%)
AGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGA12 (0.000770%)
AGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAAT12 (0.000770%)
AGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAA6 (0.000385%)
AGGAGCTGACTGGCCAATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAG10 (0.000641%)
AGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTG34 (0.002181%)
AGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGA12 (0.000770%)
AGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGG15 (0.000962%)
AGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCC12 (0.000770%)
AGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCA6 (0.000385%)
AGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCG3 (0.000192%)
AGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACT3 (0.000192%)
AGGATCTTCAGTGTCTGTGAAAGTGCCCACCATGTCTGCACACACTTCCCAGTTGCTCAGAAGACGGACTCGTCCCTTGGCTGTGGCGCTCATATGACCC4 (0.000257%)
AGGATGACATCTTAGGGTGGTCATTTATGTGTGGGATCTACCACTTTTCCCACAAAGAGGGGGCTCTGAGTGTGTTCTTCAAATATTATGAAAAGGAAAG3 (0.000192%)
AGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCAC28 (0.001796%)
AGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAAT11 (0.000706%)
AGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCA9 (0.000577%)
AGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCT15 (0.000962%)
AGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTT8 (0.000513%)
AGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGA4 (0.000257%)
AGGCCACCACACTCCTATTGTACAAAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTGAGCGTTC3 (0.000192%)
AGGCCATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGAC19 (0.001219%)
AGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACT7 (0.000449%)
AGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACG3 (0.000192%)
AGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTT5 (0.000321%)
AGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTGCAGAGCTCCCAAGTCACACAAGAACTGAC3 (0.000192%)
AGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGA12 (0.000770%)
AGGCGCTGGGCCAGGCTCTCGCGCATCTGTTCGCTGTGGGGCGCTAGCTGTGTGCGCAGAGAGTCTACGTGTGTGCGCATGCGGTCGCGAAATTCCTCAG3 (0.000192%)
AGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGC5 (0.000321%)
AGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCA11 (0.000706%)
AGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGA9 (0.000577%)
AGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTC15 (0.000962%)
AGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGC3 (0.000192%)
AGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTC19 (0.001219%)
AGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGC8 (0.000513%)
AGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGA5 (0.000321%)
AGGCTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTGG3 (0.000192%)
AGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAA3 (0.000192%)
AGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAA5 (0.000321%)
AGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCA7 (0.000449%)
AGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGT8 (0.000513%)
AGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACAC4 (0.000257%)
AGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTA3 (0.000192%)
AGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAG9 (0.000577%)
AGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGT3 (0.000192%)
AGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTT9 (0.000577%)
AGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTGAGAAAAAAAGACATGAAGACT5 (0.000321%)
AGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCA17 (0.001090%)
AGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGA6 (0.000385%)
AGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCT6 (0.000385%)
AGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGAT9 (0.000577%)
AGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAG7 (0.000449%)
AGGTCCCGTACCCACAGCGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGAGGACTTTCAGACCACCGA5 (0.000321%)
AGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAA3 (0.000192%)
AGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGATGACGAGACGTAATT3 (0.000192%)
AGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACT234 (0.015009%)
AGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCA15 (0.000962%)
AGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTG5 (0.000321%)
AGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGG3 (0.000192%)
AGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACA5 (0.000321%)
AGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGA5 (0.000321%)
AGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTT13 (0.000834%)
AGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTA5 (0.000321%)
AGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCT3 (0.000192%)
AGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACA14 (0.000898%)
AGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCC5 (0.000321%)
AGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAA8 (0.000513%)
AGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATC4 (0.000257%)
AGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCA22 (0.001411%)
AGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCG4 (0.000257%)
AGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCC20 (0.001283%)
AGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGT11 (0.000706%)
AGTAGGTCCCGTACCCACAGCGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGAGGACTTTCAGACCAC6 (0.000385%)
AGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGC8 (0.000513%)
AGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGC7 (0.000449%)
AGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACG5 (0.000321%)
AGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTC9 (0.000577%)
AGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTA77 (0.004939%)
AGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGG10 (0.000641%)
AGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCT5 (0.000321%)
AGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTG3 (0.000192%)
AGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCA10 (0.000641%)
AGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAA4 (0.000257%)
AGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTC3 (0.000192%)
AGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTA5 (0.000321%)
AGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAG18 (0.001155%)
AGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGG4 (0.000257%)
AGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGAC5 (0.000321%)
AGTGGAACCATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTG15 (0.000962%)
AGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACT5 (0.000321%)
AGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCAC8 (0.000513%)
AGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACT30 (0.001924%)
AGTGGCTGATGTAAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATT3 (0.000192%)
AGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAG3 (0.000192%)
AGTGGGTAACCTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTA26 (0.001668%)
AGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCA6 (0.000385%)
AGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTG3 (0.000192%)
AGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTG9 (0.000577%)
AGTTAGAAGAATAAGTGGAATTATGTGAAGGGCTATTAGTGTTAGTTCTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGT7 (0.000449%)
AGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATT3 (0.000192%)
AGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAA14 (0.000898%)
AGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAA7 (0.000449%)
AGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGG5 (0.000321%)
AGTTCCCCTACCAATACCACACCCATTAATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCCATTCTATGATCA4 (0.000257%)
AGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAAC10 (0.000641%)
AGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAG6 (0.000385%)
AGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTT3 (0.000192%)
AGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCA5 (0.000321%)
AGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTT4 (0.000257%)
AGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGT5 (0.000321%)
AGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCT3 (0.000192%)
AGTTTGTGTCGGAAGCCTGTAATTACGGCTCCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTA5 (0.000321%)
ATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCA19 (0.001219%)
ATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTTGACACCGGTAGGAATTGCGA41 (0.002630%)
ATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGA5 (0.000321%)
ATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTC4 (0.000257%)
ATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAA10 (0.000641%)
ATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTTGACACCGGTAGG3 (0.000192%)
ATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCA3 (0.000192%)
ATAAGAATTAAGATGATTGAGAAGTATGAGATGGAGGCTAGTTGGCCAATGATAATAAATGGGTGTTCTACTGGTTGGCCCCCAATTCAGGTTAAGATAA7 (0.000449%)
ATAAGTGGAATTATGTGAAGGGCTATTAGTGTTAGTTCTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAA4 (0.000257%)
ATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACC7 (0.000449%)
ATAATTCCTGAGATTGGTATAAGAATTAAGATGATTGAGAAGTATGAGATGGAGGCTAGTTGGCCAATGATAATAAATGGGTGTTCTACTGGTTGGCCCC6 (0.000385%)
ATAATTGTTTCCCTAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTA4 (0.000257%)
ATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCA8 (0.000513%)
ATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTC14 (0.000898%)
ATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAA5 (0.000321%)
ATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAG5 (0.000321%)
ATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGA7 (0.000449%)
ATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAG6 (0.000385%)
ATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAA6 (0.000385%)
ATACGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAA7 (0.000449%)
ATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACAT25 (0.001603%)
ATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTG10 (0.000641%)
ATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACAC9 (0.000577%)
ATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGGTGGAGTC7 (0.000449%)
ATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACG5 (0.000321%)
ATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTG8 (0.000513%)
ATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAG18 (0.001155%)
ATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAA3 (0.000192%)
ATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTCGGAA7 (0.000449%)
ATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAAC8 (0.000513%)
ATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTG7 (0.000449%)
ATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTA6 (0.000385%)
ATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCA11 (0.000706%)
ATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGAT20 (0.001283%)
ATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAG11 (0.000706%)
ATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTT17 (0.001090%)
ATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCC4 (0.000257%)
ATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTG4 (0.000257%)
ATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCACCCAGCGCAGGTAAT9 (0.000577%)
ATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTC9 (0.000577%)
ATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGA3 (0.000192%)
ATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGG3 (0.000192%)
ATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCC28 (0.001796%)
ATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAG4 (0.000257%)
ATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTG4 (0.000257%)
ATATGGGCTCCTGATTCTCATGAAATACCCAGAAATTGAAGAGAAACTTCATGAAGAAATTGACAGGGTTATTGGGCCAAGCCGTGCCCCTGCAGTCCGA3 (0.000192%)
ATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAG9 (0.000577%)
ATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGGAGTAGTA3 (0.000192%)
ATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCA25 (0.001603%)
ATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCT11 (0.000706%)
ATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAG6 (0.000385%)
ATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCAT28 (0.001796%)
ATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAA4 (0.000257%)
ATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATCCTAATCATATTCTTA4 (0.000257%)
ATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAAT7 (0.000449%)
ATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGA18 (0.001155%)
ATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCC3 (0.000192%)
ATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCA14 (0.000898%)
ATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCAT4 (0.000257%)
ATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCG19 (0.001219%)
ATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAG16 (0.001026%)
ATCAGAATTAGTATCAGGGTTTAACGTAGAATACGCAGCCGGCCCATTCGCGTTATTCTTTATAGCAGAGTACACTAACATTATTCTAATAAACGCCCTA210 (0.013469%)
ATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTG55 (0.003528%)
ATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGAT13 (0.000834%)
ATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCC5 (0.000321%)
ATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGA14 (0.000898%)
ATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCA30 (0.001924%)
ATCAGGGTTTAACGTAGAATACGCAGCCGGCCCATTCGCGTTATTCTTTATAGCAGAGTACACTAACATTATTCTAATAAACGCCCTAACAACTATTATC8 (0.000513%)
ATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGG37 (0.002373%)
ATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCA3 (0.000192%)
ATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAA8 (0.000513%)
ATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCG15 (0.000962%)
ATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCA5 (0.000321%)
ATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCC3 (0.000192%)
ATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCA48 (0.003079%)
ATCCAAGTCCATGACCATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCT334 (0.021423%)
ATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTT15 (0.000962%)
ATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGG32 (0.002052%)
ATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAG10 (0.000641%)
ATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGAT3 (0.000192%)
ATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAA9 (0.000577%)
ATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAA9 (0.000577%)
ATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTT11 (0.000706%)
ATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGA6 (0.000385%)
ATCCTATTCCCTACCAAAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGA16 (0.001026%)
ATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCT4 (0.000257%)
ATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACC5 (0.000321%)
ATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCT21 (0.001347%)
ATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAAT12 (0.000770%)
ATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGC11 (0.000706%)
ATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGAC3 (0.000192%)
ATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCA25 (0.001603%)
ATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCG14 (0.000898%)
ATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTGGAGAGCATAC5 (0.000321%)
ATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATAC16 (0.001026%)
ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGACGAA15 (0.000385%)
ATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAG5 (0.000321%)
ATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCC12 (0.000770%)
ATCGTACTGGAAGACACTTGGCATTTCCCCGTTCCATGAATTCGCGGATGTGGTTTTCACAGCCAACGACTCTGGCCATCGCCACTACACCATCGCAGCC4 (0.000257%)
ATCGTTCACCTCCTCTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCA8 (0.000513%)
ATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCC8 (0.000513%)
ATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCT46 (0.002950%)
ATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAA11 (0.000706%)
ATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCA5 (0.000321%)
ATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTAT11 (0.000706%)
ATCTAGCTCTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATTCTTATAGGAATTAA8 (0.000513%)
ATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGT20 (0.001283%)
ATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTG6 (0.000385%)
ATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTT3 (0.000192%)
ATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGA3 (0.000192%)
ATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATA7 (0.000449%)
ATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAAT3 (0.000192%)
ATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCA4 (0.000257%)
ATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAAT7 (0.000449%)
ATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCG6 (0.000385%)
ATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAG7 (0.000449%)
ATCTTCCTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAG11 (0.000706%)
ATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTA14 (0.000898%)
ATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAA6 (0.000385%)
ATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGC5 (0.000321%)
ATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACAC4 (0.000257%)
ATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTT4 (0.000257%)
ATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACGAGAAGTA27 (0.001732%)
ATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAG7 (0.000449%)
ATGAACCCTAATAATTGTTTCCCTAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATA20 (0.001283%)
ATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTG3 (0.000192%)
ATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAA9 (0.000577%)
ATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGT4 (0.000257%)
ATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCT17 (0.001090%)
ATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAA42 (0.002694%)
ATGAAGTGGGTAACCTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATC10 (0.000641%)
ATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGA11 (0.000706%)
ATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAA3 (0.000192%)
ATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCA7 (0.000449%)
ATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACG4 (0.000257%)
ATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGC10 (0.000641%)
ATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATA13 (0.000834%)
ATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTG13 (0.000834%)
ATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTT8 (0.000513%)
ATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCA5 (0.000321%)
ATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCA11 (0.000706%)
ATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTAT37 (0.002373%)
ATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGG6 (0.000385%)
ATGAGTTCCCCTACCAATACCACACCCATTAATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCCATTCTATGA5 (0.000321%)
ATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTA4 (0.000257%)
ATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTG25 (0.001603%)
ATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGAT5 (0.000321%)
ATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCA12 (0.000770%)
ATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTT9 (0.000577%)
ATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTAT4 (0.000257%)
ATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTG11 (0.000706%)
ATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCT7 (0.000449%)
ATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGA6 (0.000385%)
ATGCGCGAGAGCCTGGCCCAGCGCCTGGCTGAGCTCAAGAGCAACCCTACCTTGAACGAGTACCACACCAGGGCCAAAACCCACCTGAAGACACTTGGCG3 (0.000192%)
ATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCC5 (0.000321%)
ATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGT6 (0.000385%)
ATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTAC5 (0.000321%)
ATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGC3 (0.000192%)
ATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATT4 (0.000257%)
ATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAG33 (0.002117%)
ATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTT6 (0.000385%)
ATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATA9 (0.000577%)
ATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAG13 (0.000834%)
ATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGT3 (0.000192%)
ATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAG5 (0.000321%)
ATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGG6 (0.000385%)
ATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGG30 (0.001924%)
ATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCT24 (0.001539%)
ATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCC7 (0.000449%)
ATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAA19 (0.001219%)
ATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGA13 (0.000834%)
ATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGC32 (0.002052%)
ATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTGTGATCTG6 (0.000385%)
ATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGT8 (0.000513%)
ATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGC14 (0.000898%)
ATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGATTTAGTCGGCCTG4 (0.000257%)
ATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGA6 (0.000385%)
ATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAG3 (0.000192%)
ATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGA16 (0.001026%)
ATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGAT3 (0.000192%)
ATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGT7 (0.000449%)
ATGTAAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATAC15 (0.000962%)
ATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCA3 (0.000192%)
ATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTTTGTTT4 (0.000257%)
ATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCA5 (0.000321%)
ATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCT16 (0.001026%)
ATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGA4 (0.000257%)
ATGTGAAGGGCTATTAGTGTTAGTTCTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAATAATTATGTATA3 (0.000192%)
ATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGT4 (0.000257%)
ATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTT8 (0.000513%)
ATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCA4 (0.000257%)
ATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACA4 (0.000257%)
ATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGG5 (0.000321%)
ATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGA27 (0.001732%)
ATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGG4 (0.000257%)
ATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCAC3 (0.000192%)
ATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGA3 (0.000192%)
ATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTATCCTAATTT7 (0.000449%)
ATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTTGGCCTGGCTCT3 (0.000192%)
ATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACA9 (0.000577%)
ATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGAC18 (0.001155%)
ATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGG3 (0.000192%)
ATTAAGATGATTGAGAAGTATGAGATGGAGGCTAGTTGGCCAATGATAATAAATGGGTGTTCTACTGGTTGGCCCCCAATTCAGGTTAAGATAAGTAGGT13 (0.000834%)
ATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTC16 (0.001026%)
ATTAATTGCAGCACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTT512 (0.032839%)
ATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCCATTCTATGATCAGGATGAGCCTCAAACTCCAAATACTCAC7 (0.000449%)
ATTACGGCTCCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTG7 (0.000449%)
ATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGT13 (0.000834%)
ATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTC20 (0.001283%)
ATTAGTGTTAGTTCTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAATAATTATGTATATTGAGTATATAC13 (0.000834%)
ATTATAGTGGCTGATGTAAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACA6 (0.000385%)
ATTATCCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTA117 (0.007504%)
ATTATGTGAAGGGCTATTAGTGTTAGTTCTCGTGTGTGTGAGGGTTGGAGGTTAATTATATGGTTGGTTAGTTTGCCGCGTTGGGTGGTAATAATTATGT3 (0.000192%)
ATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCC46 (0.002950%)
ATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTC28 (0.001796%)
ATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGAC19 (0.001219%)
ATTCAGAAGGAAGGATGACATCTTAGGGTGGTCATTTATGTGTGGGATCTACCACTTTTCCCACAAAGAGGGGGCTCTGAGTGTGTTCTTCAAATATTAT13 (0.000834%)
ATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATC26 (0.001668%)
ATTCATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGG11 (0.000706%)
ATTCATTGACCTACCTGCCCCATCCAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTC13 (0.000834%)
ATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACC10 (0.000641%)
ATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCT12 (0.000770%)
ATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGA6 (0.000385%)
ATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCC17 (0.001090%)
ATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGAT20 (0.001283%)
ATTCCCTACCAAAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTT22 (0.001411%)
ATTCCTGAAAGGCCCAGGAAATGTTGAGGGAAGAATGTTATGTTTACTCCTACGAATATGATGGCGAAGTGGGCTTTTGCTCATGTGTCATCTAGGGTGA19 (0.001219%)
ATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATA36 (0.002309%)
ATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTAC5 (0.000321%)
ATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGA5 (0.000321%)
ATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACAC30 (0.001924%)
ATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGC8 (0.000513%)
ATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCA3 (0.000192%)
ATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGA57 (0.003656%)
ATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAAC4 (0.000257%)
ATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAAT75 (0.004810%)
ATTGACCTACCTGCCCCATCCAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAG17 (0.001090%)
ATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCAT25 (0.001603%)
ATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCAC12 (0.000770%)
ATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGA17 (0.001090%)
ATTGCAGCACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATG42 (0.002694%)
ATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGG10 (0.000641%)
ATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGC5 (0.000321%)
ATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGAC6 (0.000385%)
ATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAA15 (0.000962%)
ATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGT23 (0.001475%)
ATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGAT15 (0.000962%)
ATTGGGTCCCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATA35 (0.002245%)
ATTGGTATAAGAATTAAGATGATTGAGAAGTATGAGATGGAGGCTAGTTGGCCAATGATAATAAATGGGTGTTCTACTGGTTGGCCCCCAATTCAGGTTA12 (0.000770%)
ATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACA25 (0.001603%)
ATTGTACAAAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTGAGCGTTCTATCATTCTAGCCTCG6 (0.000385%)
ATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTT8 (0.000513%)
ATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTG4 (0.000257%)
ATTGTTTCCCTAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAG4 (0.000257%)
ATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTA8 (0.000513%)
ATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAG36 (0.002309%)
ATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAA7 (0.000449%)
ATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCA26 (0.001668%)
ATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTT33 (0.002117%)
ATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTAGGGTT11 (0.000706%)
ATTTCAACTAAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACG581 (0.037265%)
ATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTT43 (0.002758%)
ATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCCATACACTACACATCAGATACAA4 (0.000257%)
ATTTCCTCCACAAACTCTAAGTATTCTTAATTCTTTAGTTTACCTGTCAATCAACCCTCAGATCAAGGATATGAACAATAAAGTTCACATCCAGATTCTT32 (0.002052%)
ATTTCGCGACCGCATGCGCACACACGTAGACTCTCTGCGCACACAGCTAGCGCCCCACAGCGAACAGATGCGCGAGAGCCTGGCCCAGCGCCTGGCTGAG3 (0.000192%)
ATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGAT11 (0.000706%)
ATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAA22 (0.001411%)
ATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCA20 (0.001283%)
ATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCT72 (0.004618%)
ATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGA31 (0.001988%)
ATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCC5 (0.000321%)
ATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGA21 (0.001347%)
ATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTG9 (0.000577%)
ATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTC16 (0.001026%)
ATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAAT31 (0.001988%)
ATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTAC5 (0.000321%)
ATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAA28 (0.001796%)
ATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGC13 (0.000834%)
ATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCC8 (0.000513%)
ATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACT56 (0.003592%)
ATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTA57 (0.003656%)
ATTTTTCCTTTCCATATGCAGCATATTGTGAGCAGACTCTGTTTGACATGGTGGTGAGAAGTGACAAATGCTTCATCTGGAGTCTCTCCTTCACAAAGCA6 (0.000385%)
CAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTC19 (0.001219%)
CAAAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTGAGCGTTCTATCATTCTAGCCTCGTACCAA12 (0.000770%)
CAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCAC42 (0.002694%)
CAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCA37 (0.002373%)
CAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTA213 (0.013662%)
CAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACG30 (0.001924%)
CAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCCA14 (0.000898%)
CAAAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAA7 (0.000449%)
CAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGT103 (0.006606%)
CAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCAT11 (0.000706%)
CAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTGAGAAAAAAAGACATGAAGACTCAGGAC12 (0.000770%)
CAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTT75 (0.004810%)
CAAACTCTAAGTATTCTTAATTCTTTAGTTTACCTGTCAATCAACCCTCAGATCAAGGATATGAACAATAAAGTTCACATCCAGATTCTTATTCTCAGTG10 (0.000641%)
CAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCT13 (0.000834%)
CAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTT81 (0.005195%)
CAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTAC4 (0.000257%)
CAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGC5 (0.000321%)
CAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGC69 (0.004426%)
CAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTAT46 (0.002950%)
CAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAGCAGCTGACACCCCTTGTCAGGTCA6 (0.000385%)
CAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTGCAGAGCT3 (0.000192%)
CAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCC10 (0.000641%)
CAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTG32 (0.002052%)
CAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGA14 (0.000898%)
CAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCT7 (0.000449%)
CAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCC33 (0.002117%)
CAAATCGTACTGGAAGACACTTGGCATTTCCCCGTTCCATGAATTCGCGGATGTGGTTTTCACAGCCAACGACTCTGGCCATCGCCACTACACCATCGCA3 (0.000192%)
CAAATCTTTGCCATAATCAGTCATGCTCTGAAAGTATTGAGTGAACAGGCTCTGCATATCCGGTCCGTCTGCCTGTCTCTTAACCAAAGCTCCTTCCAGG9 (0.000577%)
CAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTT13 (0.000834%)
CAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTG95 (0.006093%)
CAAATTCTCCTAATCATAACCTTTTCAGCAACTGAACTAATTATATTTTATATTTTATTTGAAGCAACCTTAATCCCAACACTTATTATTATTACCCGAT4 (0.000257%)
CAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGT22 (0.001411%)
CAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCAC33 (0.002117%)
CAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAA12 (0.000770%)
CAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCAT89 (0.005708%)
CAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCA9 (0.000577%)
CAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCC50 (0.003207%)
CAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTGT6 (0.000385%)
CAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTTT9 (0.000577%)
CAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCCATACACTACACATCAGAT26 (0.001668%)
CAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTGCAGAGCTCCCAA4 (0.000257%)
CAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGAT25 (0.001603%)
CAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAG428 (0.027452%)
CAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCTAAA14 (0.000898%)
CAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTA24 (0.001539%)
CAACCCCGTATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCA17 (0.001090%)
CAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTTT8 (0.000513%)
CAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTT21 (0.001347%)
CAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTGCAGAGCTCCCAAGTCA7 (0.000449%)
CAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGC14 (0.000898%)
CAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGT8 (0.000513%)
CAACCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAAACCCTCAACAGACCAGACAGTGAGCTGCAGCTGAGCACAGGC10 (0.000641%)
CAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCC26 (0.001668%)
CAACGCAGTAGGTCCCGTACCCACAGCGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGAGGACTTTCA64 (0.004105%)
CAACTACATACCAGCTAATCCACTAAACACCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAA244 (0.015650%)
CAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTC15 (0.000962%)
CAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCT26 (0.001668%)
CAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGA11 (0.000706%)
CAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTC39 (0.002501%)
CAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTG31 (0.001988%)
CAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTTGAC4 (0.000257%)
CAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACA23 (0.001475%)
CAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAA22 (0.001411%)
CAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTC41 (0.002630%)
CAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAAT14 (0.000898%)
CAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGG28 (0.001796%)
CAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGT15 (0.000962%)
CAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCC58 (0.003720%)
CAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGC150 (0.009621%)
CAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTT99 (0.006350%)
CAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGC144 (0.009236%)
CAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGG405 (0.025976%)
CAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCT8 (0.000513%)
CAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGC7 (0.000449%)
CAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTC91 (0.005837%)
CAAGCCCTACTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATG7 (0.000449%)
CAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCG10 (0.000641%)
CAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGGTTCTACATTCTTCATGGCTACTGGATTCCATGGACTCCATGTAATTA5 (0.000321%)
CAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATA59 (0.003784%)
CAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGG33 (0.002117%)
CAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGA32 (0.002052%)
CAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCC15 (0.000962%)
CAAGGACCTTCTGTTCAGGGATGACACCAAATGTTTCGTTAAACTTCCAGAGGGTACCACACCTGAAAAATACTTAGGAGCGGAGTACATGCAATCTGTC7 (0.000449%)
CAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTG17 (0.001090%)
CAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCC183 (0.011737%)
CAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTA13 (0.000834%)
CAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTG9 (0.000577%)
CAAGGCCACCACACTCCTATTGTACAAAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTGAGCGT8 (0.000513%)
CAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACT68 (0.004361%)
CAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTT13 (0.000834%)
CAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGG9 (0.000577%)
CAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTTGGC4 (0.000257%)
CAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTG82 (0.005259%)
CAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAG48 (0.003079%)
CAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGC63 (0.004041%)
CAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTC34 (0.002181%)
CAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCA31 (0.001988%)
CAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAA7 (0.000449%)
CAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGCT28 (0.001796%)
CAATACCACACCCATTAATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCCATTCTATGATCAGGATGAGCCTC12 (0.000770%)
CAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACAC13 (0.000834%)
CAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGGAGTAGTAAGTAACTACATGTGAAATAATTCCAAATCCTGGGAG4 (0.000257%)
CAATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCT8 (0.000513%)
CAATCCTATTCCCTACCAAAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAG36 (0.002309%)
CAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAG52 (0.003335%)
CAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTT105 (0.006735%)
CAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCAT11 (0.000706%)
CAATCGTTCACCTCCTCTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAAT34 (0.002181%)
CAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGC4 (0.000257%)
CAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCT14 (0.000898%)
CAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGG7 (0.000449%)
CAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCA6 (0.000385%)
CAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGATTTAGTCGGCC7 (0.000449%)
CAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTT17 (0.001090%)
CAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATC11 (0.000706%)
CAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTG31 (0.001988%)
CAATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCT31 (0.001988%)
CACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTC8 (0.000513%)
CACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACT17 (0.001090%)
CACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGC8 (0.000513%)
CACAACTCTGAGATATGGGCTCCTGATTCTCATGAAATACCCAGAAATTGAAGAGAAACTTCATGAAGAAATTGACAGGGTTATTGGGCCAAGCCGTGCC4 (0.000257%)
CACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTA31 (0.001988%)
CACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCT53 (0.003399%)
CACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGG39 (0.002501%)
CACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAG20 (0.001283%)
CACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAAACCCTCAACAGACCAGACAGTGAGCTGCAGCTGAGCACAGGCAATGGC6 (0.000385%)
CACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCAC8 (0.000513%)
CACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGA14 (0.000898%)
CACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTC19 (0.001219%)
CACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTT129 (0.008274%)
CACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCT16 (0.001026%)
CACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGC8 (0.000513%)
CACACCCATTAATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCCATTCTATGATCAGGATGAGCCTCAAACTC4 (0.000257%)
CACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTT9 (0.000577%)
CACACGTCTGAACTCCAGTCACGCGACGAATTATCTCGTA10 (0.000257%)
CACACTCCTATTGTACAAAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTGAGCGTTCTATCATT21 (0.001347%)
CACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACG14 (0.000898%)
CACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTC39 (0.002501%)
CACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACA103 (0.006606%)
CACAGAACAGTTTGCCAGCGGGGTGGGGTCCAAAGCATGGCAAGTGGTCTCCAGTGTGTCAACTTCCATCTCATACACCACTCCGAAGGGCCGCCGAGAC43 (0.002758%)
CACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTT108 (0.006927%)
CACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGAC12 (0.000770%)
CACAGCGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGAGGACTTTCAGACCACCGAACTTACCACGAC3 (0.000192%)
CACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTC22 (0.001411%)
CACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGAT20 (0.001283%)
CACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAA36 (0.002309%)
CACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTA61 (0.003912%)
CACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCA25 (0.001603%)
CACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTAC3 (0.000192%)
CACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAA3 (0.000192%)
CACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTAC16 (0.001026%)
CACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGG13 (0.000834%)
CACATTACGTGGATGTCCTTGATGCTTCGAGGTGGCCCGCCAGGTGCTCAGGAGAACGTGGTCTTCAACTTCTCCTTCACTTTGCCAAATGCCTCTGAGA3 (0.000192%)
CACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTC13 (0.000834%)
CACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATG9 (0.000577%)
CACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTT11 (0.000706%)
CACCAAGGACCTTCTGTTCAGGGATGACACCAAATGTTTCGTTAAACTTCCAGAGGGTACCACACCTGAAAAATACTTAGGAGCGGAGTACATGCAATCT565 (0.036239%)
CACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACC11 (0.000706%)
CACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGAC4 (0.000257%)
CACCACACTCCTATTGTACAAAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTGAGCGTTCTATC9 (0.000577%)
CACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCG4 (0.000257%)
CACCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCAC37 (0.002373%)
CACCAGCACAACTCTGAGATATGGGCTCCTGATTCTCATGAAATACCCAGAAATTGAAGAGAAACTTCATGAAGAAATTGACAGGGTTATTGGGCCAAGC102 (0.006542%)
CACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATG3 (0.000192%)
CACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTG29 (0.001860%)
CACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACA7 (0.000449%)
CACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGG22 (0.001411%)
CACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAG7 (0.000449%)
CACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTAC8 (0.000513%)
CACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAG4 (0.000257%)
CACCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTA3 (0.000192%)
CACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACG3 (0.000192%)
CACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCA10 (0.000641%)
CACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTG10 (0.000641%)
CACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCG11 (0.000706%)
CACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCG7 (0.000449%)
CACCTCCTCTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATA8 (0.000513%)
CACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTAT8 (0.000513%)
CACCTCGTTGCGGTACTGCCCGAGTCGGTTGCGTAGATCCTCCATGTCGGCTCCGAGTCGGGCCTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGT335 (0.021487%)
CACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCC7 (0.000449%)
CACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTC9 (0.000577%)
CACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTGAGAA6 (0.000385%)
CACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCC9 (0.000577%)
CACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACA7 (0.000449%)
CACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTG10 (0.000641%)
CACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATCCTAA3 (0.000192%)
CACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTT54 (0.003464%)
CACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAG14 (0.000898%)
CACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTG71 (0.004554%)
CACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGC9 (0.000577%)
CACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACT21 (0.001347%)
CACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAA8 (0.000513%)
CACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGT30 (0.001924%)
CACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTT9 (0.000577%)
CACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGC77 (0.004939%)
CACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGT15 (0.000962%)
CACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGC30 (0.001924%)
CACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCCAATCGTT34 (0.002181%)
CACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTC5 (0.000321%)
CACTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAAT3 (0.000192%)
CACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAG23 (0.001475%)
CACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTG6 (0.000385%)
CACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAG6 (0.000385%)
CACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACA18 (0.001155%)
CACTCATTCATTGACCTACCTGCCCCATCCAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTC15 (0.000962%)
CACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTT5 (0.000321%)
CACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGC6 (0.000385%)
CACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTC7 (0.000449%)
CACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATAT4 (0.000257%)
CACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAA8 (0.000513%)
CACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTC67 (0.004297%)
CACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCAT7 (0.000449%)
CACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTC7 (0.000449%)
CACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCA6 (0.000385%)
CACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACAC14 (0.000898%)
CACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATA4 (0.000257%)
CACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACGAGAAGTAATATCA3 (0.000192%)
CACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGAT7 (0.000449%)
CACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTG11 (0.000706%)
CACTGTTCCTAGGCCATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAG554 (0.035533%)
CACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGT9 (0.000577%)
CACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTG8 (0.000513%)
CACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCAT7 (0.000449%)
CACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGA4 (0.000257%)
CACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCA9 (0.000577%)
CACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGT11 (0.000706%)
CACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATG6 (0.000385%)
CACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGAT9 (0.000577%)
CACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTT8 (0.000513%)
CAGAAAAGGCTGGTGAATATTCTGTGACGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAA6 (0.000385%)
CAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGAC69 (0.004426%)
CAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAA44 (0.002822%)
CAGAAATTGCCGGTGCAGTCACTTCCCCCAAATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACAT34 (0.002181%)
CAGAACAGTTTGCCAGCGGGGTGGGGTCCAAAGCATGGCAAGTGGTCTCCAGTGTGTCAACTTCCATCTCATACACCACTCCGAAGGGCCGCCGAGACCA3 (0.000192%)
CAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGT22 (0.001411%)
CAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGC17 (0.001090%)
CAGAAGGAAGGATGACATCTTAGGGTGGTCATTTATGTGTGGGATCTACCACTTTTCCCACAAAGAGGGGGCTCTGAGTGTGTTCTTCAAATATTATGAA6 (0.000385%)
CAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAG15 (0.000962%)
CAGAATTAGTATCAGGGTTTAACGTAGAATACGCAGCCGGCCCATTCGCGTTATTCTTTATAGCAGAGTACACTAACATTATTCTAATAAACGCCCTAAC7 (0.000449%)
CAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATAGATGACACTCCAG8 (0.000513%)
CAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGG176 (0.011289%)
CAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGT52 (0.003335%)
CAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCG109 (0.006991%)
CAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCG105 (0.006735%)
CAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACC10 (0.000641%)
CAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGC22 (0.001411%)
CAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCC16 (0.001026%)
CAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCA18 (0.001155%)
CAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTTGAGTTC7 (0.000449%)
CAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATT63 (0.004041%)
CAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAG40 (0.002566%)
CAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGA15 (0.000962%)
CAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTG59 (0.003784%)
CAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTT175 (0.011224%)
CAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCT191 (0.012251%)
CAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGA55 (0.003528%)
CAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGG9 (0.000577%)
CAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTTGAGAAGACACACGAGCAGC8 (0.000513%)
CAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCAT22 (0.001411%)
CAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCA13 (0.000834%)
CAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCG9 (0.000577%)
CAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGG69 (0.004426%)
CAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAAC8 (0.000513%)
CAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCC33 (0.002117%)
CAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGG17 (0.001090%)
CAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGG15 (0.000962%)
CAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCA37 (0.002373%)
CAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTC19 (0.001219%)
CAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCA6 (0.000385%)
CAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGC14 (0.000898%)
CAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAC3421 (0.087768%)
CAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGC319 (0.020460%)
CAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTA8 (0.000513%)
CAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGC15 (0.000962%)
CAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCC8 (0.000513%)
CAGATTACAGTTTAATGGTTTGAGGGTAGCAGATGAGTCTGAGACTCAGACCACACAGGGAATGTTTACTGCGCAATCCCAATCACTCCACAGGCCAAGCGGCTCCCAGCATTTCCAGTCTTTGTACTTTCTTCATTTCCACCTTTGC2 (0.000190%)
CAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTG48 (0.003079%)
CAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATT20 (0.001283%)
CAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGG11 (0.000706%)
CAGCAACCATAGATAATTCGGAGCACTCTTCATCTCTTACAGTATGGAATTTAAGAACTAAGGATTTCTCCAAGACATGGATTTGCTCCAGAAAAAGTCT31 (0.001988%)
CAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGC48 (0.003079%)
CAGCACAGAGACAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTT63 (0.004041%)
CAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATG24 (0.001539%)
CAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCT15 (0.000962%)
CAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCT16 (0.001026%)
CAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGC59 (0.003784%)
CAGCAGCGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTG507 (0.032519%)
CAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGA64 (0.004105%)
CAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAG72 (0.004618%)
CAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGA7 (0.000449%)
CAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGAC23 (0.001475%)
CAGCCAGCCAATGCCAACGCAGTAGGTCCCGTACCCACAGCGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTC9 (0.000577%)
CAGCCAGGCGCTGGGCCAGGCTCTCGCGCATCTGTTCGCTGTGGGGCGCTAGCTGTGTGCGCAGAGAGTCTACGTGTGTGCGCATGCGGTCGCGAAATTC11 (0.000706%)
CAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATC7 (0.000449%)
CAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAA72 (0.004618%)
CAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGAGGACTTTCAGACCACCGAACTTACCACGACCTACGCCACGC7 (0.000449%)
CAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCT61 (0.003912%)
CAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCC17 (0.001090%)
CAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAG6 (0.000385%)
CAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTG221 (0.014175%)
CAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGC30 (0.001924%)
CAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCT15 (0.000962%)
CAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCC181 (0.011609%)
CAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTC38 (0.002437%)
CAGCCTTGATTTTTCCTTTCCATATGCAGCATATTGTGAGCAGACTCTGTTTGACATGGTGGTGAGAAGTGACAAATGCTTCATCTGGAGTCTCTCCTTC5 (0.000321%)
CAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAG103 (0.006606%)
CAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGGCTGACAT7 (0.000449%)
CAGCGAACAGATGCGCGAGAGCCTGGCCCAGCGCCTGGCTGAGCTCAAGAGCAACCCTACCTTGAACGAGTACCACACCAGGGCCAAAACCCACCTGAAG4 (0.000257%)
CAGCGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGAGGACTTTCAGACCACCGAACTTACCACGACCT4 (0.000257%)
CAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCC13 (0.000834%)
CAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCC53 (0.003399%)
CAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTG19 (0.001219%)
CAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGA31 (0.001988%)
CAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCT10 (0.000641%)
CAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAG6 (0.000385%)
CAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTA32 (0.002052%)
CAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACC15 (0.000962%)
CAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCT7 (0.000449%)
CAGCTTCTGGCGCGCGCTCTCCTGCAGCTCGGCGCCCAGAGGCGCCACCTTCTGGCGGTAGAGCTCCACATCCTCTTTCCATTTCTTCTGGAATTCGTCC3 (0.000192%)
CAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATG25 (0.001603%)
CAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCA4 (0.000257%)
CAGGAAGAGGAAGAAATTCATGAAAAATTGTCATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGG13 (0.000834%)
CAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAAC41 (0.002630%)
CAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGT83 (0.005324%)
CAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCAT35 (0.002245%)
CAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAA6 (0.000385%)
CAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATCCTAATCATATT5 (0.000321%)
CAGGATCTTCAGTGTCTGTGAAAGTGCCCACCATGTCTGCACACACTTCCCAGTTGCTCAGAAGACGGACTCGTCCCTTGGCTGTGGCGCTCATATGACC4 (0.000257%)
CAGGATGAGGCTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGA6 (0.000385%)
CAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCC52 (0.003335%)
CAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGA6 (0.000385%)
CAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTT74 (0.004746%)
CAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATAC4 (0.000257%)
CAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCT21 (0.001347%)
CAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTGCAGAGCTCCCAAGTCACACAAGAACTGA9 (0.000577%)
CAGGCCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTAC10 (0.000641%)
CAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTG38 (0.002437%)
CAGGCGCTGGGCCAGGCTCTCGCGCATCTGTTCGCTGTGGGGCGCTAGCTGTGTGCGCAGAGAGTCTACGTGTGTGCGCATGCGGTCGCGAAATTCCTCA7 (0.000449%)
CAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAG16 (0.001026%)
CAGGCTCTCGCGCATCTGTTCGCTGTGGGGCGCTAGCTGTGTGCGCAGAGAGTCTACGTGTGTGCGCATGCGGTCGCGAAATTCCTCAGCCACAGGGGAC6 (0.000385%)
CAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACC3 (0.000192%)
CAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGG7 (0.000449%)
CAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTC49 (0.003143%)
CAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGG614 (0.039382%)
CAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACA140 (0.008980%)
CAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACA18 (0.001155%)
CAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGT30 (0.001924%)
CAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGC13 (0.000834%)
CAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTT23 (0.001475%)
CAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCT11 (0.000706%)
CAGGGTGCCCCTCCAACCAGGATGAGGCTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGG289 (0.018536%)
CAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGC22 (0.001411%)
CAGGGTTTAACGTAGAATACGCAGCCGGCCCATTCGCGTTATTCTTTATAGCAGAGTACACTAACATTATTCTAATAAACGCCCTAACAACTATTATCTT8 (0.000513%)
CAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGA7 (0.000449%)
CAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGATGACGAGACGTAAT410 (0.026297%)
CAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGG61 (0.003912%)
CAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCT29 (0.001860%)
CAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTC35 (0.002245%)
CAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGC10 (0.000641%)
CAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATT4 (0.000257%)
CAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGG4 (0.000257%)
CAGTAGGTCCCGTACCCACAGCGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGAGGACTTTCAGACCA4 (0.000257%)
CAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTG5 (0.000321%)
CAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACT26 (0.001668%)
CAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTT7 (0.000449%)
CAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTC6 (0.000385%)
CAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGA54 (0.003464%)
CAGTGCTCCAAAGAAGATGGTGGTGGCTGGTGGTATAACAGATGCCATGCAGCCAATCCAAATGGCAGATACTACTGGGGTGGCCTTTACAGCTGGGACA5 (0.000321%)
CAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAA6 (0.000385%)
CAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCA24 (0.001539%)
CAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCA10 (0.000641%)
CAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGC9 (0.000577%)
CAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTGTGATCTGCATTCCATCCTGTC9 (0.000577%)
CAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGAT5 (0.000321%)
CAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCA8 (0.000513%)
CAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAA13 (0.000834%)
CAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATC5 (0.000321%)
CAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACT4 (0.000257%)
CAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTG3 (0.000192%)
CATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGA8 (0.000513%)
CATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACC3 (0.000192%)
CATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGC6 (0.000385%)
CATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAA6 (0.000385%)
CATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCT5 (0.000321%)
CATAGAGCCCCATCAGCTGGAAGGTTTCCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATT165 (0.010583%)
CATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAAC4 (0.000257%)
CATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAA7 (0.000449%)
CATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGA11 (0.000706%)
CATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAACCATAGATAATTCGGA7 (0.000449%)
CATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGT7 (0.000449%)
CATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTC8 (0.000513%)
CATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACA4 (0.000257%)
CATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCA5 (0.000321%)
CATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAG15 (0.000962%)
CATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGC3 (0.000192%)
CATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGC4 (0.000257%)
CATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGG5 (0.000321%)
CATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCC17 (0.001090%)
CATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGC10 (0.000641%)
CATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCG3 (0.000192%)
CATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGT9 (0.000577%)
CATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCT9 (0.000577%)
CATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATG6 (0.000385%)
CATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGA7 (0.000449%)
CATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACC3 (0.000192%)
CATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTGGAGAGCATA30 (0.001924%)
CATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTC6 (0.000385%)
CATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAG30 (0.001924%)
CATCTCAATACTAATCAGCTTACAAATTCTCCTAATCATAACCTTTTCAGCAACTGAACTAATTATATTTTATATTTTATTTGAAGCAACCTTAATCCCA146 (0.009364%)
CATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAA5 (0.000321%)
CATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGC8 (0.000513%)
CATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAA27 (0.001732%)
CATCTTCCTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGA6 (0.000385%)
CATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCA5 (0.000321%)
CATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACA5 (0.000321%)
CATGAACCCTAATAATTGTTTCCCTAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCAT19 (0.001219%)
CATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTG20 (0.001283%)
CATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGC42 (0.002694%)
CATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTG20 (0.001283%)
CATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACAT15 (0.000962%)
CATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTC3 (0.000192%)
CATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTC3 (0.000192%)
CATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCT12 (0.000770%)
CATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATA15 (0.000962%)
CATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAG5 (0.000321%)
CATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTA6 (0.000385%)
CATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAA50 (0.003207%)
CATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCT6 (0.000385%)
CATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCCCAGATATAGCAT5 (0.000321%)
CATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGA4 (0.000257%)
CATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATA9 (0.000577%)
CATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACAC6 (0.000385%)
CATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAA15 (0.000962%)
CATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGC4 (0.000257%)
CATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAG16 (0.001026%)
CATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAG11 (0.000706%)
CATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTG5 (0.000321%)
CATGGGTATATCAAAGAGAAATTTAAAGAAGTCTTTGATTCTTGATGAGGTATCCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACA3 (0.000192%)
CATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCG6 (0.000385%)
CATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCA9 (0.000577%)
CATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTG14 (0.000898%)
CATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTGTGTT17 (0.001090%)
CATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTTTGTT41 (0.002630%)
CATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGC6 (0.000385%)
CATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCG3 (0.000192%)
CATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTT7 (0.000449%)
CATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGC8 (0.000513%)
CATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAGGGATGATGG4 (0.000257%)
CATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGAC10 (0.000641%)
CATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTG26 (0.001668%)
CATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCA3 (0.000192%)
CATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTTGGCCTGGCTC3 (0.000192%)
CATTAATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCCATTCTATGATCAGGATGAGCCTCAAACTCCAAATA3 (0.000192%)
CATTCATTGACCTACCTGCCCCATCCAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTT22 (0.001411%)
CATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGC6 (0.000385%)
CATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGA8 (0.000513%)
CATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTG4 (0.000257%)
CATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACA10 (0.000641%)
CATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTC3 (0.000192%)
CATTGACCTACCTGCCCCATCCAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTA45 (0.002886%)
CATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCA42 (0.002694%)
CATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCA15 (0.000962%)
CATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAG7 (0.000449%)
CATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGA18 (0.001155%)
CATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGA3 (0.000192%)
CATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGAC15 (0.000962%)
CATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTT3 (0.000192%)
CATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCG8 (0.000513%)
CATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGA12 (0.000770%)
CCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCT4 (0.000257%)
CCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCAC10 (0.000641%)
CCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCC12 (0.000770%)
CCAAAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGA36 (0.002309%)
CCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAG44 (0.002822%)
CCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTGAGAAAAAAAGACATGAAGACTCAGGA6 (0.000385%)
CCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCT9 (0.000577%)
CCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTC17 (0.001090%)
CCAAATCGTACTGGAAGACACTTGGCATTTCCCCGTTCCATGAATTCGCGGATGTGGTTTTCACAGCCAACGACTCTGGCCATCGCCACTACACCATCGC26 (0.001668%)
CCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTG4 (0.000257%)
CCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCA9 (0.000577%)
CCAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCCATACACTACACATCAGA5 (0.000321%)
CCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGA6 (0.000385%)
CCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGTT3 (0.000192%)
CCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTGCAGAGCTCCCAAGTC6 (0.000385%)
CCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCG22 (0.001411%)
CCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGG23 (0.001475%)
CCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGT15 (0.000962%)
CCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTAAATACTTTGA3 (0.000192%)
CCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAA12 (0.000770%)
CCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCT10 (0.000641%)
CCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCG44 (0.002822%)
CCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAG16 (0.001026%)
CCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGC29 (0.001860%)
CCAAGGCCACCACACTCCTATTGTACAAAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTGAGCG8 (0.000513%)
CCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGAC18 (0.001155%)
CCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGA10 (0.000641%)
CCAAGTCCATGACCATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGATGACGAGACGTAA102 (0.009682%)
CCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTT18 (0.001155%)
CCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGC13 (0.000834%)
CCAATACCACACCCATTAATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCCATTCTATGATCAGGATGAGCCT3 (0.000192%)
CCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTCCGGAGTAGTAAGTAACTACATGTGAAATAATTCCAAATCCTGGGA5 (0.000321%)
CCAATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGC12 (0.000770%)
CCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAA30 (0.001924%)
CCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCA21 (0.001347%)
CCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCC13 (0.000834%)
CCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAG35 (0.002245%)
CCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGC4 (0.000257%)
CCAATTTTAGGGGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTC13 (0.000834%)
CCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTG9 (0.000577%)
CCACACTCCTATTGTACAAAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTGAGCGTTCTATCAT26 (0.001668%)
CCACCACACTCCTATTGTACAAAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTGAGCGTTCTAT8 (0.000513%)
CCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTC6 (0.000385%)
CCACCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCA14 (0.000898%)
CCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTC13 (0.000834%)
CCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTA4 (0.000257%)
CCACCGCGTGCTCAGTCAGCTGCCTCACAGAACAGTTTGCCAGCGGGGTGGGGTCCAAAGCATGGCAAGTGGTCTCCAGTGTGTCAACTTCCATCTCATA3 (0.000192%)
CCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGC7 (0.000449%)
CCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGC6 (0.000385%)
CCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCT6 (0.000385%)
CCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCT23 (0.001475%)
CCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACA6 (0.000385%)
CCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCA4 (0.000257%)
CCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTC19 (0.001219%)
CCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAG14 (0.000898%)
CCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGT21 (0.001347%)
CCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATA8 (0.000513%)
CCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAAC7 (0.000449%)
CCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCC8 (0.000513%)
CCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCT22 (0.001411%)
CCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAG9 (0.000577%)
CCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCG12 (0.000770%)
CCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGAT6 (0.000385%)
CCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGA31 (0.001988%)
CCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTG18 (0.001155%)
CCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAG6 (0.000385%)
CCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGC8 (0.000513%)
CCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATG3 (0.000192%)
CCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATG13 (0.000834%)
CCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGC8 (0.000513%)
CCAGAGGGCCAGAGAGGTGCTTGAGACAGGGCCACCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTG20 (0.001283%)
CCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAG13 (0.000834%)
CCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTG5 (0.000321%)
CCAGATTTGAGTTCAGACATCAAGGAAAGGTTTGCACAACTATGTGAGGAGCATGGAATCCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCT704 (0.045154%)
CCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCAT7 (0.000449%)
CCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATG6 (0.000385%)
CCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAG8 (0.000513%)
CCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACC14 (0.000898%)
CCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTC4 (0.000257%)
CCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGC59 (0.003784%)
CCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCC6 (0.000385%)
CCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTG3 (0.000192%)
CCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACG7 (0.000449%)
CCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCCAATAA7 (0.000449%)
CCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTG5 (0.000321%)
CCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTC8 (0.000513%)
CCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTG20 (0.001283%)
CCAGGATGAGGCTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGG33 (0.002117%)
CCAGGATGCGCTAAGTAGCGTGCAGGAGTCCGATATAGCTGTGGTGGCCAGGGGCTGGATGGACAATCACTTCAGATCCCTGAAAGGCTACTGGAGCAAG15 (0.000962%)
CCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCA12 (0.000770%)
CCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATC13 (0.000834%)
CCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCT8 (0.000513%)
CCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACAC16 (0.001026%)
CCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCAC3 (0.000192%)
CCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTT16 (0.001026%)
CCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATT19 (0.001219%)
CCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAG6 (0.000385%)
CCAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTC3 (0.000192%)
CCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTGTGATCTGCATTCCATCCTGT13 (0.000834%)
CCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGA3 (0.000192%)
CCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGC13 (0.000834%)
CCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTCTGTTTTGTCAGCAAC6 (0.000385%)
CCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGA4 (0.000257%)
CCATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGG86 (0.005516%)
CCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACG5 (0.000321%)
CCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTATCCTA3 (0.000192%)
CCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGC14 (0.000898%)
CCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGG4 (0.000257%)
CCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACAC6 (0.000385%)
CCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAG15 (0.000962%)
CCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGGTTCTACATTCTTCATGGCTACTGGATTCCATGGACTCCA3 (0.000192%)
CCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCAC6 (0.000385%)
CCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACC7 (0.000449%)
CCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAG11 (0.000706%)
CCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGACAAAAGAGAAAAG6 (0.000385%)
CCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAA5 (0.000321%)
CCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGA33 (0.002117%)
CCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGC9 (0.000577%)
CCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCCCAGATATAGCA3 (0.000192%)
CCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGC6 (0.000385%)
CCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCT3 (0.000192%)
CCATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTG5 (0.000321%)
CCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAG12 (0.000770%)
CCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATGT10 (0.000641%)
CCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCT17 (0.001090%)
CCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTG98 (0.006286%)
CCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGA93 (0.005965%)
CCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACA12 (0.000770%)
CCCACAGCGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGAGGACTTTCAGACCACCGAACTTACCACG6 (0.000385%)
CCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCT6 (0.000385%)
CCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACA4 (0.000257%)
CCCACTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCA5 (0.000321%)
CCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCAT31 (0.001988%)
CCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAA19 (0.001219%)
CCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTC5 (0.000321%)
CCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGC6 (0.000385%)
CCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGC50 (0.003207%)
CCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGA26 (0.001668%)
CCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGT22 (0.001411%)
CCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCA89 (0.005708%)
CCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTT25 (0.001603%)
CCCAGCCAGCCAATGCCAACGCAGTAGGTCCCGTACCCACAGCGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGT8 (0.000513%)
CCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCC6 (0.000385%)
CCCAGCGCCTGGCTGAGCTCAAGAGCAACCCTACCTTGAACGAGTACCACACCAGGGCCAAAACCCACCTGAAGACACTTGGCGAGAAAGCCAGACCTGC4 (0.000257%)
CCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCT59 (0.003784%)
CCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCA10 (0.000641%)
CCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAA4 (0.000257%)
CCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAA15 (0.000962%)
CCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTATCCT10 (0.000641%)
CCCATCCAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCCATACACTACACA8 (0.000513%)
CCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCA9 (0.000577%)
CCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAA5 (0.000321%)
CCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAG5 (0.000321%)
CCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTCTTGGATTTTAATG3 (0.000192%)
CCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCT14 (0.000898%)
CCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGAC32 (0.002052%)
CCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATC9 (0.000577%)
CCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGG4 (0.000257%)
CCCCAGCCAGCCAATGCCAACGCAGTAGGTCCCGTACCCACAGCGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGG4 (0.000257%)
CCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACA20 (0.001283%)
CCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAA23 (0.001475%)
CCCCATCCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTC7 (0.000449%)
CCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAA8 (0.000513%)
CCCCGTATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACA4 (0.000257%)
CCCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAG10 (0.000641%)
CCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTAT3 (0.000192%)
CCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGG5 (0.000321%)
CCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAA72 (0.004618%)
CCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTATCCTAATTTTAGCCC13 (0.000834%)
CCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGC32 (0.002052%)
CCCGAGTCGGTTGCGTAGATCCTCCATGTCGGCTCCGAGTCGGGCCTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGA8 (0.000513%)
CCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTA29 (0.001860%)
CCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAG42 (0.002694%)
CCCGTACCCACAGCGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGAGGACTTTCAGACCACCGAACTT25 (0.001603%)
CCCGTATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAA32 (0.002052%)
CCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCA34 (0.002181%)
CCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTG24 (0.001539%)
CCCTAATAATTGTTTCCCTAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCT3 (0.000192%)
CCCTAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCC19 (0.001219%)
CCCTACCAAAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAAT18 (0.001155%)
CCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACC6 (0.000385%)
CCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGA12 (0.000770%)
CCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAG5 (0.000321%)
CCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGT29 (0.001860%)
CCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCC7 (0.000449%)
CCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGA14 (0.000898%)
CCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGA4 (0.000257%)
CCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGC15 (0.000962%)
CCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATC3 (0.000192%)
CCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATAT34 (0.002181%)
CCCTGGTGTGGTACTCGTTCAAGGTAGGGTTGCTCTTGAGCTCAGCCAGGCGCTGGGCCAGGCTCTCGCGCATCTGTTCGCTGTGGGGCGCTAGCTGTGT15 (0.000962%)
CCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATT4 (0.000257%)
CCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATT32 (0.002052%)
CCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAG5 (0.000321%)
CCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGA14 (0.000898%)
CCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAG40 (0.002566%)
CCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCAC120 (0.007697%)
CCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCG43 (0.002758%)
CCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAG30 (0.001924%)
CCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAG29 (0.001860%)
CCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAA6 (0.000385%)
CCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCT14 (0.000898%)
CCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGT752 (0.048233%)
CCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCA13 (0.000834%)
CCGAGTCGGTTGCGTAGATCCTCCATGTCGGCTCCGAGTCGGGCCTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGAC3 (0.000192%)
CCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGC11 (0.000706%)
CCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGAT46 (0.002950%)
CCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTAC11 (0.000706%)
CCGCATGCGCACACACGTAGACTCTCTGCGCACACAGCTAGCGCCCCACAGCGAACAGATGCGCGAGAGCCTGGCCCAGCGCCTGGCTGAGCTCAAGAGC5 (0.000321%)
CCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGA72 (0.004618%)
CCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTAC22 (0.001411%)
CCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGA18 (0.001155%)
CCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACC53 (0.003399%)
CCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGC15 (0.000962%)
CCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGC11 (0.000706%)
CCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACCCCATC76 (0.004875%)
CCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCC5 (0.000321%)
CCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGA40 (0.002566%)
CCGCGATAATAAATGGTAAGATGAAGTGGAAAGCGAAGAATCGGGTCAAGGTGGCTTTGTCTACTGAGAAGCCCCCTCAAATTCATTCGACTAGGGTTGT6 (0.000385%)
CCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTT21 (0.001347%)
CCGGACGCTCCTCACTGTGGCCCTCTTGGCTCTCCTGGCATCTGCCCGAGCTGAAGAGGTAGAGGGATCCTTGCTGCTGGGCTCTGTACAGGGCTACATG282 (0.018087%)
CCGGACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGG38 (0.002437%)
CCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTG10 (0.000641%)
CCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAAC581 (0.037265%)
CCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCT7 (0.000449%)
CCGTATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAA7 (0.000449%)
CCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGAC12 (0.000770%)
CCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCACCCAGCGCAG12 (0.000770%)
CCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAG41 (0.002630%)
CCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTT12 (0.000770%)
CCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTG6 (0.000385%)
CCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTC4 (0.000257%)
CCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATT5 (0.000321%)
CCTAATAATTGTTTCCCTAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTA3 (0.000192%)
CCTAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCA15 (0.000962%)
CCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCC13 (0.000834%)
CCTACCAAAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATG5 (0.000321%)
CCTACCAAGGCCACCACACTCCTATTGTACAAAAAGGACTACGATATGGTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTCTG10 (0.000641%)
CCTACCAATACCACACCCATTAATTAATTTAAACCTAGGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCCATTCTATGATCAGGATGA8 (0.000513%)
CCTACCTGCCCCATCCAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCCATA14 (0.000898%)
CCTACTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGGTTCT3 (0.000192%)
CCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCC4 (0.000257%)
CCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTTTTTTC15 (0.000962%)
CCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTC21 (0.001347%)
CCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCA6 (0.000385%)
CCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGG299 (0.019178%)
CCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGC13 (0.000834%)
CCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTG13 (0.000834%)
CCTAGGCCATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACG56 (0.003592%)
CCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGAC8 (0.000513%)
CCTAGGTAACATGTGGATAGACTGGAATTGGACTTCTCAGTGAGACAGGATGGAATGCAGATCACAGAATTTATACTGGGGATGCTGTATGGATAGGAAG17 (0.001090%)
CCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCT7 (0.000449%)
CCTAGGTTTAAATTAATTAATGGGTGTGGTATTGGTAGGGGAACTCATAGACTTAATGCTAGTGTGAGTGATAGGGTAGGTGCAATAATAAATAAGGATA6 (0.000385%)
CCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAACTTTAATGTAGAAAAGATTAATGGGGAATGGCATACTATTATCCTGGCCTCTGAC5 (0.000321%)
CCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCC12 (0.000770%)
CCTATTCCCTACCAAAATGAAGATGCTGCTGCTGCTGCTGTGTTTGGGACTGACCCTAGTCTGTGTCCATGCAGAAGAAGCTAGTTCTACGGGAAGGAAC13 (0.000834%)
CCTCACACAAACATCGGAGGCTGACATCCACAAGTCCTTCCAACACCTCCTCCAAACCCTCAACAGACCAGACAGTGAGCTGCAGCTGAGCACAGGCAAT5 (0.000321%)
CCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAG25 (0.001603%)
CCTCACTGTGGCCCTCTTGGCTCTCCTGGCATCTGCCCGAGCTGAAGAGGTAGAGGGATCCTTGCTGCTGGGCTCTGTACAGGGCTACATGGAACAAGCC12 (0.000770%)
CCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTC6 (0.000385%)
CCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTG4 (0.000257%)
CCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGC78 (0.005003%)
CCTCCAACCAGGATGAGGCTCTTCATCGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATT6 (0.000385%)
CCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATC3 (0.000192%)
CCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATC4 (0.000257%)
CCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTG11 (0.000706%)
CCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGG5 (0.000321%)
CCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGAC12 (0.000770%)
CCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCC5 (0.000321%)
CCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTC66 (0.004233%)
CCTCCATGTCGGCTCCGAGTCGGGCCTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTC18 (0.001155%)
CCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATC25 (0.001603%)
CCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTG17 (0.001090%)
CCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTA7 (0.000449%)
CCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCG8 (0.000513%)
CCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAA5 (0.000321%)
CCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGC4 (0.000257%)
CCTCCTCTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATC3 (0.000192%)
CCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAA8 (0.000513%)
CCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGC14 (0.000898%)
CCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCG5 (0.000321%)
CCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAG4 (0.000257%)
CCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTC8 (0.000513%)
CCTCGTTGCGGTACTGCCCGAGTCGGTTGCGTAGATCCTCCATGTCGGCTCCGAGTCGGGCCTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGT6 (0.000385%)
CCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCC3 (0.000192%)
CCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGAT97 (0.006222%)
CCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAG3 (0.000192%)
CCTCTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAAGATATCCTA4 (0.000257%)
CCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACAT12 (0.000770%)
CCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCAT3 (0.000192%)
CCTGAACAGAAGGTCCTTGGTGGTGGACTTGAACAAACAGAAATTGCCGGTGCAGTCACTTCCCCCAAATAAAGTCTCCTGGCTAGTCAGTACAGCCTTA11 (0.000706%)
CCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCT168 (0.010775%)
CCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTA18 (0.001155%)
CCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACT19 (0.001219%)
CCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCA3 (0.000192%)
CCTGAGATTGGTATAAGAATTAAGATGATTGAGAAGTATGAGATGGAGGCTAGTTGGCCAATGATAATAAATGGGTGTTCTACTGGTTGGCCCCCAATTC6 (0.000385%)
CCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAATTCTGTGATCTGCATT5 (0.000321%)
CCTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCT5 (0.000321%)
CCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTT16 (0.001026%)
CCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGA36 (0.002309%)
CCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCA30 (0.001924%)
CCTGATTCTCATGAAATACCCAGAAATTGAAGAGAAACTTCATGAAGAAATTGACAGGGTTATTGGGCCAAGCCGTGCCCCTGCAGTCCGAGACAGGATG10 (0.000641%)
CCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTC7 (0.000449%)
CCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAA6 (0.000385%)
CCTGCCCCATCCAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCCATACACT4 (0.000257%)
CCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCT6 (0.000385%)
CCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTG28 (0.001796%)
CCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCA4 (0.000257%)
CCTGCTTCAGATTCTTAGCCCATTCGGCAGGGTTCTTTCCTTCGGTGTTATCCAGGACAGTCTGGTGTTTCACAAAGGCTACATCTCCTTTCTCAACGAG3 (0.000192%)
CCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTC25 (0.001603%)
CCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTGAGAAAA19 (0.001219%)
CCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTG9 (0.000577%)
CCTGGAGGCAGCGATTGGCATTGGATAGGTCAATGATATTTTCTCTAAGGATTCCATGCTCCTCACATAGTTGTGCAAACCTTTCCTTGATGTCTGAACT15 (0.000962%)
CCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACAT26 (0.001668%)
CCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGT9 (0.000577%)
CCTGGCCTCTGACAAAAGAGAAAAGATAGAAGATAATGGCAACTTTAGACTTTTTCTGGAGCAAATCCATGTCTTGGAGAAATCCTTAGTTCTTAAATTC17 (0.001090%)
CCTGGCTGGATATGGATGTTGTTGCAGGACAGGAGAAGGATACTCATTGATTCTCCTGGGCCACTGGGGTGATGATGGGGTTGGTAGCCACAGAGGCCTG19 (0.001219%)
CCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTGCAGAGCTCCCAAGTCACACA8 (0.000513%)
CCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAG24 (0.001539%)
CCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACA13 (0.000834%)
CCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGC5 (0.000321%)
CCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCTGTAGGAGTATGGGCTGAGCAGGGCTGCGATGGTGTAGTGGCGATGGCCA26 (0.001668%)
CCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGC9 (0.000577%)
CCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCTGTAGGAGTATGGGCTGAGCAGGGCTGCGATGGTGTAGTGG14 (0.000898%)
CCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATC15 (0.000962%)
CCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGT20 (0.001283%)
CCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGT9 (0.000577%)
CCTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAG52 (0.003335%)
CCTGTGTTGCCTGGTCCCCAGCTTTCTGGCTGAGGATGTTCAGGAGACAGACACCTCCCAGAAGGATCAGTCCCCAGCCTCCCATGAGATCGCTACAAAC13 (0.000834%)
CCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGGCATACTTT11 (0.000706%)
CCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTA45 (0.002886%)
CCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTT16 (0.001026%)
CCTTAGAGAAAATATCATTGACCTATCCAATGCCAATCGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTC6 (0.000385%)
CCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGT6 (0.000385%)
CCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCC15 (0.000962%)
CCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAG9 (0.000577%)
CCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGA39 (0.002501%)
CCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGG6 (0.000385%)
CCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGC36 (0.002309%)
CCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGC3 (0.000192%)
CCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGA24 (0.001539%)
CCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCAC28 (0.001796%)
CCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTC8 (0.000513%)
CCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGC12 (0.000770%)
CCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCA109 (0.006991%)
CCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGATGGACCAGCTCCCGGTATAG113 (0.007248%)
CCTTGGTGGTGGACTTGAACAAACAGAAATTGCCGGTGCAGTCACTTCCCCCAAATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTT6 (0.000385%)
CCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTGAGAAAAAAAGACATGAAGACTCAGGACTCAT3 (0.000192%)
CCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAG8 (0.000513%)
CCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGAT5 (0.000321%)
CCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGA7 (0.000449%)
CCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCAC5 (0.000321%)
CCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGAC5 (0.000321%)
CCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAG12 (0.000770%)
CCTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTT73 (0.004682%)
CCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACT11 (0.000706%)
CCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACAC4 (0.000257%)
CCTTTTCGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGC7 (0.000449%)
CCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGA5 (0.000321%)
CGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAA4 (0.000257%)
CGAACAGATGCGCGAGAGCCTGGCCCAGCGCCTGGCTGAGCTCAAGAGCAACCCTACCTTGAACGAGTACCACACCAGGGCCAAAACCCACCTGAAGACA9 (0.000577%)
CGAACATGAACCCTAATAATTGTTTCCCTAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTAT379 (0.024309%)
CGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACG31 (0.001988%)
CGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAA5 (0.000321%)
CGAAGACTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACC11 (0.000706%)
CGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCG184 (0.017466%)
CGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGC95 (0.006093%)
CGAAGTCTTCCTGCTTCAGATTCTTAGCCCATTCGGCAGGGTTCTTTCCTTCGGTGTTATCCAGGACAGTCTGGTGTTTCACAAAGGCTACATCTCCTTT7 (0.000449%)
CGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGAGGACTTTCAGACCACCGAACTTACCACGACCTACG16 (0.001026%)
CGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCA34 (0.002181%)
CGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACC26 (0.001668%)
CGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACA30 (0.001924%)
CGACCGCATGCGCACACACGTAGACTCTCTGCGCACACAGCTAGCGCCCCACAGCGAACAGATGCGCGAGAGCCTGGCCCAGCGCCTGGCTGAGCTCAAG36 (0.002309%)
CGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCT37 (0.002373%)
CGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTA51 (0.003271%)
CGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCT111 (0.007119%)
CGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGC24 (0.001539%)
CGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGC13 (0.000834%)
CGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCACAACCTTCTCAGGCTACCCTGAGAAAAAAAGACATG5 (0.000321%)
CGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGA15 (0.000962%)
CGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGC70 (0.004490%)
CGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGA59 (0.003784%)
CGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCAGTATAAA28 (0.001796%)
CGAGAGCCTGGCCCAGCGCCTGGCTGAGCTCAAGAGCAACCCTACCTTGAACGAGTACCACACCAGGGCCAAAACCCACCTGAAGACACTTGGCGAGAAA3 (0.000192%)
CGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTT56 (0.003592%)
CGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACCCCATCATCACCCCAGTGGCCCAG4 (0.000257%)
CGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTG19 (0.001219%)
CGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCA19 (0.001219%)
CGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTG46 (0.002950%)
CGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAG10 (0.000641%)
CGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCC8 (0.000513%)
CGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAG4 (0.000257%)
CGAGTCGGTTGCGTAGATCCTCCATGTCGGCTCCGAGTCGGGCCTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACC3 (0.000192%)
CGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTG17 (0.001090%)
CGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGAC43 (0.002758%)
CGATAATTCCTGAGATTGGTATAAGAATTAAGATGATTGAGAAGTATGAGATGGAGGCTAGTTGGCCAATGATAATAAATGGGTGTTCTACTGGTTGGCC17 (0.001090%)
CGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAG8 (0.000513%)
CGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCTCTTTTCTTTGTGAAGGGCAGGGCGCCCTGGAATGGGTTCGCCCCGAGAGAGGGGCCCGTG53 (0.003399%)
CGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACAC10 (0.000641%)
CGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCT23 (0.001475%)
CGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGG3 (0.000192%)
CGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCA112 (0.007184%)
CGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGC5 (0.000321%)
CGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATG3 (0.000192%)
CGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATAC31 (0.001988%)
CGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGG135 (0.008659%)
CGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGG104 (0.006670%)
CGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGC20 (0.001283%)
CGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCT33 (0.002117%)
CGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATG10 (0.000641%)
CGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACT3 (0.000192%)
CGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGAGTCGGTTGC3 (0.000192%)
CGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAA25 (0.001603%)
CGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTG11 (0.000706%)
CGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACA53 (0.003399%)
CGCCACATCCCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTA549 (0.035212%)
CGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAG64 (0.004105%)
CGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTGATGAGTTTCACCTCCTTATCCAGATAGTGGCT10 (0.000641%)
CGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTAC27 (0.001732%)
CGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAG8 (0.000513%)
CGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCA19 (0.001219%)
CGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCA9 (0.000577%)
CGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCC7 (0.000449%)
CGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCT14 (0.000898%)
CGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCC10 (0.000641%)
CGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGC9 (0.000577%)
CGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACCCCATCA7 (0.000449%)
CGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTG358 (0.022962%)
CGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATAC14 (0.000898%)
CGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCC10 (0.000641%)
CGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACC15 (0.000962%)
CGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCT4 (0.000257%)
CGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGAT297 (0.019049%)
CGCGACCGCATGCGCACACACGTAGACTCTCTGCGCACACAGCTAGCGCCCCACAGCGAACAGATGCGCGAGAGCCTGGCCCAGCGCCTGGCTGAGCTCA26 (0.001668%)
CGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCG37 (0.002373%)
CGCGATAATAAATGGTAAGATGAAGTGGAAAGCGAAGAATCGGGTCAAGGTGGCTTTGTCTACTGAGAAGCCCCCTCAAATTCATTCGACTAGGGTTGTT7 (0.000449%)
CGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCAC33 (0.002117%)
CGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCG28 (0.001796%)
CGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGA67 (0.004297%)
CGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCG43 (0.002758%)
CGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGC11 (0.000706%)
CGCGTGCTCAGTCAGCTGCCTCACAGAACAGTTTGCCAGCGGGGTGGGGTCCAAAGCATGGCAAGTGGTCTCCAGTGTGTCAACTTCCATCTCATACACC3 (0.000192%)
CGCTAAGTAGCGTGCAGGAGTCCGATATAGCTGTGGTGGCCAGGGGCTGGATGGACAATCACTTCAGATCCCTGAAAGGCTACTGGAGCAAGTTTACTGA5 (0.000321%)
CGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAG7 (0.000449%)
CGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAA25 (0.001603%)
CGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAAGACATGC3 (0.000192%)
CGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTG17 (0.001090%)
CGCTCTTCCTGTCCTGATTGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTGGAGAGCATACCG31 (0.001988%)
CGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTT6 (0.000385%)
CGCTGCCTCCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAG7 (0.000449%)
CGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGC7 (0.000449%)
CGCTGGGCCAGGCTCTCGCGCATCTGTTCGCTGTGGGGCGCTAGCTGTGTGCGCAGAGAGTCTACGTGTGTGCGCATGCGGTCGCGAAATTCCTCAGCCA13 (0.000834%)
CGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCA33 (0.002117%)
CGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGAGTC10 (0.000641%)
CGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAG43 (0.002758%)
CGGAAGAGCACACGTCTGAACTCCAGTCACGCGACGAATT15 (0.000385%)
CGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTT43 (0.002758%)
CGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCAT14 (0.000898%)
CGGACCGGATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGC11 (0.000706%)
CGGACGCTCCTCACTGTGGCCCTCTTGGCTCTCCTGGCATCTGCCCGAGCTGAAGAGGTAGAGGGATCCTTGCTGCTGGGCTCTGTACAGGGCTACATGG5 (0.000321%)
CGGACTGCTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGG50 (0.003207%)
CGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAA13 (0.000834%)
CGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCA58 (0.003720%)
CGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTC19 (0.001219%)
CGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAAT12 (0.000770%)
CGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCA8 (0.000513%)
CGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGA17 (0.001090%)
CGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGT10 (0.000641%)
CGGATCCAAGAAAACAGTGCTCCAAAGAAGATGGTGGTGGCTGGTGGTATAACAGATGCCATGCAGCCAATCCAAATGGCAGATACTACTGGGGTGGCCT5 (0.000321%)
CGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCC30 (0.001924%)
CGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGA14 (0.000898%)
CGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTC114 (0.007312%)
CGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTT76 (0.004875%)
CGGCATCTTCCTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGC367 (0.023539%)
CGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAG187 (0.011994%)
CGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGGCGCCCTCGCG10 (0.000641%)
CGGCGCCCTCGCGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGA91 (0.005837%)
CGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACT17 (0.001090%)
CGGCTCCAGCTCATAGTGGAATGGCTATACTTAGATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCC8 (0.000513%)
CGGCTCCGAGTCGGGCCTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTA14 (0.000898%)
CGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGG373 (0.035407%)
CGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTA18 (0.001155%)
CGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAA41 (0.002630%)
CGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACC3 (0.000192%)
CGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAAC34 (0.002181%)
CGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAAT33 (0.002117%)
CGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTG33 (0.002117%)
CGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGC3 (0.000192%)
CGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGT18 (0.001155%)
CGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGG14 (0.000898%)
CGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCAC8 (0.000513%)
CGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTT45 (0.002886%)
CGGTACTGCCCGAGTCGGTTGCGTAGATCCTCCATGTCGGCTCCGAGTCGGGCCTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCG14 (0.000898%)
CGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGC6 (0.000385%)
CGGTCCAGGATGCGCTAAGTAGCGTGCAGGAGTCCGATATAGCTGTGGTGGCCAGGGGCTGGATGGACAATCACTTCAGATCCCTGAAAGGCTACTGGAG3 (0.000192%)
CGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTT7 (0.000449%)
CGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGAT4 (0.000257%)
CGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAG9 (0.000577%)
CGGTTGCGTAGATCCTCCATGTCGGCTCCGAGTCGGGCCTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCT6 (0.000385%)
CGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTC5 (0.000321%)
CGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCCCA18 (0.001155%)
CGTAGATCCTCCATGTCGGCTCCGAGTCGGGCCTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCT6 (0.000385%)
CGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAAC4 (0.000257%)
CGTATGATGGATTCAATACATTTACTATACCTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCT7 (0.000449%)
CGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCA4 (0.000257%)
CGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACT5 (0.000321%)
CGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGACAGCGTCTGCACCCAGCGCAGG3 (0.000192%)
CGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGC5 (0.000321%)
CGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATC125 (0.008017%)
CGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGG8 (0.000513%)
CGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGACCCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCG9 (0.000577%)
CGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCGATCGCGCCCAGGCTTTTG6 (0.000385%)
CGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTG3 (0.000192%)
CGTGCCCCTGCCTTGTACACAGCTAGGCGCTTCTGCAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCC35 (0.002245%)
CGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATC17 (0.001090%)
CGTGGCTCTGGTCTTCCTGACAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTG10 (0.000641%)
CGTGGGTGCCCTGCTGGCCTGCGCTGCCCTGGGGCTGTGTCTGGCTGTCCCTGACAAAACGGTCAAATGGTGCGCAGTGTCAGAGCACGAGAATACCAAG3 (0.000192%)
CGTGTCTCCTCCGCCACTGGACCCAGCTGTTCCTCCAGCTCCTTTTTGTAAGCCTTTACTTCCGTCATAGTGTCCTCCATCAGTGCCGTCAGTTCTTGTG9 (0.000577%)
CGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATATAGC58 (0.003720%)
CGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGA26 (0.001668%)
CGTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAA5 (0.000321%)
CGTTAATGAGATGAGCCATAAGAAAGTTATCATAGTCTGTCTTAGGTATAGTAAATGTATTGAATCCATCATACGTCACAGAATATTCACCAGCCTTTTC32 (0.002052%)
CGTTCACCTCCTCTTCCTCCACGAAACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCCATTTCACCCCTACTATACAATCAAA35 (0.002245%)
CGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGC39 (0.002501%)
CGTTGCGGTACTGCCCGAGTCGGTTGCGTAGATCCTCCATGTCGGCTCCGAGTCGGGCCTGTGCCGCCTGCACCTCTTTGCCCAGCCTGGCCCGTGTCTC10 (0.000641%)
CGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGT5 (0.000321%)
CTAAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCT13 (0.000834%)
CTAAACACCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAA158 (0.010134%)
CTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAAT17 (0.001090%)
CTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCCAATCGTTGT15 (0.000962%)
CTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGG6 (0.000385%)
CTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAG3 (0.000192%)
CTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGA7 (0.000449%)
CTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCA13 (0.000834%)
CTAAGACAGACTATGATAACTTTCTTATGGCTCATCTCATTAACGAAAAGGATGGGGAAACCTTCCAGCTGATGGGGCTCTATGGCCGAGAACCAGATTT37 (0.002373%)
CTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCG20 (0.001283%)
CTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAA225 (0.014431%)
CTAATAATTGTTTCCCTAATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAA4 (0.000257%)
CTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGAAAGCCAATAGACATTATTGCTCATACTATTCCTATATAGCCGAAAGGTTCTTT9 (0.000577%)
CTAATCTAGCTCTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATTCTTATAGGAAT17 (0.001090%)
CTAATGCCATTGGTTGAATAAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGA10 (0.000641%)
CTAATTACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACTTTGAAACATCATTCTCCATTTCAGATGGTATCTATGGTTCTACAT3 (0.000192%)
CTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTCGGAAGCCTG3 (0.000192%)
CTACACCAGTTAGCCCCAACCCCTCAGGGCATGAAGACCAAGAGAAGCCCATGGGCCACGGGAGGGAGCATCTGTCTCCACCACAGTGGCAACCCACCTC9 (0.000577%)
CTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGAT12 (0.000770%)
CTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTT