fastp report
General
fastp version:0.23.1 (https://github.com/OpenGene/fastp)
sequencing:paired end (150 cycles + 150 cycles)
mean length before filtering:150bp, 150bp
mean length after filtering:144bp, 143bp
duplication rate:24.023419%
Insert size peak:262
Before filtering
total reads:42.646320 M
total bases:6.396948 G
Q20 bases:6.274848 G (98.091276%)
Q30 bases:6.050080 G (94.577598%)
GC content:49.757776%
After filtering
total reads:42.425864 M
total bases:6.108262 G
Q20 bases:6.014258 G (98.461031%)
Q30 bases:5.805154 G (95.037738%)
GC content:49.658612%
Filtering result
reads passed filters:42.425864 M (99.483060%)
reads with low quality:175.320000 K (0.411102%)
reads with too many N:28.412000 K (0.066622%)
reads too short:16.724000 K (0.039216%)
Adapter or bad ligation of read1
The input has little adapter percentage (~0.762910%), probably it's trimmed before.
SequenceOccurrences
A14420
AG15427
AGA15669
AGAT15348
AGATC14659
AGATCG15081
AGATCGG14261
AGATCGGA13393
AGATCGGAA13227
AGATCGGAAG12849
AGATCGGAAGA12434
AGATCGGAAGAG12505
AGATCGGAAGAGC13009
AGATCGGAAGAGCA13507
AGATCGGAAGAGCAC14103
AGATCGGAAGAGCACA13865
AGATCGGAAGAGCACAC12131
AGATCGGAAGAGCACACG11296
AGATCGGAAGAGCACACGT10967
AGATCGGAAGAGCACACGTC10596
AGATCGGAAGAGCACACGTCT11146
AGATCGGAAGAGCACACGTCTG11739
AGATCGGAAGAGCACACGTCTGA11841
AGATCGGAAGAGCACACGTCTGAA11602
AGATCGGAAGAGCACACGTCTGAAC11956
AGATCGGAAGAGCACACGTCTGAACT11236
AGATCGGAAGAGCACACGTCTGAACTC10859
AGATCGGAAGAGCACACGTCTGAACTCC10479
AGATCGGAAGAGCACACGTCTGAACTCCA9488
AGATCGGAAGAGCACACGTCTGAACTCCAG9163
AGATCGGAAGAGCACACGTCTGAACTCCAGT9060
AGATCGGAAGAGCACACGTCTGAACTCCAGTC9553
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA10786
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC11312
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACC10398
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCT9697
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTA9425
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTAT9007
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATC8333
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATCC9161
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATCCAG8162
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATCCAGT12986
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATCCAGTG9504
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATCCAGTGA29881
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATCCAGTGAT11504
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATCCAGTGATCTCGTATGC7899
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATCCAGTGATCTCGTATGCCG7814
other adapter sequences209289
Adapter or bad ligation of read2
The input has little adapter percentage (~0.788626%), probably it's trimmed before.
SequenceOccurrences
A15502
AG15551
AGA15839
AGAT15359
AGATC15061
AGATCG18890
AGATCGG14212
AGATCGGA13869
AGATCGGAA11900
AGATCGGAAG11677
AGATCGGAAGA11718
AGATCGGAAGAG14398
AGATCGGAAGAGC13444
AGATCGGAAGAGCG13645
AGATCGGAAGAGCGT19969
AGATCGGAAGAGCGTC12223
AGATCGGAAGAGCGTCG17529
AGATCGGAAGAGCGTCGT11795
AGATCGGAAGAGCGTCGTG10021
AGATCGGAAGAGCGTCGTGTAG11828
AGATCGGAAGAGCGTCGTGTAGG17253
AGATCGGAAGAGCGTCGTGTAGGG14558
AGATCGGAAGAGCGTCGTGTAGGGA10892
AGATCGGAAGAGCGTCGTGTAGGGAA8512
AGATCGGAAGAGCGTCGTGTAGGGAAAG10172
AGATCGGAAGAGCGTCGTGTAGGGAAAGAG11547
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGT8694
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG8411
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTT8065
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTG10334
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTGT8604
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTGTG9893
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTGTGA8476
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTGTGAG8642
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTGTGAGTCTGGTG9263
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTGTGAGTCTGGTGT7903
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTGTGAGTCTGGTGTAGATCTCGGT8450
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTGTGAGTCTGGTGTAGATCTCGGTGGTCGC8232
other adapter sequences319169
This estimation is based on paired-end overlap analysis, and there are 62.278599% reads found not overlapped.
The nonoverlapped read pairs may have insert size <30 or >270, or contain too much sequencing errors to be detected as overlapped.
Value of each position will be shown on mouse over.
Value of each position will be shown on mouse over.
Darker background means larger counts. The count will be shown on mouse over.
AAATACAGTATTTCTGCACTCCCGGAGTGCGG
AAAAAAAAAAAATAAAACAAAAGAAATAAAATTAAATCAAATGAAACAAAACTAAACCAAACGAAAGAAAAGTAAAGCAAAGG
AATAATAAAATATAATACAATAGAATTAAATTTAATTCAATTGAATCAAATCTAATCCAATCGAATGAAATGTAATGCAATGG
AACAACAAAACATAACACAACAGAACTAAACTTAACTCAACTGAACCAAACCTAACCCAACCGAACGAAACGTAACGCAACGG
AAGAAGAAAAGATAAGACAAGAGAAGTAAAGTTAAGTCAAGTGAAGCAAAGCTAAGCCAAGCGAAGGAAAGGTAAGGCAAGGG
ATAATAAAATAATATAACATAAGATATAATATTATATCATATGATACAATACTATACCATACGATAGAATAGTATAGCATAGG
ATTATTAAATTATATTACATTAGATTTAATTTTATTTCATTTGATTCAATTCTATTCCATTCGATTGAATTGTATTGCATTGG
ATCATCAAATCATATCACATCAGATCTAATCTTATCTCATCTGATCCAATCCTATCCCATCCGATCGAATCGTATCGCATCGG
ATGATGAAATGATATGACATGAGATGTAATGTTATGTCATGTGATGCAATGCTATGCCATGCGATGGAATGGTATGGCATGGG
ACAACAAAACAATACAACACAAGACATAACATTACATCACATGACACAACACTACACCACACGACAGAACAGTACAGCACAGG
ACTACTAAACTATACTACACTAGACTTAACTTTACTTCACTTGACTCAACTCTACTCCACTCGACTGAACTGTACTGCACTGG
ACCACCAAACCATACCACACCAGACCTAACCTTACCTCACCTGACCCAACCCTACCCCACCCGACCGAACCGTACCGCACCGG
ACGACGAAACGATACGACACGAGACGTAACGTTACGTCACGTGACGCAACGCTACGCCACGCGACGGAACGGTACGGCACGGG
AGAAGAAAAGAATAGAACAGAAGAGATAAGATTAGATCAGATGAGACAAGACTAGACCAGACGAGAGAAGAGTAGAGCAGAGG
AGTAGTAAAGTATAGTACAGTAGAGTTAAGTTTAGTTCAGTTGAGTCAAGTCTAGTCCAGTCGAGTGAAGTGTAGTGCAGTGG
AGCAGCAAAGCATAGCACAGCAGAGCTAAGCTTAGCTCAGCTGAGCCAAGCCTAGCCCAGCCGAGCGAAGCGTAGCGCAGCGG
AGGAGGAAAGGATAGGACAGGAGAGGTAAGGTTAGGTCAGGTGAGGCAAGGCTAGGCCAGGCGAGGGAAGGGTAGGGCAGGGG
TAATAAAATAAATTAAACTAAAGTAATATAATTTAATCTAATGTAACATAACTTAACCTAACGTAAGATAAGTTAAGCTAAGG
TATTATAATATATTATACTATAGTATTATATTTTATTCTATTGTATCATATCTTATCCTATCGTATGATATGTTATGCTATGG
TACTACAATACATTACACTACAGTACTATACTTTACTCTACTGTACCATACCTTACCCTACCGTACGATACGTTACGCTACGG
TAGTAGAATAGATTAGACTAGAGTAGTATAGTTTAGTCTAGTGTAGCATAGCTTAGCCTAGCGTAGGATAGGTTAGGCTAGGG
TTATTAAATTAATTTAACTTAAGTTATATTATTTTATCTTATGTTACATTACTTTACCTTACGTTAGATTAGTTTAGCTTAGG
TTTTTTAATTTATTTTACTTTAGTTTTATTTTTTTTTCTTTTGTTTCATTTCTTTTCCTTTCGTTTGATTTGTTTTGCTTTGG
TTCTTCAATTCATTTCACTTCAGTTCTATTCTTTTCTCTTCTGTTCCATTCCTTTCCCTTCCGTTCGATTCGTTTCGCTTCGG
TTGTTGAATTGATTTGACTTGAGTTGTATTGTTTTGTCTTGTGTTGCATTGCTTTGCCTTGCGTTGGATTGGTTTGGCTTGGG
TCATCAAATCAATTCAACTCAAGTCATATCATTTCATCTCATGTCACATCACTTCACCTCACGTCAGATCAGTTCAGCTCAGG
TCTTCTAATCTATTCTACTCTAGTCTTATCTTTTCTTCTCTTGTCTCATCTCTTCTCCTCTCGTCTGATCTGTTCTGCTCTGG
TCCTCCAATCCATTCCACTCCAGTCCTATCCTTTCCTCTCCTGTCCCATCCCTTCCCCTCCCGTCCGATCCGTTCCGCTCCGG
TCGTCGAATCGATTCGACTCGAGTCGTATCGTTTCGTCTCGTGTCGCATCGCTTCGCCTCGCGTCGGATCGGTTCGGCTCGGG
TGATGAAATGAATTGAACTGAAGTGATATGATTTGATCTGATGTGACATGACTTGACCTGACGTGAGATGAGTTGAGCTGAGG
TGTTGTAATGTATTGTACTGTAGTGTTATGTTTTGTTCTGTTGTGTCATGTCTTGTCCTGTCGTGTGATGTGTTGTGCTGTGG
TGCTGCAATGCATTGCACTGCAGTGCTATGCTTTGCTCTGCTGTGCCATGCCTTGCCCTGCCGTGCGATGCGTTGCGCTGCGG
TGGTGGAATGGATTGGACTGGAGTGGTATGGTTTGGTCTGGTGTGGCATGGCTTGGCCTGGCGTGGGATGGGTTGGGCTGGGG
CAACAAAACAAATCAAACCAAAGCAATACAATTCAATCCAATGCAACACAACTCAACCCAACGCAAGACAAGTCAAGCCAAGG
CATCATAACATATCATACCATAGCATTACATTTCATTCCATTGCATCACATCTCATCCCATCGCATGACATGTCATGCCATGG
CACCACAACACATCACACCACAGCACTACACTTCACTCCACTGCACCACACCTCACCCCACCGCACGACACGTCACGCCACGG
CAGCAGAACAGATCAGACCAGAGCAGTACAGTTCAGTCCAGTGCAGCACAGCTCAGCCCAGCGCAGGACAGGTCAGGCCAGGG
CTACTAAACTAATCTAACCTAAGCTATACTATTCTATCCTATGCTACACTACTCTACCCTACGCTAGACTAGTCTAGCCTAGG
CTTCTTAACTTATCTTACCTTAGCTTTACTTTTCTTTCCTTTGCTTCACTTCTCTTCCCTTCGCTTGACTTGTCTTGCCTTGG
CTCCTCAACTCATCTCACCTCAGCTCTACTCTTCTCTCCTCTGCTCCACTCCTCTCCCCTCCGCTCGACTCGTCTCGCCTCGG
CTGCTGAACTGATCTGACCTGAGCTGTACTGTTCTGTCCTGTGCTGCACTGCTCTGCCCTGCGCTGGACTGGTCTGGCCTGGG
CCACCAAACCAATCCAACCCAAGCCATACCATTCCATCCCATGCCACACCACTCCACCCCACGCCAGACCAGTCCAGCCCAGG
CCTCCTAACCTATCCTACCCTAGCCTTACCTTTCCTTCCCTTGCCTCACCTCTCCTCCCCTCGCCTGACCTGTCCTGCCCTGG
CCCCCCAACCCATCCCACCCCAGCCCTACCCTTCCCTCCCCTGCCCCACCCCTCCCCCCCCCGCCCGACCCGTCCCGCCCCGG
CCGCCGAACCGATCCGACCCGAGCCGTACCGTTCCGTCCCGTGCCGCACCGCTCCGCCCCGCGCCGGACCGGTCCGGCCCGGG
CGACGAAACGAATCGAACCGAAGCGATACGATTCGATCCGATGCGACACGACTCGACCCGACGCGAGACGAGTCGAGCCGAGG
CGTCGTAACGTATCGTACCGTAGCGTTACGTTTCGTTCCGTTGCGTCACGTCTCGTCCCGTCGCGTGACGTGTCGTGCCGTGG
CGCCGCAACGCATCGCACCGCAGCGCTACGCTTCGCTCCGCTGCGCCACGCCTCGCCCCGCCGCGCGACGCGTCGCGCCGCGG
CGGCGGAACGGATCGGACCGGAGCGGTACGGTTCGGTCCGGTGCGGCACGGCTCGGCCCGGCGCGGGACGGGTCGGGCCGGGG
GAAGAAAAGAAATGAAACGAAAGGAATAGAATTGAATCGAATGGAACAGAACTGAACCGAACGGAAGAGAAGTGAAGCGAAGG
GATGATAAGATATGATACGATAGGATTAGATTTGATTCGATTGGATCAGATCTGATCCGATCGGATGAGATGTGATGCGATGG
GACGACAAGACATGACACGACAGGACTAGACTTGACTCGACTGGACCAGACCTGACCCGACCGGACGAGACGTGACGCGACGG
GAGGAGAAGAGATGAGACGAGAGGAGTAGAGTTGAGTCGAGTGGAGCAGAGCTGAGCCGAGCGGAGGAGAGGTGAGGCGAGGG
GTAGTAAAGTAATGTAACGTAAGGTATAGTATTGTATCGTATGGTACAGTACTGTACCGTACGGTAGAGTAGTGTAGCGTAGG
GTTGTTAAGTTATGTTACGTTAGGTTTAGTTTTGTTTCGTTTGGTTCAGTTCTGTTCCGTTCGGTTGAGTTGTGTTGCGTTGG
GTCGTCAAGTCATGTCACGTCAGGTCTAGTCTTGTCTCGTCTGGTCCAGTCCTGTCCCGTCCGGTCGAGTCGTGTCGCGTCGG
GTGGTGAAGTGATGTGACGTGAGGTGTAGTGTTGTGTCGTGTGGTGCAGTGCTGTGCCGTGCGGTGGAGTGGTGTGGCGTGGG
GCAGCAAAGCAATGCAACGCAAGGCATAGCATTGCATCGCATGGCACAGCACTGCACCGCACGGCAGAGCAGTGCAGCGCAGG
GCTGCTAAGCTATGCTACGCTAGGCTTAGCTTTGCTTCGCTTGGCTCAGCTCTGCTCCGCTCGGCTGAGCTGTGCTGCGCTGG
GCCGCCAAGCCATGCCACGCCAGGCCTAGCCTTGCCTCGCCTGGCCCAGCCCTGCCCCGCCCGGCCGAGCCGTGCCGCGCCGG
GCGGCGAAGCGATGCGACGCGAGGCGTAGCGTTGCGTCGCGTGGCGCAGCGCTGCGCCGCGCGGCGGAGCGGTGCGGCGCGGG
GGAGGAAAGGAATGGAACGGAAGGGATAGGATTGGATCGGATGGGACAGGACTGGACCGGACGGGAGAGGAGTGGAGCGGAGG
GGTGGTAAGGTATGGTACGGTAGGGTTAGGTTTGGTTCGGTTGGGTCAGGTCTGGTCCGGTCGGGTGAGGTGTGGTGCGGTGG
GGCGGCAAGGCATGGCACGGCAGGGCTAGGCTTGGCTCGGCTGGGCCAGGCCTGGCCCGGCCGGGCGAGGCGTGGCGCGGCGG
GGGGGGAAGGGATGGGACGGGAGGGGTAGGGTTGGGTCGGGTGGGGCAGGGCTGGGCCGGGCGGGGGAGGGGTGGGGCGGGGG
Sampling rate: 1 / 20
overrepresented sequencecount (% of bases)distribution: cycle 1 ~ cycle 150
AAAAAACTGGACCAAGACACAGTTTTCGCCCTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTG127 (0.007941%)
AAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCCAATCGTTGTAGCCATCATTATATTTC36 (0.002251%)
AAAAACTGGACCAAGACACAGTTTTCGCCCTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGA12 (0.000750%)
AAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCA68 (0.004252%)
AAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACA53 (0.003314%)
AAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACC113 (0.007066%)
AAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAA24 (0.001501%)
AAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCC13 (0.000813%)
AAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCCAATCGTTGTAGCCATCATTATATTTCC9 (0.000563%)
AAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATT13 (0.000813%)
AAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCAT50 (0.003126%)
AAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGA83 (0.005190%)
AAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTAC23 (0.001438%)
AAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGG36 (0.002251%)
AAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTC49 (0.003064%)
AAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACAT17 (0.001063%)
AAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCCAATCGTTGTAGCCATCATTA6 (0.000375%)
AAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTAT22 (0.001376%)
AAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAA61 (0.003814%)
AAAATATTAGGTTGGGTTTAGTTTTTGTTTGGTGAGTTATTATTTTTGAGTTATTGTTGGTTGGAAATATTGTTAGTGAAGTGGAATAAATTAGGCGAGT212 (0.013256%)
AAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTC27 (0.001688%)
AAAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCC8 (0.000500%)
AAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTG33 (0.002063%)
AAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCT64 (0.004002%)
AAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAGGGATGAGTTGGATAAAACAATTCCG13 (0.000813%)
AAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGC4 (0.000250%)
AAACAGATTGGGTGAGACAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGA4 (0.000250%)
AAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGC17 (0.001063%)
AAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAA19 (0.001188%)
AAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAAC18 (0.001126%)
AAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGG12 (0.000750%)
AAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCT25 (0.001563%)
AAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCCAATCGTTGTAGCCATCATTATATTTCCT3 (0.000188%)
AAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGT4 (0.000250%)
AAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGC4 (0.000250%)
AAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCA10 (0.000625%)
AAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTT8 (0.000500%)
AAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCG31 (0.001938%)
AAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTC29 (0.001813%)
AAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTG14 (0.000875%)
AAACTGGACCAAGACACAGTTTTCGCCCTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGT3 (0.000188%)
AAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTG15 (0.000938%)
AAAGAAACAGATTGGGTGAGACAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAG14 (0.000875%)
AAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAA39 (0.002439%)
AAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACG20 (0.001251%)
AAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTG38 (0.002376%)
AAAGAATGGAGACGGTTGTTGATTAGGCGTTTTGAGGATGGGAATAGGATTGAAGGAAATATAATGATGGCTACAACGATTGGGAATCCTATTATTGTTG6 (0.000375%)
AAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGGCTGTACCTTGGCCATAACTATGTCACTGCCATTC3 (0.000188%)
AAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAAC66 (0.004127%)
AAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTT8 (0.000500%)
AAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCC18 (0.001126%)
AAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATC18 (0.001126%)
AAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGG32 (0.002001%)
AAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGC23 (0.001438%)
AAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATT48 (0.003001%)
AAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGAC16 (0.001000%)
AAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGC61 (0.003814%)
AAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCC64 (0.004002%)
AAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACT17 (0.001063%)
AAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACC6 (0.000375%)
AAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGA6 (0.000375%)
AAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCA13 (0.000813%)
AAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACA36 (0.002251%)
AAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGA30 (0.001876%)
AAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATG5 (0.000313%)
AAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCT48 (0.003001%)
AAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTT32 (0.002001%)
AAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGT60 (0.003752%)
AAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGG8 (0.000500%)
AAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACT11 (0.000688%)
AAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAA8 (0.000500%)
AAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTG14 (0.000875%)
AAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCA6 (0.000375%)
AAAGTCACCTGCAAGAAGTTTGACCTCAGGGTCAGCATAAGACCAGCCCCTGAGACAGCCAAGAAGCCCGAGGAAGCCAAGAATACCATGTTCCTTGAAA3 (0.000188%)
AAAGTCATGGCGTCCGCTTCTCCGTTCACAATCTTTTCAATGCAGTCCTCAGTGGTCTCTGCTGACTCACACTCTATCTTTCCCTCACTGATGATGCTCC4 (0.000250%)
AAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATT5 (0.000313%)
AAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAA6 (0.000375%)
AAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGT5 (0.000313%)
AAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAAC18 (0.001126%)
AAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATC3 (0.000188%)
AAATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTG6 (0.000375%)
AAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTT68 (0.004252%)
AAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTA10 (0.000625%)
AAATATGTCACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGAT243 (0.015195%)
AAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTA27 (0.001688%)
AAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCT7 (0.000438%)
AAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCA3 (0.000188%)
AAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCG40 (0.002501%)
AAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAGGGATGAG15 (0.000938%)
AAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCG8 (0.000500%)
AAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGT12 (0.000750%)
AAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCC14 (0.000875%)
AAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGA9 (0.000563%)
AAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCTGTAGGAGTATGG18 (0.001126%)
AAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTT18 (0.001126%)
AAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGA40 (0.002501%)
AAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGT17 (0.001063%)
AAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGATTAGGTGT5 (0.000313%)
AAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTG13 (0.000813%)
AAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGT4 (0.000250%)
AACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAA17 (0.001063%)
AACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAGGGAT32 (0.002001%)
AACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATT7 (0.000438%)
AACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTT5 (0.000313%)
AACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTC16 (0.001000%)
AACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAAC10 (0.000625%)
AACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACA7 (0.000438%)
AACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGG6 (0.000375%)
AACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAGGGATGAGTTGGATAAAACAATTCCGG3 (0.000188%)
AACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGG22 (0.001376%)
AACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATT31 (0.001938%)
AACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCT7 (0.000438%)
AACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCA7 (0.000438%)
AACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAG25 (0.001563%)
AACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAAC37 (0.002314%)
AACAGATTGGGTGAGACAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGAT5 (0.000313%)
AACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAA4 (0.000250%)
AACAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCT7 (0.000438%)
AACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCT22 (0.001376%)
AACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGT5 (0.000313%)
AACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGA8 (0.000500%)
AACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGC15 (0.000938%)
AACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACT13 (0.000813%)
AACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGA4 (0.000250%)
AACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTG14 (0.000875%)
AACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAG3 (0.000188%)
AACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCCAATCGTTGTAGCCATCATTATATTTCCTT3 (0.000188%)
AACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTTCACAGGCTTCCTGGTGCCATCA3 (0.000188%)
AACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCA4 (0.000250%)
AACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTC9 (0.000563%)
AACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAA10 (0.000625%)
AACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCG11 (0.000688%)
AACGATACCAACGTGGTCCACACCGTCAACACTGCCCTGGCTGCCTTCAACACACAGAATAATGGAACCTATTTTAAACTGGTGGAGATTTCCCGGGCTC3 (0.000188%)
AACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAAT5 (0.000313%)
AACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGAT5 (0.000313%)
AACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCA10 (0.000625%)
AACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGT3 (0.000188%)
AACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGC3 (0.000188%)
AACTGGACCAAGACACAGTTTTCGCCCTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTT3 (0.000188%)
AACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGA10 (0.000625%)
AACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACAC7 (0.000438%)
AACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAAC4 (0.000250%)
AACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATT5 (0.000313%)
AACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGG3 (0.000188%)
AACTTCTCCACCAGCTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTT211 (0.013194%)
AACTTCTCCGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACA3 (0.000188%)
AACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGT6 (0.000375%)
AACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGA5 (0.000313%)
AACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGT7 (0.000438%)
AAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTG31 (0.001938%)
AAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAAC17 (0.001063%)
AAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGA14 (0.000875%)
AAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGG11 (0.000688%)
AAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGC24 (0.001501%)
AAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGT32 (0.002001%)
AAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCG13 (0.000813%)
AAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTG21 (0.001313%)
AAGAACTGACGGCACTGATGGAGGACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGC9 (0.000563%)
AAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGG23 (0.001438%)
AAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCA62 (0.003877%)
AAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGG98 (0.006128%)
AAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTTGGCCTGGCTCTGAATCTCTGAGG8 (0.000500%)
AAGACACAGTTTTCGCCCTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGA8 (0.000500%)
AAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGC93 (0.005815%)
AAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCA31 (0.001938%)
AAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCC8 (0.000500%)
AAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGGCTGTACCTTGGCCATAACTATGTCACTGCCATTCG4 (0.000250%)
AAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACT12 (0.000750%)
AAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGA14 (0.000875%)
AAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACC3 (0.000188%)
AAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTA6 (0.000375%)
AAGAGCACACGTCTGAACTCCAGTCACCTATCCAGTGATC6 (0.000150%)
AAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTT18 (0.001126%)
AAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGC12 (0.000750%)
AAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTC5 (0.000313%)
AAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCA24 (0.001501%)
AAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACG3 (0.000188%)
AAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCAT3 (0.000188%)
AAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCG12 (0.000750%)
AAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGT22 (0.001376%)
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATC3062 (0.076587%)
AAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTT16 (0.001000%)
AAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACA9 (0.000563%)
AAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTG10 (0.000625%)
AAGCAAAGTCACCTGCAAGAAGTTTGACCTCAGGGTCAGCATAAGACCAGCCCCTGAGACAGCCAAGAAGCCCGAGGAAGCCAAGAATACCATGTTCCTT47 (0.002939%)
AAGCAACATGGCTTCTGCAAGGCAAATCTCATGCATAATCTTGGTGGGGAAGAAGTTTCAGTGGCCTGCAAGTTATTCCAAACACAGCCCCAGCCAGCCA4 (0.000250%)
AAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCT13 (0.000813%)
AAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCC55 (0.003439%)
AAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGT5 (0.000313%)
AAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTAT5 (0.000313%)
AAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCA10 (0.000625%)
AAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTT20 (0.001251%)
AAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCT3 (0.000188%)
AAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTA3 (0.000188%)
AAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCC7 (0.000438%)
AAGCCCGTGGCGGCGGAGTTTTATGGATCAGTGGAACATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACC6 (0.000375%)
AAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTG9 (0.000563%)
AAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGA7 (0.000438%)
AAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAG17 (0.001063%)
AAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAA9 (0.000563%)
AAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAG13 (0.000813%)
AAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAG3 (0.000188%)
AAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGA3 (0.000188%)
AAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGT5 (0.000313%)
AAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTG39 (0.002439%)
AAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGC6 (0.000375%)
AAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTC4 (0.000250%)
AAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTG3 (0.000188%)
AAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTT12 (0.000750%)
AAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGC30 (0.001876%)
AAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCA29 (0.001813%)
AAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGC21 (0.001313%)
AAGGCATCGGACACTAGCATCACCTGGAACAACCTGAAAGGCAAGAAGTCCTGCCACACTGGGGTAGACAGAACCGCTGGTTGGAACATCCCTATGGGCA5 (0.000313%)
AAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTC6 (0.000375%)
AAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTG25 (0.001563%)
AAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTT42 (0.002626%)
AAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTG8 (0.000500%)
AAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCG5 (0.000313%)
AAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCAT12 (0.000750%)
AAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGG8 (0.000500%)
AAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGC5 (0.000313%)
AAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGA10 (0.000625%)
AAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCC18 (0.001126%)
AAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGC15 (0.000938%)
AAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGG4 (0.000250%)
AAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAG10 (0.000625%)
AAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTT4 (0.000250%)
AAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGA3 (0.000188%)
AAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCA73 (0.004565%)
AAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACT9 (0.000563%)
AAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCA20 (0.001251%)
AAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCT3 (0.000188%)
AAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAG6 (0.000375%)
AAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAG8 (0.000500%)
AAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGCTT8 (0.000500%)
AAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACA13 (0.000813%)
AAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCA3 (0.000188%)
AAGTTTAACTAGTCAGTGTTGGAAAGAATGGAGACGGTTGTTGATTAGGCGTTTTGAGGATGGGAATAGGATTGAAGGAAATATAATGATGGCTACAACG4 (0.000250%)
AATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGG10 (0.000625%)
AATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACCTAAAATA4 (0.000250%)
AATAAGTTTAACTAGTCAGTGTTGGAAAGAATGGAGACGGTTGTTGATTAGGCGTTTTGAGGATGGGAATAGGATTGAAGGAAATATAATGATGGCTACA16 (0.001000%)
AATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATG9 (0.000563%)
AATACGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTA12 (0.000750%)
AATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAA262 (0.016383%)
AATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAA7 (0.000438%)
AATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGT4 (0.000250%)
AATATGGGGTGGGGTGTTTAGTGGATTAGCTGGTATGTAGTTGTCTGGGTCTCCTAGTATGTCTGGGAAAAATAATACTAGGGTTATGAGAATTAAGAAT3 (0.000188%)
AATATGTCACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATC5 (0.000313%)
AATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTC12 (0.000750%)
AATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTAC6 (0.000375%)
AATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTC6 (0.000375%)
AATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTG9 (0.000563%)
AATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGT14 (0.000875%)
AATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGT12 (0.000750%)
AATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGA40 (0.002501%)
AATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGC8 (0.000500%)
AATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTC14 (0.000875%)
AATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAGGGATGAGT3 (0.000188%)
AATCTAGCTCTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATTCTTATAGGAATTA3 (0.000188%)
AATCTGCTTCTCCTTCTCTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGA5 (0.000313%)
AATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAA13 (0.000813%)
AATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGG17 (0.001063%)
AATGCAGTCCTCAGTGGTCTCTGCTGACTCACACTCTATCTTTCCCTCACTGATGATGCTCCACTCGTCACACTTGGTTCTCTCCAGGTGACTCAGTGCA4 (0.000250%)
AATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAA6 (0.000375%)
AATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCT9 (0.000563%)
AATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCAT13 (0.000813%)
AATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAG3 (0.000188%)
AATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCA3 (0.000188%)
AATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTT5 (0.000313%)
AATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAG11 (0.000688%)
AATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCAC11 (0.000688%)
AATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCT32 (0.002001%)
AATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAAT15 (0.000938%)
AATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGC6 (0.000375%)
AATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTC6 (0.000375%)
AATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGTCAGAAAT4 (0.000250%)
AATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGG10 (0.000625%)
AATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGA6 (0.000375%)
AATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGT3 (0.000188%)
AATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTT60 (0.003752%)
AATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCC22 (0.001376%)
AATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTAT4 (0.000250%)
ACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCA16 (0.001000%)
ACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAG8 (0.000500%)
ACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTA11 (0.000688%)
ACAAAGTGAAGGATTTCGCTAATGTGTATGTGGATGCGGTCAAAGACAGCGGCAGAGACTATGTGTCCCAGTTTGAATCCTCCTCCTTGGGCCAACAGCT4 (0.000250%)
ACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCC3 (0.000188%)
ACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAGGGATG6 (0.000375%)
ACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCA16 (0.001000%)
ACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTT8 (0.000500%)
ACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGA15 (0.000938%)
ACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAA4 (0.000250%)
ACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCC9 (0.000563%)
ACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATA701 (0.043833%)
ACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTT30 (0.001876%)
ACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACT5 (0.000313%)
ACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGT5 (0.000313%)
ACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGT10 (0.000625%)
ACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACT19 (0.001188%)
ACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAG14 (0.000875%)
ACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGC5 (0.000313%)
ACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCT4 (0.000250%)
ACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTG3 (0.000188%)
ACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACG4 (0.000250%)
ACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTG13 (0.000813%)
ACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCA8 (0.000500%)
ACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCA3 (0.000188%)
ACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAAC3 (0.000188%)
ACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTG10 (0.000625%)
ACACGTCTGAACTCCAGTCACCTATCCAGTGATCTCGTAT10 (0.000250%)
ACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGC3 (0.000188%)
ACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGA3 (0.000188%)
ACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAG9 (0.000563%)
ACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAG4 (0.000250%)
ACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGG7 (0.000438%)
ACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACC7 (0.000438%)
ACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTC7 (0.000438%)
ACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCA10 (0.000625%)
ACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTTCACAGGCTTCCTGG3 (0.000188%)
ACAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTG3 (0.000188%)
ACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTG5 (0.000313%)
ACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTA4 (0.000250%)
ACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAA6 (0.000375%)
ACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAA3 (0.000188%)
ACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATAC3 (0.000188%)
ACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGGAATGTT3 (0.000188%)
ACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCT3 (0.000188%)
ACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACA4 (0.000250%)
ACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACA8 (0.000500%)
ACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGT3 (0.000188%)
ACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGA3 (0.000188%)
ACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACC3 (0.000188%)
ACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCA5 (0.000313%)
ACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCA3 (0.000188%)
ACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCC4 (0.000250%)
ACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCT22 (0.001376%)
ACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGT23 (0.001438%)
ACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCA4 (0.000250%)
ACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTC3 (0.000188%)
ACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCT32 (0.002001%)
ACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCC254 (0.015883%)
ACCACACTGGCCTGCAATGTAGGCATGTCCTCCATCCAAAGTCATGGCGTCCGCTTCTCCGTTCACAATCTTTTCAATGCAGTCCTCAGTGGTCTCTGCT191 (0.011943%)
ACCACAGCCACGGCATAATACCCTTTAGGAAAGATACCTTGTTGTGATGGGATGGCACAATTAGAGCTCTCGTAGTACTCTGCCATGACAGGCACTAGAC147 (0.009192%)
ACCAGCTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACT16 (0.001000%)
ACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGC3 (0.000188%)
ACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCA14 (0.000875%)
ACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACAC5 (0.000313%)
ACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACAT4 (0.000250%)
ACCCAACCCCCATCCAAGGTCATAGCATCGGCTTCACTTGCAGAAATGGCCTTGATGCAATCCGGATAGGAGGTTTTCTTCACACAGGCAAGCCGGGGGC4 (0.000250%)
ACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGA8 (0.000500%)
ACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCA4 (0.000250%)
ACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTTCACAGGCTTCCTGGTGCCATCAG3 (0.000188%)
ACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAG4 (0.000250%)
ACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGG9 (0.000563%)
ACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAA10 (0.000625%)
ACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGA16 (0.001000%)
ACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATT4 (0.000250%)
ACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCT21 (0.001313%)
ACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCT3 (0.000188%)
ACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATG6 (0.000375%)
ACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCT35 (0.002189%)
ACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGG3 (0.000188%)
ACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACC3 (0.000188%)
ACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAG3 (0.000188%)
ACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAAC3 (0.000188%)
ACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCA11 (0.000688%)
ACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAG3 (0.000188%)
ACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGT18 (0.001126%)
ACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTC15 (0.000938%)
ACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGA8 (0.000500%)
ACGATACCAACGTGGTCCACACCGTCAACACTGCCCTGGCTGCCTTCAACACACAGAATAATGGAACCTATTTTAAACTGGTGGAGATTTCCCGGGCTCA5 (0.000313%)
ACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGA7 (0.000438%)
ACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCT6 (0.000375%)
ACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATG11 (0.000688%)
ACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATA4 (0.000250%)
ACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGG5 (0.000313%)
ACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAG12 (0.000750%)
ACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATT24 (0.001501%)
ACGGCACTGATGGAGGACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGG3 (0.000188%)
ACGGCATCTTCCTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGG200 (0.012506%)
ACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCA8 (0.000500%)
ACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCA10 (0.000625%)
ACGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATA3 (0.000188%)
ACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCG12 (0.000750%)
ACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGT3 (0.000188%)
ACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATT6 (0.000375%)
ACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGC30 (0.001876%)
ACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAG9 (0.000563%)
ACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAA16 (0.001000%)
ACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATT4 (0.000250%)
ACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTA3 (0.000188%)
ACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAA15 (0.000938%)
ACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCA3 (0.000188%)
ACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTA3 (0.000188%)
ACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGG3 (0.000188%)
ACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCA3 (0.000188%)
ACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCT11 (0.000688%)
ACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTC3 (0.000188%)
ACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAG4 (0.000250%)
ACTGATGCTCCTGCATGGGCTAGATTTCCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGA4 (0.000250%)
ACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTG8 (0.000500%)
ACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCAT16 (0.001000%)
ACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGT11 (0.000688%)
ACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCA10 (0.000625%)
ACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGA7 (0.000438%)
ACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACT5 (0.000313%)
ACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATC3 (0.000188%)
ACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGAT7 (0.000438%)
ACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGT17 (0.001063%)
ACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTG6 (0.000375%)
ACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGAC7 (0.000438%)
ACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCAT116 (0.007253%)
ACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCCCAAAT5 (0.000313%)
ACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTG10 (0.000625%)
ACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAG4 (0.000250%)
ACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTA7 (0.000438%)
ACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTG5 (0.000313%)
ACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTC3 (0.000188%)
ACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATC3 (0.000188%)
ACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTG10 (0.000625%)
ACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGGT5 (0.000313%)
ACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCG4 (0.000250%)
ACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTT11 (0.000688%)
ACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACT1088 (0.068032%)
ACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTC4 (0.000250%)
AGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGT26 (0.001626%)
AGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGT6 (0.000375%)
AGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACC11 (0.000688%)
AGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACT15 (0.000938%)
AGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAG21 (0.001313%)
AGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAA40 (0.002501%)
AGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGA23 (0.001438%)
AGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCC16 (0.001000%)
AGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAG5 (0.000313%)
AGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATC21 (0.001313%)
AGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTG57 (0.003564%)
AGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGAC4 (0.000250%)
AGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGT10 (0.000625%)
AGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGT4 (0.000250%)
AGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCAT58 (0.003627%)
AGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGT37 (0.002314%)
AGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAA14 (0.000875%)
AGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAA5 (0.000313%)
AGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTT5 (0.000313%)
AGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGA32 (0.002001%)
AGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGA14 (0.000875%)
AGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCT14 (0.000875%)
AGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGT18 (0.001126%)
AGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGA9 (0.000563%)
AGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGA10 (0.000625%)
AGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAG15 (0.000938%)
AGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAG12 (0.000750%)
AGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCA5 (0.000313%)
AGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGATTAGGTGTATTAATA5 (0.000313%)
AGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGT33 (0.002063%)
AGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCT31 (0.001938%)
AGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTT11 (0.000688%)
AGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCAC7 (0.000438%)
AGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTC3 (0.000188%)
AGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCC10 (0.000625%)
AGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAA12 (0.000750%)
AGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCT66 (0.004127%)
AGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAA45 (0.002814%)
AGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCA4 (0.000250%)
AGACTCTGCAGAGGACGTTCGTAAGTTGTGCCCACGGTGCCCACTCCTGACTCCGTTCAACGATACCAACGTGGTCCACACCGTCAACACTGCCCTGGCT4 (0.000250%)
AGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTA33 (0.002063%)
AGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAG9 (0.000563%)
AGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCG17 (0.001063%)
AGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTG10 (0.000625%)
AGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTT19 (0.001188%)
AGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTC16 (0.001000%)
AGAGAAGCAACATGGCTTCTGCAAGGCAAATCTCATGCATAATCTTGGTGGGGAAGAAGTTTCAGTGGCCTGCAAGTTATTCCAAACACAGCCCCAGCCA3 (0.000188%)
AGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGG23 (0.001438%)
AGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGAC5 (0.000313%)
AGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGC69 (0.004315%)
AGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTG37 (0.002314%)
AGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAA4 (0.000250%)
AGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGT10 (0.000625%)
AGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGT4 (0.000250%)
AGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGTCAGAAATCGTGCA3 (0.000188%)
AGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCA6 (0.000375%)
AGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCA11 (0.000688%)
AGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAG6 (0.000375%)
AGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTG3 (0.000188%)
AGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATG7 (0.000438%)
AGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCC9 (0.000563%)
AGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCGG6 (0.000375%)
AGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATAT4 (0.000250%)
AGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATG8 (0.000500%)
AGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGT20 (0.001251%)
AGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTG15 (0.000938%)
AGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAA8 (0.000500%)
AGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGT9 (0.000563%)
AGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGG37 (0.002314%)
AGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAG9 (0.000563%)
AGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGC7 (0.000438%)
AGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGC63 (0.005830%)
AGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCA11 (0.000688%)
AGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCA19 (0.001188%)
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATCC1774 (0.044371%)
AGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAA6 (0.000375%)
AGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAA4 (0.000250%)
AGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTG34 (0.002126%)
AGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGA7 (0.000438%)
AGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCC19 (0.001188%)
AGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTAC10 (0.000625%)
AGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAA6 (0.000375%)
AGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCT5 (0.000313%)
AGATTGGGTGAGACAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTG3 (0.000188%)
AGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAGGGATGAGTTGGATAAAACAATT6 (0.000375%)
AGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTG19 (0.001188%)
AGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCT3 (0.000188%)
AGCAAAGTCACCTGCAAGAAGTTTGACCTCAGGGTCAGCATAAGACCAGCCCCTGAGACAGCCAAGAAGCCCGAGGAAGCCAAGAATACCATGTTCCTTG6 (0.000375%)
AGCAACAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTT10 (0.000625%)
AGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCT15 (0.000938%)
AGCAAGTCTAGCTAATCTAGCTCTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATT7 (0.000438%)
AGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCA45 (0.002814%)
AGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTG9 (0.000563%)
AGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTG11 (0.000688%)
AGCACACGTCTGAACTCCAGTCACCTATCCAGTGATCTCG6 (0.000150%)
AGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGT3 (0.000188%)
AGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCT39 (0.002439%)
AGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACA8 (0.000500%)
AGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTG6 (0.000375%)
AGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATA5 (0.000313%)
AGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTA24 (0.001501%)
AGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTC10 (0.000625%)
AGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTT19 (0.001188%)
AGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGT3 (0.000188%)
AGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCA17 (0.001063%)
AGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGA9 (0.000563%)
AGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACA6 (0.000375%)
AGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGG6 (0.000375%)
AGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGC30 (0.001876%)
AGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGC3 (0.000188%)
AGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGA4 (0.000250%)
AGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACA3 (0.000188%)
AGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAG8 (0.000500%)
AGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAG29 (0.001813%)
AGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGA7 (0.000438%)
AGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTG17 (0.001063%)
AGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCG54 (0.003377%)
AGCCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACT4 (0.000250%)
AGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAAC4 (0.000250%)
AGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTAT8 (0.000500%)
AGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATC5 (0.000313%)
AGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCA9 (0.000563%)
AGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACC3 (0.000188%)
AGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGA6 (0.000375%)
AGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCC16 (0.001000%)
AGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTA11 (0.000688%)
AGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAG6 (0.000375%)
AGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCA5 (0.000313%)
AGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGA6 (0.000375%)
AGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTG10 (0.000625%)
AGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCG3 (0.000188%)
AGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGAG3 (0.000188%)
AGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCA11 (0.000688%)
AGCTAATCTAGCTCTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATTCTTATAGGA6 (0.000375%)
AGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACA16 (0.001000%)
AGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTA5 (0.000313%)
AGCTCTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATTCTTATAGGAATTAACATT3 (0.000188%)
AGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGG3 (0.000188%)
AGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAG6 (0.000375%)
AGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGA23 (0.001438%)
AGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCTGCTGTAGACGTGGCTGTAAAAGTG3 (0.000188%)
AGCTGGTCCATCAGTCCAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCA5 (0.000313%)
AGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAA11 (0.000688%)
AGCTTCAGTATCATTGGTGCCCTATGGTTTTAACGGTTAATACGGGGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGAGAGGGGAGAGCAATTAT3 (0.000188%)
AGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATG4 (0.000250%)
AGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCT8 (0.000500%)
AGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCT12 (0.000750%)
AGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAAC19 (0.001188%)
AGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTA4 (0.000250%)
AGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAA22 (0.001376%)
AGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGG61 (0.003814%)
AGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCT12 (0.000750%)
AGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTG5 (0.000313%)
AGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCAT6 (0.000375%)
AGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACT16 (0.001000%)
AGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTT19 (0.001188%)
AGGAATGTCCCCTCGGCCAGAGAACTCATTCTTGTGGTTCAGTAGCACCTCCTTGACAGCCTTGTAGCCATGCAGGACCACGATGCGCCTCTGACCCAGG5 (0.000313%)
AGGAATTGCGATAATTATAGTGGCTGATGTAAAGTAAGCTCGTGTGTCTACATCTAATCCTACTGTGAATATGTGGTGGGCTCATACAATAAAGCCTAGA4 (0.000250%)
AGGACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCA4 (0.000250%)
AGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATC3 (0.000188%)
AGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCT6 (0.000375%)
AGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGC6 (0.000375%)
AGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGC4 (0.000250%)
AGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCA5 (0.000313%)
AGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAA4 (0.000250%)
AGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTC4 (0.000250%)
AGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGA9 (0.000563%)
AGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTG62 (0.003877%)
AGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCC12 (0.000750%)
AGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACT3 (0.000188%)
AGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCAC34 (0.002126%)
AGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCC4 (0.000250%)
AGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATA9 (0.000563%)
AGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTC12 (0.000750%)
AGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCT25 (0.001563%)
AGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACT17 (0.001063%)
AGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAG12 (0.000750%)
AGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGA12 (0.000750%)
AGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTC16 (0.001000%)
AGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGA3 (0.000188%)
AGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGT3 (0.000188%)
AGGGACACTTATATTTCGCTCTCACCTAATATCCACATTACTATGCCTGGAAGGCATAGTATTATCCTTATTTATTATAACTTCAGTAACTTCCCTAAAC378 (0.023636%)
AGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGT94 (0.008699%)
AGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACAC6 (0.000375%)
AGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATT6 (0.000375%)
AGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTT13 (0.000813%)
AGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGG8 (0.000500%)
AGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATA5 (0.000313%)
AGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGT3 (0.000188%)
AGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCA3 (0.000188%)
AGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAG6 (0.000375%)
AGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGC3 (0.000188%)
AGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACA5 (0.000313%)
AGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGA3 (0.000188%)
AGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTT5 (0.000313%)
AGGTTAGTGGTAGTAGCATTAGTGAGGGAAGAATAATTTTTAGCATTGTAGTAGGTTGAGATTTTGGACGTAATCTGTTCCGTACGTGTTTGAAACTTTT3 (0.000188%)
AGGTTGAGCACTTCCTCATGTTACCGACAGATTGCATGTACTCCGCTCCTAAGTATTTTTCAGGTGTGGTACCCTCTGGAAGTTTAACGAAACATTTGGT3 (0.000188%)
AGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGA3 (0.000188%)
AGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCA22 (0.001376%)
AGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCG4 (0.000250%)
AGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTT3 (0.000188%)
AGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCC10 (0.000625%)
AGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTA3 (0.000188%)
AGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTG8 (0.000500%)
AGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGG10 (0.000625%)
AGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGC6 (0.000375%)
AGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGC5 (0.000313%)
AGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTC7 (0.000438%)
AGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTTCACAGGC4 (0.000250%)
AGTCAGTATATTCGTAGCTTCAGTATCATTGGTGCCCTATGGTTTTAACGGTTAATACGGGGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGAGA4 (0.000250%)
AGTCAGTGTTGGAAAGAATGGAGACGGTTGTTGATTAGGCGTTTTGAGGATGGGAATAGGATTGAAGGAAATATAATGATGGCTACAACGATTGGGAATC7 (0.000438%)
AGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCC4 (0.000250%)
AGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGG6 (0.000375%)
AGTCTCAGCAACAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGC624 (0.039019%)
AGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAA4 (0.000250%)
AGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAG5 (0.000313%)
AGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTA9 (0.000563%)
AGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAG16 (0.001000%)
AGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGT4 (0.000250%)
AGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAAT4 (0.000250%)
AGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACT27 (0.001688%)
AGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCAT4 (0.000250%)
AGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAA5 (0.000313%)
AGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTG6 (0.000375%)
AGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAA3 (0.000188%)
AGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGCTTC3 (0.000188%)
AGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTT12 (0.000750%)
AGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAA30 (0.001876%)
AGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTT5 (0.000313%)
AGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTT3 (0.000188%)
AGTTTAACTAGTCAGTGTTGGAAAGAATGGAGACGGTTGTTGATTAGGCGTTTTGAGGATGGGAATAGGATTGAAGGAAATATAATGATGGCTACAACGA3 (0.000188%)
AGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGT5 (0.000313%)
AGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCT7 (0.000438%)
ATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCA21 (0.001313%)
ATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGA17 (0.001063%)
ATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGC10 (0.000625%)
ATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATAC12 (0.000750%)
ATAACCTGGAGAAAGAAACAGATTGGGTGAGACAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAA9 (0.000563%)
ATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACA14 (0.000875%)
ATAAGTTTAACTAGTCAGTGTTGGAAAGAATGGAGACGGTTGTTGATTAGGCGTTTTGAGGATGGGAATAGGATTGAAGGAAATATAATGATGGCTACAA8 (0.000500%)
ATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCA9 (0.000563%)
ATACACCACTCCGAAGGGCCGCCGAGACCACACCTTGACTTTGTCGATCTGATTCAAGACCTGTTTGAATCCCTGAAGAAGATGATTATTGAGGTAGTCC3 (0.000188%)
ATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGGAATG3 (0.000188%)
ATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGA3 (0.000188%)
ATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAA3 (0.000188%)
ATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACT17 (0.001063%)
ATACGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAA6 (0.000375%)
ATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTG13 (0.000813%)
ATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACG4 (0.000250%)
ATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAG10 (0.000625%)
ATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAA4 (0.000250%)
ATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGG6 (0.000375%)
ATAGTCAGTATATTCGTAGCTTCAGTATCATTGGTGCCCTATGGTTTTAACGGTTAATACGGGGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGA3 (0.000188%)
ATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCA12 (0.000750%)
ATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGAT24 (0.001501%)
ATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTT18 (0.001126%)
ATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCC6 (0.000375%)
ATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTG20 (0.001251%)
ATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCT4 (0.000250%)
ATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTC39 (0.002439%)
ATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAG7 (0.000438%)
ATATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAA4 (0.000250%)
ATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTT11 (0.000688%)
ATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCA29 (0.001813%)
ATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCT8 (0.000500%)
ATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCAT44 (0.002751%)
ATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGA20 (0.001251%)
ATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTA3 (0.000188%)
ATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGA13 (0.000813%)
ATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCA14 (0.000875%)
ATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTC8 (0.000500%)
ATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCG24 (0.001501%)
ATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGC10 (0.000625%)
ATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAG10 (0.000625%)
ATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACA3 (0.000188%)
ATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCA10 (0.000625%)
ATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGAT9 (0.000563%)
ATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGC15 (0.000938%)
ATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTA6 (0.000375%)
ATCAGGGCTCTTTACTGACTGCAGCCAAGGATGCTGTTCACCTTCTGAGGCTGAGGCAGACTCTTGGCTGCATTCAGTTTGTCTATACTGCTATAGCAGT99 (0.006190%)
ATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGG34 (0.002126%)
ATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCAGAACGACTCGG17 (0.001063%)
ATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCA3 (0.000188%)
ATCATTGGTGCCCTATGGTTTTAACGGTTAATACGGGGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGAGAGGGGAGAGCAATTATGATAAGGAT6 (0.000375%)
ATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCA15 (0.000938%)
ATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGGG3 (0.000188%)
ATCCACATTACTATGCCTGGAAGGCATAGTATTATCCTTATTTATTATAACTTCAGTAACTTCCCTAAACTCCAACTCCATAAGCTCCATACCAATCCCC3 (0.000188%)
ATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGG36 (0.002251%)
ATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTA6 (0.000375%)
ATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGAT6 (0.000375%)
ATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAA9 (0.000563%)
ATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAA19 (0.001188%)
ATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTC7 (0.000438%)
ATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCT7 (0.000438%)
ATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCT17 (0.001063%)
ATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGC11 (0.000688%)
ATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGAC6 (0.000375%)
ATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTA3 (0.000188%)
ATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCA45 (0.002814%)
ATCGCCACCCTCCTCCTCGTATCCATCTGGAAACAGATCTATAGAAGTTGGAACCTGCCCCCAGGACCTTTCCCAATTCCTTTCTTTGGAAACATTTTTC296 (0.018509%)
ATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATG23 (0.001438%)
ATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCG15 (0.000938%)
ATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATCCAG10 (0.000250%)
ATCGGACACTAGCATCACCTGGAACAACCTGAAAGGCAAGAAGTCCTGCCACACTGGGGTAGACAGAACCGCTGGTTGGAACATCCCTATGGGCATGCTG7 (0.000438%)
ATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGG16 (0.001000%)
ATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATT20 (0.001251%)
ATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAA12 (0.000750%)
ATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCA8 (0.000500%)
ATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTAT8 (0.000500%)
ATCTAGCTCTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATTCTTATAGGAATTAA4 (0.000250%)
ATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGC14 (0.000875%)
ATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCA5 (0.000313%)
ATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTG12 (0.000750%)
ATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGA6 (0.000375%)
ATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATA10 (0.000625%)
ATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAAT3 (0.000188%)
ATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGAT3 (0.000188%)
ATCTGCTTCTCCTTCTCTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAG23 (0.001438%)
ATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAAT14 (0.000875%)
ATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCG5 (0.000313%)
ATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAG5 (0.000313%)
ATCTTCCTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAG8 (0.000500%)
ATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTA14 (0.000875%)
ATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCA12 (0.000750%)
ATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGC4 (0.000250%)
ATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACAC9 (0.000563%)
ATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAAC12 (0.000750%)
ATGAACTTCTCCGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGG16 (0.001000%)
ATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAA5 (0.000313%)
ATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGT4 (0.000250%)
ATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACC6 (0.000375%)
ATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAA60 (0.003752%)
ATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAA3 (0.000188%)
ATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCA10 (0.000625%)
ATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACG8 (0.000500%)
ATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCA8 (0.000500%)
ATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGC8 (0.000500%)
ATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATA8 (0.000500%)
ATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTG10 (0.000625%)
ATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGG5 (0.000313%)
ATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGA4 (0.000250%)
ATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAGGGATGAGTTGGATAAAA3 (0.000188%)
ATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGA4 (0.000250%)
ATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGA12 (0.000750%)
ATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCA8 (0.000500%)
ATGCAACCTGCTGGCAGAGAAGCAACATGGCTTCTGCAAGGCAAATCTCATGCATAATCTTGGTGGGGAAGAAGTTTCAGTGGCCTGCAAGTTATTCCAA3 (0.000188%)
ATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAA3 (0.000188%)
ATGCAGAGCCTGTTCACTCAATACTTTCAGAGCATGACTGATTATGGCAAAGATTTGATGGAGAAGGCCAAGACCTCAGAGATTCAGAGCCAGGCCAAGG4 (0.000250%)
ATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTT6 (0.000375%)
ATGCAGTCCTCAGTGGTCTCTGCTGACTCACACTCTATCTTTCCCTCACTGATGATGCTCCACTCGTCACACTTGGTTCTCTCCAGGTGACTCAGTGCAC14 (0.000875%)
ATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGA4 (0.000250%)
ATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTG7 (0.000438%)
ATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAG4 (0.000250%)
ATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGG5 (0.000313%)
ATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATAT7 (0.000438%)
ATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGT5 (0.000313%)
ATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAG25 (0.001563%)
ATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTT4 (0.000250%)
ATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATA10 (0.000625%)
ATGGAGGACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGG5 (0.000313%)
ATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACC3 (0.000188%)
ATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGG22 (0.001376%)
ATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCT29 (0.001813%)
ATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGG12 (0.000750%)
ATGGCATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCAGAACGA4 (0.000250%)
ATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAA14 (0.000875%)
ATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGC51 (0.003189%)
ATGGCGTCCGCTTCTCCGTTCACAATCTTTTCAATGCAGTCCTCAGTGGTCTCTGCTGACTCACACTCTATCTTTCCCTCACTGATGATGCTCCACTCGT5 (0.000313%)
ATGGGAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCAC401 (0.025074%)
ATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGA6 (0.000375%)
ATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTC5 (0.000313%)
ATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGT3 (0.000188%)
ATGGTTTTAACGGTTAATACGGGGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGAGAGGGGAGAGCAATTATGATAAGGATTACAGCTGGTAGAA4 (0.000250%)
ATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGA16 (0.001000%)
ATGTAGTTGTCTGGGTCTCCTAGTATGTCTGGGAAAAATAATACTAGGGTTATGAGAATTAAGAATATGATTAGGATACCTAGGATATCTTTGATTGTAT61 (0.003814%)
ATGTCACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCAT4 (0.000250%)
ATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGC6 (0.000375%)
ATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCT21 (0.001313%)
ATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTT14 (0.000875%)
ATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACA6 (0.000375%)
ATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGA10 (0.000625%)
ATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATG7 (0.000438%)
ATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACA3 (0.000188%)
ATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGC3 (0.000188%)
ATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTC10 (0.000625%)
ATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCG6 (0.000375%)
ATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGT25 (0.001563%)
ATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTC8 (0.000500%)
ATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATA17 (0.001063%)
ATTAGGTTGGGTTTAGTTTTTGTTTGGTGAGTTATTATTTTTGAGTTATTGTTGGTTGGAAATATTGTTAGTGAAGTGGAATAAATTAGGCGAGTATAAA10 (0.000625%)
ATTATGCCGTGGCTGTGGTGAAGGCATCGGACACTAGCATCACCTGGAACAACCTGAAAGGCAAGAAGTCCTGCCACACTGGGGTAGACAGAACCGCTGG3 (0.000188%)
ATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCC58 (0.003627%)
ATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACC8 (0.000500%)
ATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACC9 (0.000563%)
ATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAG4 (0.000250%)
ATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATA21 (0.001313%)
ATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAG41 (0.002564%)
ATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTAC12 (0.000750%)
ATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGT30 (0.001876%)
ATTCTAATAAACGCCCTAACAACTATTATCTTCCTAGGACCCCTATACTATATCAATTTACCAGAACTCTACTCAACTAACTTCATAATAGAAGCTCTAC3 (0.000188%)
ATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACAC43 (0.002689%)
ATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGC17 (0.001063%)
ATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCA10 (0.000625%)
ATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGA11 (0.000688%)
ATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGA21 (0.001313%)
ATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAGG9 (0.000563%)
ATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGG3 (0.000188%)
ATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGT28 (0.001751%)
ATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGC8 (0.000500%)
ATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGG5 (0.000313%)
ATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGAC24 (0.001501%)
ATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAG13 (0.000813%)
ATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAA11 (0.000688%)
ATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGAT17 (0.001063%)
ATTGGGTGAGACAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGA3 (0.000188%)
ATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACA42 (0.002626%)
ATTGGTGCCCTATGGTTTTAACGGTTAATACGGGGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGAGAGGGGAGAGCAATTATGATAAGGATTAC4 (0.000250%)
ATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTA30 (0.001876%)
ATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATT10 (0.000625%)
ATTTAGTCGGCCTGGGATGGCATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGT42 (0.002626%)
ATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAA50 (0.003126%)
ATTTCAACTAAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACG15 (0.000938%)
ATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTT43 (0.002689%)
ATTTCCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAA143 (0.008942%)
ATTTCGCTCTCACCTAATATCCACATTACTATGCCTGGAAGGCATAGTATTATCCTTATTTATTATAACTTCAGTAACTTCCCTAAACTCCAACTCCATA5 (0.000313%)
ATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCA3 (0.000188%)
ATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCT20 (0.001251%)
ATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGT32 (0.002001%)
ATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTG20 (0.001251%)
ATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAAC8 (0.000500%)
ATTTGTGCCAATTTCTGGTTGGAATGGTGACAACATGCTGGAGCCAAGTGCTAATATGCCTTGGTTCAAGGGATGGAAAGTCACCCGCAAAGATGGCAGT3 (0.000188%)
ATTTGTGTCTGAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCTGCTGTAGACGTG3 (0.000188%)
ATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTG44 (0.002751%)
ATTTGTTTGATAATAAGTTTAACTAGTCAGTGTTGGAAAGAATGGAGACGGTTGTTGATTAGGCGTTTTGAGGATGGGAATAGGATTGAAGGAAATATAA153 (0.009567%)
ATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGT15 (0.000938%)
ATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTAC20 (0.001251%)
ATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATC17 (0.001063%)
ATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACT56 (0.003502%)
ATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTA49 (0.003064%)
CAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTC58 (0.003627%)
CAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCAC58 (0.003627%)
CAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCA36 (0.002251%)
CAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTA119 (0.007441%)
CAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACG35 (0.002189%)
CAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGT31 (0.001938%)
CAAAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTC20 (0.001251%)
CAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGT72 (0.004502%)
CAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAGGGATGAGTTGGATAAAACAATTCC6 (0.000375%)
CAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAG60 (0.003752%)
CAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACC20 (0.001251%)
CAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCT17 (0.001063%)
CAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTT123 (0.007691%)
CAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAA85 (0.005315%)
CAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGT6 (0.000375%)
CAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGC22 (0.001376%)
CAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTG23 (0.001438%)
CAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTAT50 (0.003126%)
CAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACG211 (0.013194%)
CAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGG13 (0.000813%)
CAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCC13 (0.000813%)
CAAAGTCATGGCGTCCGCTTCTCCGTTCACAATCTTTTCAATGCAGTCCTCAGTGGTCTCTGCTGACTCACACTCTATCTTTCCCTCACTGATGATGCTC5 (0.000313%)
CAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTG4 (0.000250%)
CAAAGTGAAGGATTTCGCTAATGTGTATGTGGATGCGGTCAAAGACAGCGGCAGAGACTATGTGTCCCAGTTTGAATCCTCCTCCTTGGGCCAACAGCTG4 (0.000250%)
CAAATAAAGTCTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCT235 (0.014695%)
CAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCT24 (0.001501%)
CAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCC53 (0.003314%)
CAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAGGGATGA3 (0.000188%)
CAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAATTAC16 (0.001000%)
CAAATGCAACCTGCTGGCAGAGAAGCAACATGGCTTCTGCAAGGCAAATCTCATGCATAATCTTGGTGGGGAAGAAGTTTCAGTGGCCTGCAAGTTATTC5 (0.000313%)
CAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCTGTAGGAGTATG9 (0.000563%)
CAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTT23 (0.001438%)
CAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTG72 (0.004502%)
CAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAG13 (0.000813%)
CAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGATTAGGTG8 (0.000500%)
CAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGT40 (0.002501%)
CAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCA6 (0.000375%)
CAACAAATCTCCTAGGCCTTTTACCACATACATTTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTATGAGCTGGAGCCGTAAT13 (0.000813%)
CAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAA18 (0.001126%)
CAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGAC12 (0.000750%)
CAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAG18 (0.001126%)
CAACACTGCCCTGGCTGCCTTCAACACACAGAATAATGGAACCTATTTTAAACTGGTGGAGATTTCCCGGGCTCAAAATGTGCCTCTCCCAGTGTCTACT12 (0.000750%)
CAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAG6 (0.000375%)
CAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCAT54 (0.003377%)
CAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATC22 (0.001376%)
CAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCA25 (0.001563%)
CAACAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCC12 (0.000750%)
CAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAG17 (0.001063%)
CAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTGT4 (0.000250%)
CAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTG60 (0.003752%)
CAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTA24 (0.001501%)
CAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAA43 (0.002689%)
CAACCCCCATCCAAGGTCATAGCATCGGCTTCACTTGCAGAAATGGCCTTGATGCAATCCGGATAGGAGGTTTTCTTCACACAGGCAAGCCGGGGGCCAT5 (0.000313%)
CAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTT13 (0.000813%)
CAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGC8 (0.000500%)
CAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCC30 (0.001876%)
CAACGTGGTCCACACCGTCAACACTGCCCTGGCTGCCTTCAACACACAGAATAATGGAACCTATTTTAAACTGGTGGAGATTTCCCGGGCTCAAAATGTG5 (0.000313%)
CAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGA11 (0.000688%)
CAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTC30 (0.001876%)
CAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTG14 (0.000875%)
CAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACA31 (0.001938%)
CAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAA23 (0.001438%)
CAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTC36 (0.002251%)
CAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAAT19 (0.001188%)
CAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGG62 (0.003877%)
CAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGT13 (0.000813%)
CAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCC41 (0.002564%)
CAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTT76 (0.004752%)
CAAGAACTGACGGCACTGATGGAGGACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGG208 (0.013006%)
CAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGC148 (0.009254%)
CAAGAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGG905 (0.056589%)
CAAGACACAGTTTTCGCCCTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGG6 (0.000375%)
CAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCT14 (0.000875%)
CAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATAC42 (0.002626%)
CAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTC60 (0.003752%)
CAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGT3 (0.000188%)
CAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCG11 (0.000688%)
CAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATA70 (0.004377%)
CAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGG56 (0.003502%)
CAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTT11 (0.000688%)
CAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCG38 (0.002376%)
CAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTG14 (0.000875%)
CAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCC148 (0.009254%)
CAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTG22 (0.001376%)
CAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACT49 (0.003064%)
CAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAG55 (0.003439%)
CAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCCGGAT3 (0.000188%)
CAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGC114 (0.007128%)
CAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTC22 (0.001376%)
CAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCA20 (0.001251%)
CAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAA15 (0.000938%)
CAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGCT37 (0.002314%)
CAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTC11 (0.000688%)
CAATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCT8 (0.000500%)
CAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAG184 (0.011505%)
CAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTT70 (0.004377%)
CAATGCAGTCCTCAGTGGTCTCTGCTGACTCACACTCTATCTTTCCCTCACTGATGATGCTCCACTCGTCACACTTGGTTCTCTCCAGGTGACTCAGTGC11 (0.000688%)
CAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCA10 (0.000625%)
CAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCT22 (0.001376%)
CAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATACTT10 (0.000625%)
CAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTT4 (0.000250%)
CAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGGGTGTCAGAAA5 (0.000313%)
CAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTG32 (0.002001%)
CAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTA29 (0.001813%)
CACAAAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTC9 (0.000563%)
CACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTC7 (0.000438%)
CACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACT35 (0.002189%)
CACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTA43 (0.002689%)
CACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCT66 (0.004127%)
CACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGG43 (0.002689%)
CACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAG28 (0.001751%)
CACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCAC17 (0.001063%)
CACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGA16 (0.001000%)
CACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAG61 (0.003814%)
CACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTC22 (0.001376%)
CACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCAC12 (0.000750%)
CACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTT174 (0.010880%)
CACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCT15 (0.000938%)
CACACCGTCAACACTGCCCTGGCTGCCTTCAACACACAGAATAATGGAACCTATTTTAAACTGGTGGAGATTTCCCGGGCTCAAAATGTGCCTCTCCCAG4 (0.000250%)
CACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCG15 (0.000938%)
CACACCTTGACTTTGTCGATCTGATTCAAGACCTGTTTGAATCCCTGAAGAAGATGATTATTGAGGTAGTCCACGGCCAACAAAGCTACTTGCTCTGCTT8 (0.000500%)
CACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTT17 (0.001063%)
CACACGTCTGAACTCCAGTCACCTATCCAGTGATCTCGTA18 (0.000450%)
CACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCC7 (0.000438%)
CACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACG15 (0.000938%)
CACACTGGCCTGCAATGTAGGCATGTCCTCCATCCAAAGTCATGGCGTCCGCTTCTCCGTTCACAATCTTTTCAATGCAGTCCTCAGTGGTCTCTGCTGA5 (0.000313%)
CACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTC47 (0.002939%)
CACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACA121 (0.007566%)
CACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTAC7 (0.000438%)
CACAGCCACGGCATAATACCCTTTAGGAAAGATACCTTGTTGTGATGGGATGGCACAATTAGAGCTCTCGTAGTACTCTGCCATGACAGGCACTAGACCA6 (0.000375%)
CACAGTAGCATTTGTGCCAATTTCTGGTTGGAATGGTGACAACATGCTGGAGCCAAGTGCTAATATGCCTTGGTTCAAGGGATGGAAAGTCACCCGCAAA90 (0.005628%)
CACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACT4 (0.000250%)
CACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAA35 (0.002189%)
CACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTA52 (0.003252%)
CACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATA19 (0.001188%)
CACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCA17 (0.001063%)
CACAGTTTTCGCCCTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGACGAG9 (0.000563%)
CACATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGGA8 (0.000500%)
CACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTC16 (0.001000%)
CACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTAC41 (0.002564%)
CACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGG17 (0.001063%)
CACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTC4 (0.000250%)
CACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATG11 (0.000688%)
CACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGC41 (0.002564%)
CACCACTCCGAAGGGCCGCCGAGACCACACCTTGACTTTGTCGATCTGATTCAAGACCTGTTTGAATCCCTGAAGAAGATGATTATTGAGGTAGTCCACG5 (0.000313%)
CACCACTTCACTGGCGAGTTGTCGATCGAGCCCTCCGGGCACACGCCTTCCTGCTGATTCCGAATGGCAGTGACATAGTTATGGCCAAGGTACAGCCTGT5 (0.000313%)
CACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTTGGCCTGGCTCTGAATCTCTGAGGTCTTGGCC12 (0.000750%)
CACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCC11 (0.000688%)
CACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACA12 (0.000750%)
CACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGG23 (0.001438%)
CACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGC3 (0.000188%)
CACCATGAACTTCTCCGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGG4 (0.000250%)
CACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAG10 (0.000625%)
CACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACA26 (0.001626%)
CACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAG15 (0.000938%)
CACCCCACCCCATATTAAACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCAATAAACTAGGAGGTGTCCTAGCCTTAATCTTA244 (0.015257%)
CACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACG6 (0.000375%)
CACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTG8 (0.000500%)
CACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTAT10 (0.000625%)
CACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTC13 (0.000813%)
CACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCG4 (0.000250%)
CACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACA12 (0.000750%)
CACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTT32 (0.002001%)
CACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAG29 (0.001813%)
CACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACT21 (0.001313%)
CACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAA16 (0.001000%)
CACGGCATAATACCCTTTAGGAAAGATACCTTGTTGTGATGGGATGGCACAATTAGAGCTCTCGTAGTACTCTGCCATGACAGGCACTAGACCACACTGG4 (0.000250%)
CACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGC95 (0.005940%)
CACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGT9 (0.000563%)
CACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTT23 (0.001438%)
CACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGC30 (0.001876%)
CACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCCCAAATCATTATAC3 (0.000188%)
CACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAG22 (0.001376%)
CACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCT12 (0.000750%)
CACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACA14 (0.000875%)
CACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGC5 (0.000313%)
CACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTC7 (0.000438%)
CACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAA24 (0.001501%)
CACTGATGGAGGACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAA21 (0.001313%)
CACTGGCCTGCAATGTAGGCATGTCCTCCATCCAAAGTCATGGCGTCCGCTTCTCCGTTCACAATCTTTTCAATGCAGTCCTCAGTGGTCTCTGCTGACT8 (0.000500%)
CACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACAC9 (0.000563%)
CACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGAT5 (0.000313%)
CACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTG10 (0.000625%)
CACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGT9 (0.000563%)
CACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTG4 (0.000250%)
CACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCT11 (0.000688%)
CACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCAT15 (0.000938%)
CACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGA4 (0.000250%)
CACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGT13 (0.000813%)
CACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATG7 (0.000438%)
CACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGAT8 (0.000500%)
CACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTT7 (0.000438%)
CACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGG7 (0.000438%)
CAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAG14 (0.000875%)
CAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGAC78 (0.004877%)
CAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAA70 (0.004377%)
CAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAAT130 (0.008129%)
CAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGG5 (0.000313%)
CAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCG11 (0.000688%)
CAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAG17 (0.001063%)
CAGAATCTTTAAACAGCAGGTCTTTCCCAAGAGGAGAGCTGAACAGTTGGAAGTCTTTTGATTTGCCTTTGCCAAAGTGTTCCTGTGCCACTTTGAGAAT4 (0.000250%)
CAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACC10 (0.000625%)
CAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGG193 (0.012068%)
CAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGT67 (0.004189%)
CAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGC27 (0.001688%)
CAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCC27 (0.001688%)
CAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTTGGCCTGGCTCTGAATCTCTGAGGTCTTGGCCTTC3 (0.000188%)
CAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGC54 (0.003377%)
CAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATT79 (0.004940%)
CAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCT22 (0.001376%)
CAGAGAAGCAACATGGCTTCTGCAAGGCAAATCTCATGCATAATCTTGGTGGGGAAGAAGTTTCAGTGGCCTGCAAGTTATTCCAAACACAGCCCCAGCC5 (0.000313%)
CAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAG32 (0.002001%)
CAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGA11 (0.000688%)
CAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTG64 (0.004002%)
CAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCT292 (0.018259%)
CAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTG12 (0.000750%)
CAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAA6 (0.000375%)
CAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTAT41 (0.002564%)
CAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGC57 (0.003564%)
CAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCTCG12 (0.000750%)
CAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCC22 (0.001376%)
CAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGG14 (0.000875%)
CAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGG12 (0.000750%)
CAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCA29 (0.001813%)
CAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTC37 (0.002314%)
CAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTCCA4 (0.000250%)
CAGATCCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGC11 (0.000688%)
CAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATC3496 (0.087442%)
CAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGC19 (0.001188%)
CAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTA12 (0.000750%)
CAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGC15 (0.000938%)
CAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCC5 (0.000313%)
CAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATT32 (0.002001%)
CAGCAACAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACT88 (0.005503%)
CAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGC71 (0.004440%)
CAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTT51 (0.003189%)
CAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCT22 (0.001376%)
CAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCT13 (0.000813%)
CAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAG13 (0.000813%)
CAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGC38 (0.002376%)
CAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAG76 (0.004752%)
CAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTG8 (0.000500%)
CAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGAC41 (0.002564%)
CAGCCACGGCATAATACCCTTTAGGAAAGATACCTTGTTGTGATGGGATGGCACAATTAGAGCTCTCGTAGTACTCTGCCATGACAGGCACTAGACCACA3 (0.000188%)
CAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATG11 (0.000688%)
CAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATC28 (0.001751%)
CAGCCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTAC5 (0.000313%)
CAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAA193 (0.012068%)
CAGCCCAAAGGCAGAATCTTTAAACAGCAGGTCTTTCCCAAGAGGAGAGCTGAACAGTTGGAAGTCTTTTGATTTGCCTTTGCCAAAGTGTTCCTGTGCC3 (0.000188%)
CAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGC13 (0.000813%)
CAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCA10 (0.000625%)
CAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCC16 (0.001000%)
CAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCT4 (0.000250%)
CAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAG9 (0.000563%)
CAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGC31 (0.001938%)
CAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGC58 (0.003627%)
CAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCT13 (0.000813%)
CAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCC55 (0.003439%)
CAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTTCACAGGCTTCCTGGT9 (0.000563%)
CAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAG54 (0.003377%)
CAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCC30 (0.001876%)
CAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGT10 (0.000625%)
CAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCT6 (0.000375%)
CAGCTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGGCTGTACCTTGGCCATAAC23 (0.001438%)
CAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGG8 (0.000500%)
CAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACC13 (0.000813%)
CAGCTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTG12 (0.000750%)
CAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATG25 (0.001563%)
CAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTC31 (0.001938%)
CAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCA7 (0.000438%)
CAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGC23 (0.001438%)
CAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCA28 (0.001751%)
CAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAAC17 (0.001063%)
CAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGT65 (0.004064%)
CAGGAATGTCCCCTCGGCCAGAGAACTCATTCTTGTGGTTCAGTAGCACCTCCTTGACAGCCTTGTAGCCATGCAGGACCACGATGCGCCTCTGACCCAG158 (0.009880%)
CAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGACTCTCTGC3 (0.000188%)
CAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCC8 (0.000500%)
CAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAA8 (0.000500%)
CAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTT16 (0.001000%)
CAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCC77 (0.004815%)
CAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGAT21 (0.001313%)
CAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGT21 (0.001313%)
CAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAA24 (0.001501%)
CAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTG45 (0.002814%)
CAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGG6 (0.000375%)
CAGGCTTCCAGGAGTCGTGAGGTTGAGCACTTCCTCATGTTACCGACAGATTGCATGTACTCCGCTCCTAAGTATTTTTCAGGTGTGGTACCCTCTGGAA26 (0.001626%)
CAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGG91 (0.005690%)
CAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACA165 (0.010317%)
CAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGT25 (0.001563%)
CAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCT19 (0.001188%)
CAGGTGACTCAGTGCACACCACTTCACTGGCGAGTTGTCGATCGAGCCCTCCGGGCACACGCCTTCCTGCTGATTCCGAATGGCAGTGACATAGTTATGG148 (0.009254%)
CAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGG41 (0.002564%)
CAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCT22 (0.001376%)
CAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTC28 (0.001751%)
CAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGC5 (0.000313%)
CAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATT8 (0.000500%)
CAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGC4 (0.000250%)
CAGTATCATTGGTGCCCTATGGTTTTAACGGTTAATACGGGGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGAGAGGGGAGAGCAATTATGATAA5 (0.000313%)
CAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACT6 (0.000375%)
CAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTG8 (0.000500%)
CAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACT45 (0.002814%)
CAGTCCAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCC5 (0.000313%)
CAGTCCCAATGGGACAAAGTGAAGGATTTCGCTAATGTGTATGTGGATGCGGTCAAAGACAGCGGCAGAGACTATGTGTCCCAGTTTGAATCCTCCTCCT148 (0.009254%)
CAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTC19 (0.001188%)
CAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAA9 (0.000563%)
CAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGA45 (0.002814%)
CAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAA8 (0.000500%)
CAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCA11 (0.000688%)
CAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGT20 (0.001251%)
CAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCA17 (0.001063%)
CAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAA7 (0.000438%)
CAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACT5 (0.000313%)
CAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTG3 (0.000188%)
CAGTTTTCGCCCTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTGGACGAGTC5 (0.000313%)
CATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGG16 (0.001000%)
CATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATA4 (0.000250%)
CATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGGAATGTTG3 (0.000188%)
CATACATAATGCTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGGAAT3 (0.000188%)
CATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACAC11 (0.000688%)
CATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCT9 (0.000563%)
CATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGA5 (0.000313%)
CATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGA10 (0.000625%)
CATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGC12 (0.000750%)
CATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGT11 (0.000688%)
CATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCT23 (0.001438%)
CATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTC9 (0.000563%)
CATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACA7 (0.000438%)
CATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCA7 (0.000438%)
CATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAG17 (0.001063%)
CATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGC3 (0.000188%)
CATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGC10 (0.000625%)
CATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTT3 (0.000188%)
CATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGG5 (0.000313%)
CATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCC11 (0.000688%)
CATCAGTCCAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGA12 (0.000750%)
CATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGC7 (0.000438%)
CATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAAGAAGTCCTGCCACACAGGCCTGG109 (0.006816%)
CATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGT10 (0.000625%)
CATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATG9 (0.000563%)
CATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGA8 (0.000500%)
CATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAG13 (0.000813%)
CATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAAT45 (0.002814%)
CATCGTACACCCAACCCCCATCCAAGGTCATAGCATCGGCTTCACTTGCAGAAATGGCCTTGATGCAATCCGGATAGGAGGTTTTCTTCACACAGGCAAG3 (0.000188%)
CATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAA9 (0.000563%)
CATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAA25 (0.001563%)
CATCTTCCTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGA5 (0.000313%)
CATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACA23 (0.001438%)
CATGAACTTCTCCGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAG9 (0.000563%)
CATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTG20 (0.001251%)
CATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACAT14 (0.000875%)
CATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTC4 (0.000250%)
CATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAG779 (0.048711%)
CATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTC14 (0.000875%)
CATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCT8 (0.000500%)
CATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAG4 (0.000250%)
CATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTC279 (0.017446%)
CATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATA7 (0.000438%)
CATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAA33 (0.002063%)
CATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCT11 (0.000688%)
CATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAA7 (0.000438%)
CATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAG35 (0.002189%)
CATGGCGTCCGCTTCTCCGTTCACAATCTTTTCAATGCAGTCCTCAGTGGTCTCTGCTGACTCACACTCTATCTTTCCCTCACTGATGATGCTCCACTCG3 (0.000188%)
CATGGCTTCTGCAAGGCAAATCTCATGCATAATCTTGGTGGGGAAGAAGTTTCAGTGGCCTGCAAGTTATTCCAAACACAGCCCCAGCCAGCCAATGCCA4 (0.000250%)
CATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCG6 (0.000375%)
CATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGG10 (0.000925%)
CATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTG20 (0.001251%)
CATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCCGTGTGTT23 (0.001438%)
CATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCG4 (0.000250%)
CATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTT14 (0.000875%)
CATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGAC18 (0.001126%)
CATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTG12 (0.000750%)
CATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATCACAACCA8 (0.000500%)
CATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAG18 (0.001126%)
CATTATTCTAATAAACGCCCTAACAACTATTATCTTCCTAGGACCCCTATACTATATCAATTTACCAGAACTCTACTCAACTAACTTCATAATAGAAGCT201 (0.012568%)
CATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACA17 (0.001063%)
CATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTC9 (0.000563%)
CATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAACATCGGAG3 (0.000188%)
CATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGA15 (0.000938%)
CATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGA3 (0.000188%)
CATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGAC24 (0.001501%)
CATTGGTGCCCTATGGTTTTAACGGTTAATACGGGGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGAGAGGGGAGAGCAATTATGATAAGGATTA11 (0.000688%)
CATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTAT5 (0.000313%)
CATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAA3 (0.000188%)
CATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCAC6 (0.000375%)
CCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCT15 (0.000938%)
CCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCAC21 (0.001313%)
CCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCC8 (0.000500%)
CCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAG41 (0.002564%)
CCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCA17 (0.001063%)
CCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCT20 (0.001251%)
CCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCT15 (0.000938%)
CCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTC24 (0.001501%)
CCAAAGTCATGGCGTCCGCTTCTCCGTTCACAATCTTTTCAATGCAGTCCTCAGTGGTCTCTGCTGACTCACACTCTATCTTTCCCTCACTGATGATGCT5 (0.000313%)
CCAAATGCAACCTGCTGGCAGAGAAGCAACATGGCTTCTGCAAGGCAAATCTCATGCATAATCTTGGTGGGGAAGAAGTTTCAGTGGCCTGCAAGTTATT5 (0.000313%)
CCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAA14 (0.000875%)
CCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTG8 (0.000500%)
CCAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGA7 (0.000438%)
CCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCAT7 (0.000438%)
CCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCA17 (0.001063%)
CCAACCCCCATCCAAGGTCATAGCATCGGCTTCACTTGCAGAAATGGCCTTGATGCAATCCGGATAGGAGGTTTTCTTCACACAGGCAAGCCGGGGGCCA8 (0.000500%)
CCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGG25 (0.001563%)
CCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGT14 (0.000875%)
CCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAA13 (0.000813%)
CCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCT10 (0.000625%)
CCAAGACACAGTTTTCGCCCTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACGTG21 (0.001313%)
CCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAG38 (0.002376%)
CCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGC38 (0.002376%)
CCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGAC10 (0.000625%)
CCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGA18 (0.001126%)
CCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTT19 (0.001188%)
CCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCC8 (0.000500%)
CCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTGGC17 (0.001063%)
CCAATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGC8 (0.000500%)
CCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGC4 (0.000250%)
CCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTG15 (0.000938%)
CCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGA8 (0.000500%)
CCACACCTTGACTTTGTCGATCTGATTCAAGACCTGTTTGAATCCCTGAAGAAGATGATTATTGAGGTAGTCCACGGCCAACAAAGCTACTTGCTCTGCT3 (0.000188%)
CCACACTGGCCTGCAATGTAGGCATGTCCTCCATCCAAAGTCATGGCGTCCGCTTCTCCGTTCACAATCTTTTCAATGCAGTCCTCAGTGGTCTCTGCTG4 (0.000250%)
CCACCAGCTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGA8 (0.000500%)
CCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTC7 (0.000438%)
CCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATG8 (0.000500%)
CCACCATGAACTTCTCCGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGG31 (0.001938%)
CCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGAC5 (0.000313%)
CCACCCTCCTCCTCGTATCCATCTGGAAACAGATCTATAGAAGTTGGAACCTGCCCCCAGGACCTTTCCCAATTCCTTTCTTTGGAAACATTTTTCAGCT7 (0.000438%)
CCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAG3 (0.000188%)
CCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCT10 (0.000625%)
CCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACA3 (0.000188%)
CCACGGCATAATACCCTTTAGGAAAGATACCTTGTTGTGATGGGATGGCACAATTAGAGCTCTCGTAGTACTCTGCCATGACAGGCACTAGACCACACTG5 (0.000313%)
CCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCA17 (0.001063%)
CCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACC17 (0.001063%)
CCACTCCGAAGGGCCGCCGAGACCACACCTTGACTTTGTCGATCTGATTCAAGACCTGTTTGAATCCCTGAAGAAGATGATTATTGAGGTAGTCCACGGC6 (0.000375%)
CCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAG3 (0.000188%)
CCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGT26 (0.001626%)
CCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCT13 (0.000813%)
CCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAG8 (0.000500%)
CCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCG7 (0.000438%)
CCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGA43 (0.002689%)
CCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAA12 (0.000750%)
CCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGC7 (0.000438%)
CCAGACTCTGCAGAGGACGTTCGTAAGTTGTGCCCACGGTGCCCACTCCTGACTCCGTTCAACGATACCAACGTGGTCCACACCGTCAACACTGCCCTGG8 (0.000500%)
CCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATG5 (0.000313%)
CCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCT3 (0.000188%)
CCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATG16 (0.001000%)
CCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAG8 (0.000500%)
CCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTG5 (0.000313%)
CCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCAT10 (0.000625%)
CCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTC8 (0.000500%)
CCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGC13 (0.000813%)
CCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTG6 (0.000375%)
CCAGCTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTT38 (0.002376%)
CCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATG6 (0.000375%)
CCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTG11 (0.000688%)
CCAGGCCCGAGAATGAAGAATGGCCTGAGCCTCCAGTGTTGAGTGGAGACTTCTCACCAGGACTCCACCATCATCCCTTCCTATCCATACAGCATCCCCA4 (0.000250%)
CCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCT8 (0.000500%)
CCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACAC8 (0.000500%)
CCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGC6 (0.000375%)
CCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCAC7 (0.000438%)
CCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAAC22 (0.001376%)
CCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATT55 (0.003439%)
CCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAAA3 (0.000188%)
CCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAG8 (0.000500%)
CCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAG28 (0.001751%)
CCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGC18 (0.001126%)
CCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAG4 (0.000250%)
CCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTAT11 (0.000688%)
CCATAGTCTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGG87 (0.005440%)
CCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACG7 (0.000438%)
CCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGC36 (0.002251%)
CCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTG4 (0.000250%)
CCATCAGTCCAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAG3 (0.000188%)
CCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACAC6 (0.000375%)
CCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAG22 (0.001376%)
CCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAG3 (0.000188%)
CCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAA4 (0.000250%)
CCATGAACTTCTCCGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAA3 (0.000188%)
CCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAA11 (0.000688%)
CCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGA36 (0.002251%)
CCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGC12 (0.000750%)
CCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGC14 (0.000875%)
CCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCT5 (0.000313%)
CCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAA15 (0.000938%)
CCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTAC4 (0.000250%)
CCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATC4 (0.000250%)
CCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGC11 (0.000688%)
CCCAACCCCCATCCAAGGTCATAGCATCGGCTTCACTTGCAGAAATGGCCTTGATGCAATCCGGATAGGAGGTTTTCTTCACACAGGCAAGCCGGGGGCC5 (0.000313%)
CCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTG112 (0.007003%)
CCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGA64 (0.004002%)
CCCAATGGGACAAAGTGAAGGATTTCGCTAATGTGTATGTGGATGCGGTCAAAGACAGCGGCAGAGACTATGTGTCCCAGTTTGAATCCTCCTCCTTGGG4 (0.000250%)
CCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACA8 (0.000500%)
CCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGC3 (0.000188%)
CCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGC32 (0.002001%)
CCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGA26 (0.001626%)
CCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAG8 (0.000500%)
CCCAGACTCTGCAGAGGACGTTCGTAAGTTGTGCCCACGGTGCCCACTCCTGACTCCGTTCAACGATACCAACGTGGTCCACACCGTCAACACTGCCCTG193 (0.012068%)
CCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCA414 (0.025887%)
CCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTT103 (0.006441%)
CCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATT194 (0.012131%)
CCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTG26 (0.001626%)
CCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCAT16 (0.001000%)
CCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAA9 (0.000563%)
CCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACAA3 (0.000188%)
CCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAA16 (0.001000%)
CCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAA10 (0.000625%)
CCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCA3 (0.000188%)
CCCATCCAAGGTCATAGCATCGGCTTCACTTGCAGAAATGGCCTTGATGCAATCCGGATAGGAGGTTTTCTTCACACAGGCAAGCCGGGGGCCATCAGGC5 (0.000313%)
CCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAA14 (0.000875%)
CCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAA3 (0.000188%)
CCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAG9 (0.000563%)
CCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAG14 (0.000875%)
CCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCT24 (0.001501%)
CCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTT39 (0.002439%)
CCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACACA18 (0.001126%)
CCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAA11 (0.000688%)
CCCCCATCCAAGGTCATAGCATCGGCTTCACTTGCAGAAATGGCCTTGATGCAATCCGGATAGGAGGTTTTCTTCACACAGGCAAGCCGGGGGCCATCAG9 (0.000563%)
CCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATTCTTATAGGAATTAACATTATTATTA3 (0.000188%)
CCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAA9 (0.000563%)
CCCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAG8 (0.000500%)
CCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGG12 (0.000750%)
CCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAA84 (0.005253%)
CCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGC318 (0.019884%)
CCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTA22 (0.001376%)
CCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAG39 (0.002439%)
CCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCTGCTGTAGACGTGGCTGTAAAAGTGTTCAAAA11 (0.000688%)
CCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTTCACAGGCTTCCTGGTGCCATCAGG8 (0.000500%)
CCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATC3 (0.000188%)
CCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCC4 (0.000250%)
CCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACC5 (0.000313%)
CCCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGT41 (0.002564%)
CCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGA7 (0.000438%)
CCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGC15 (0.000938%)
CCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATAT16 (0.001000%)
CCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATT7 (0.000438%)
CCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATT18 (0.001126%)
CCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAG9 (0.000563%)
CCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCC3 (0.000188%)
CCCTTCTCCACAAAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCA20 (0.001251%)
CCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGA23 (0.001438%)
CCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAG48 (0.003001%)
CCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCAC108 (0.006753%)
CCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCG39 (0.002439%)
CCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAG30 (0.001876%)
CCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCT409 (0.025575%)
CCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGA27 (0.001688%)
CCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGT8 (0.000500%)
CCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGC24 (0.001501%)
CCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCT15 (0.000938%)
CCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGAT50 (0.003126%)
CCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGT10 (0.000625%)
CCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTAC17 (0.001063%)
CCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGA94 (0.005878%)
CCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTAC21 (0.001313%)
CCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTT6 (0.000375%)
CCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACC39 (0.002439%)
CCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGC36 (0.002251%)
CCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGA48 (0.003001%)
CCGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGG28 (0.001751%)
CCGGCATCGTACACCCAACCCCCATCCAAGGTCATAGCATCGGCTTCACTTGCAGAAATGGCCTTGATGCAATCCGGATAGGAGGTTTTCTTCACACAGG237 (0.014820%)
CCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAAC44 (0.002751%)
CCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTTCACAGGCTTCCTGGTGCCATCAGGG8 (0.000500%)
CCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTAC34 (0.002126%)
CCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAA21 (0.001313%)
CCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGAC8 (0.000500%)
CCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGC11 (0.000688%)
CCGTGGCGGCGGAGTTTTATGGATCAGTGGAACATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCT16 (0.001000%)
CCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTG10 (0.000625%)
CCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTC4 (0.000250%)
CCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCC10 (0.000625%)
CCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCC6 (0.000375%)
CCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTAT8 (0.000500%)
CCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCA32 (0.002001%)
CCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTG9 (0.000563%)
CCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCA13 (0.000813%)
CCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTA3 (0.000188%)
CCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTG12 (0.000750%)
CCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCAGAACGACTCGGTTATCAACTTCTA3 (0.000188%)
CCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTT14 (0.000875%)
CCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCA33 (0.002063%)
CCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACA35 (0.002189%)
CCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTC36 (0.002251%)
CCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTG7 (0.000438%)
CCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATC5 (0.000313%)
CCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTG7 (0.000438%)
CCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGG8 (0.000500%)
CCTCCATCCAAAGTCATGGCGTCCGCTTCTCCGTTCACAATCTTTTCAATGCAGTCCTCAGTGGTCTCTGCTGACTCACACTCTATCTTTCCCTCACTGA12 (0.000750%)
CCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTG17 (0.001063%)
CCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTG4 (0.000250%)
CCTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTA6 (0.000375%)
CCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGA11 (0.000688%)
CCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGC21 (0.001313%)
CCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTC4 (0.000250%)
CCTCGCTGGACTGGTATTTGTGTCTGAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGC730 (0.045647%)
CCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAG8 (0.000500%)
CCTCGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTC7 (0.000438%)
CCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGAT108 (0.006753%)
CCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAG3 (0.000188%)
CCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACA3 (0.000188%)
CCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCT141 (0.008817%)
CCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTA15 (0.000938%)
CCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACT32 (0.002001%)
CCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCT11 (0.000688%)
CCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCA7 (0.000438%)
CCTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCT4 (0.000250%)
CCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTT17 (0.001063%)
CCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGA49 (0.003064%)
CCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCA39 (0.002439%)
CCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGAT22 (0.001376%)
CCTGCAAGAAGTTTGACCTCAGGGTCAGCATAAGACCAGCCCCTGAGACAGCCAAGAAGCCCGAGGAAGCCAAGAATACCATGTTCCTTGAAATCTGCAC3 (0.000188%)
CCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCCCAAATCATT10 (0.000625%)
CCTGCATGGGCTAGATTTCCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATG25 (0.001563%)
CCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGA16 (0.001000%)
CCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAA14 (0.000875%)
CCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGT4 (0.000250%)
CCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTG37 (0.002314%)
CCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGT4 (0.000250%)
CCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCA3 (0.000188%)
CCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTC54 (0.003377%)
CCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAG4 (0.000250%)
CCTGGAGAAAGAAACAGATTGGGTGAGACAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAA8 (0.000500%)
CCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACAT27 (0.001688%)
CCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGG7 (0.000438%)
CCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTT5 (0.000313%)
CCTGGGATGGCATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCA7 (0.000438%)
CCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAG29 (0.001813%)
CCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTT13 (0.000813%)
CCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATC12 (0.000750%)
CCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGT7 (0.000438%)
CCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTG6 (0.000375%)
CCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGA5 (0.000313%)
CCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTA35 (0.002189%)
CCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTT11 (0.000688%)
CCTTAACAGCCCAAAGGCAGAATCTTTAAACAGCAGGTCTTTCCCAAGAGGAGAGCTGAACAGTTGGAAGTCTTTTGATTTGCCTTTGCCAAAGTGTTCC13 (0.000813%)
CCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTTCACAGGCTTCCTGGTGCC10 (0.000625%)
CCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTT9 (0.000563%)
CCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCC17 (0.001063%)
CCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAG15 (0.000938%)
CCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGA60 (0.003752%)
CCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGC29 (0.001813%)
CCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCA10 (0.000625%)
CCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGC5 (0.000313%)
CCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGA9 (0.000563%)
CCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTA9 (0.000563%)
CCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCAC22 (0.001376%)
CCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGC9 (0.000563%)
CCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACT8 (0.000500%)
CCTTGGGTTCCCTTCTCCACAAAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGG21 (0.001313%)
CCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAG4 (0.000250%)
CCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAAC35 (0.002189%)
CCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGA4 (0.000250%)
CCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCA3 (0.000188%)
CCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAG7 (0.000438%)
CCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACT6 (0.000375%)
CCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAAT13 (0.000813%)
CCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGC22 (0.001376%)
CGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAA10 (0.000625%)
CGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAA8 (0.000500%)
CGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAG135 (0.008442%)
CGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGC130 (0.008129%)
CGAAGGGCCGCCGAGACCACACCTTGACTTTGTCGATCTGATTCAAGACCTGTTTGAATCCCTGAAGAAGATGATTATTGAGGTAGTCCACGGCCAACAA18 (0.001126%)
CGAATGCAGCCCTACCAGCTGACCCACCTGCATCTGTGGTGGTGGGACCTGTGGTGGTTCCACGAGGACTTTCAGACCACCGAACTTACCACGACCTACG14 (0.000875%)
CGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCA11 (0.000688%)
CGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACC46 (0.002876%)
CGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACA16 (0.001000%)
CGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTA30 (0.001876%)
CGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCT185 (0.011568%)
CGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGC18 (0.001126%)
CGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGC10 (0.000625%)
CGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGA49 (0.003064%)
CGAGACCACACCTTGACTTTGTCGATCTGATTCAAGACCTGTTTGAATCCCTGAAGAAGATGATTATTGAGGTAGTCCACGGCCAACAAAGCTACTTGCT24 (0.001501%)
CGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTT75 (0.004690%)
CGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTG16 (0.001000%)
CGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCA43 (0.002689%)
CGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGAC4 (0.000250%)
CGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAG7 (0.000438%)
CGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGAC60 (0.003752%)
CGATACCAACGTGGTCCACACCGTCAACACTGCCCTGGCTGCCTTCAACACACAGAATAATGGAACCTATTTTAAACTGGTGGAGATTTCCCGGGCTCAA5 (0.000313%)
CGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAG6 (0.000375%)
CGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACAC13 (0.000813%)
CGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTT18 (0.001126%)
CGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCT35 (0.002189%)
CGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTC16 (0.001000%)
CGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCA48 (0.003001%)
CGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGC6 (0.000375%)
CGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATG9 (0.000563%)
CGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGA5 (0.000313%)
CGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCC5 (0.000313%)
CGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAATAC16 (0.001000%)
CGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATT15 (0.000938%)
CGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGC151 (0.013974%)
CGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCGCT28 (0.001751%)
CGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAA57 (0.003564%)
CGCAGCAAGTCTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATG23 (0.001438%)
CGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTC10 (0.000625%)
CGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACT4 (0.000250%)
CGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAA22 (0.001376%)
CGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGGGGAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTT31 (0.002869%)
CGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACA49 (0.003064%)
CGCCACCCTCCTCCTCGTATCCATCTGGAAACAGATCTATAGAAGTTGGAACCTGCCCCCAGGACCTTTCCCAATTCCTTTCTTTGGAAACATTTTTCAG20 (0.001251%)
CGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTAC15 (0.000938%)
CGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCC134 (0.008379%)
CGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCA14 (0.000875%)
CGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCA20 (0.001251%)
CGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTA22 (0.001376%)
CGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCG29 (0.001813%)
CGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCT7 (0.000438%)
CGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTA6 (0.000375%)
CGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGAT287 (0.017946%)
CGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCAC32 (0.002001%)
CGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCACTCACACCGCG20 (0.001251%)
CGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACCAGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGG479 (0.029952%)
CGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGA43 (0.002689%)
CGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCCCAGCCTCTGCGCG32 (0.002001%)
CGCTAATGTGTATGTGGATGCGGTCAAAGACAGCGGCAGAGACTATGTGTCCCAGTTTGAATCCTCCTCCTTGGGCCAACAGCTGAACCTGAATCTCCTG12 (0.000750%)
CGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAG17 (0.001063%)
CGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAA18 (0.001126%)
CGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTT7 (0.000438%)
CGCTGGACTGGTATTTGTGTCTGAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCT11 (0.000688%)
CGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGG7 (0.000438%)
CGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTTGCGGTACTGCCCGAGTC15 (0.000938%)
CGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACC542 (0.033891%)
CGGAACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTA356 (0.022261%)
CGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAG67 (0.004189%)
CGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGC52 (0.003252%)
CGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCAT24 (0.001501%)
CGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAA6 (0.000375%)
CGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTC14 (0.000875%)
CGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAAT18 (0.001126%)
CGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCA4 (0.000250%)
CGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGT31 (0.001938%)
CGGAGTTTTATGGATCAGTGGAACATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGGCAA11 (0.000688%)
CGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCC13 (0.000813%)
CGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGAC280 (0.017508%)
CGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAGGGG11 (0.000688%)
CGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTC109 (0.006816%)
CGGCACTGATGGAGGACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGG49 (0.003064%)
CGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAA34 (0.002126%)
CGGCATCCCGCATCAAGCGCTTGCGCATCTTGCGCAGGTGTGTGGAGAGCCGCGCCCGTATCTCCTCTGTGCTCTGGCCCAGCATGGTGTGCACCTCGTT81 (0.005065%)
CGGCATCGTACACCCAACCCCCATCCAAGGTCATAGCATCGGCTTCACTTGCAGAAATGGCCTTGATGCAATCCGGATAGGAGGTTTTCTTCACACAGGC40 (0.002501%)
CGGCATCTTCCTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGC63 (0.003939%)
CGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAG145 (0.009067%)
CGGCCTGGGATGGCATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTG4 (0.000250%)
CGGCGGAGTTTTATGGATCAGTGGAACATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAACCAGCTCGAAGG9 (0.000563%)
CGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACT11 (0.000688%)
CGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGG244 (0.015257%)
CGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTTGATACTGTGTTATGGCTGGGGGTTTCATGTTGATAATAGTGGTAATAAAATTAATTGCACC5 (0.000313%)
CGGCTTCAAATCCGAAGTGATGTTTTGATGTGAAGTGAAATTTTAGTTGTCGTAGTAGGCAAACAATAAGGAATGTTGATCCAATAATTACATGGAGTCC11 (0.000688%)
CGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAAC31 (0.001938%)
CGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAAT41 (0.002564%)
CGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGCCTGGGGC6 (0.000375%)
CGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTG18 (0.001126%)
CGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGC91 (0.005690%)
CGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCAC5 (0.000313%)
CGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTT78 (0.004877%)
CGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAA40 (0.002501%)
CGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAG10 (0.000625%)
CGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGC17 (0.001063%)
CGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGATCAGACAAATAGTGGAGTTT3 (0.000188%)
CGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACA18 (0.001126%)
CGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAG8 (0.000500%)
CGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTC10 (0.000625%)
CGTACACCCAACCCCCATCCAAGGTCATAGCATCGGCTTCACTTGCAGAAATGGCCTTGATGCAATCCGGATAGGAGGTTTTCTTCACACAGGCAAGCCG21 (0.001313%)
CGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTT4 (0.000250%)
CGTAGCTTCAGTATCATTGGTGCCCTATGGTTTTAACGGTTAATACGGGGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGAGAGGGGAGAGCAAT7 (0.000438%)
CGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATAC4 (0.000250%)
CGTCAACACTGCCCTGGCTGCCTTCAACACACAGAATAATGGAACCTATTTTAAACTGGTGGAGATTTCCCGGGCTCAAAATGTGCCTCTCCCAGTGTCT3 (0.000188%)
CGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACT6 (0.000375%)
CGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTG7 (0.000438%)
CGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCAC8 (0.000500%)
CGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATC16 (0.001000%)
CGTGGCTGTGGTGAAGGCATCGGACACTAGCATCACCTGGAACAACCTGAAAGGCAAGAAGTCCTGCCACACTGGGGTAGACAGAACCGCTGGTTGGAAC10 (0.000625%)
CGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGATGGACC4 (0.000250%)
CGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGA32 (0.002001%)
CGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGG17 (0.001063%)
CGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGC40 (0.002501%)
CGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTG19 (0.001188%)
CGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGT5 (0.000313%)
CTAAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCT5 (0.000313%)
CTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGG15 (0.000938%)
CTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGATGACGAG13 (0.000813%)
CTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGA12 (0.000750%)
CTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCA19 (0.001188%)
CTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTG161 (0.014900%)
CTAATAAACGCCCTAACAACTATTATCTTCCTAGGACCCCTATACTATATCAATTTACCAGAACTCTACTCAACTAACTTCATAATAGAAGCTCTACTAC3 (0.000188%)
CTAATATCCACATTACTATGCCTGGAAGGCATAGTATTATCCTTATTTATTATAACTTCAGTAACTTCCCTAAACTCCAACTCCATAAGCTCCATACCAA5 (0.000313%)
CTAATCTAGCTCTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATTCTTATAGGAAT5 (0.000313%)
CTAATGTGTATGTGGATGCGGTCAAAGACAGCGGCAGAGACTATGTGTCCCAGTTTGAATCCTCCTCCTTGGGCCAACAGCTGAACCTGAATCTCCTGGA11 (0.000688%)
CTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCCCAAATCATTATACCG8 (0.000500%)
CTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGAT19 (0.001188%)
CTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCA8 (0.000500%)
CTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTC11 (0.000688%)
CTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGG27 (0.001688%)
CTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCC10 (0.000625%)
CTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAA4 (0.000250%)
CTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATT11 (0.000688%)
CTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAG5 (0.000313%)
CTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGA7 (0.000438%)
CTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGA51 (0.003189%)
CTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAA5 (0.000313%)
CTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTCCGATTAT4 (0.000250%)
CTACTGATGCTCCTGCATGGGCTAGATTTCCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAG3 (0.000188%)
CTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGAT8 (0.000500%)
CTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACC63 (0.003939%)
CTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTC143 (0.008942%)
CTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGATTAGGTGTATTAA23 (0.001438%)
CTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGG4 (0.000250%)
CTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTAT58 (0.003627%)
CTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCAC12 (0.000750%)
CTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAA18 (0.001126%)
CTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTA16 (0.001000%)
CTAGCTAATCTAGCTCTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATTCTTATAG3 (0.000188%)
CTAGCTCTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATTCTTATAGGAATTAACA11 (0.000688%)
CTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGC6 (0.000375%)
CTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGA55 (0.003439%)
CTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTTCACAG6 (0.000375%)
CTAGTCAGTGTTGGAAAGAATGGAGACGGTTGTTGATTAGGCGTTTTGAGGATGGGAATAGGATTGAAGGAAATATAATGATGGCTACAACGATTGGGAA3 (0.000188%)
CTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTG22 (0.001376%)
CTAGTGTTAGGGGTAGAAAGTTTTTTCATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGGAATGTTGATGATAG3 (0.000188%)
CTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTTGGCCTGGCTCTGAATCTCTGAGGTCTTGGCCTTCTCCA12 (0.000750%)
CTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTC27 (0.001688%)
CTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGATGACGAGACGTAATTCGTGAAGGAACCTACCAAGGC11 (0.000688%)
CTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGAC8 (0.000500%)
CTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCC21 (0.001313%)
CTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGG18 (0.001126%)
CTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGC10 (0.000625%)
CTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAGGGATGAGTTGGATAA6 (0.000375%)
CTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAG41 (0.002564%)
CTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAA22 (0.001376%)
CTATGTCCTGTCTGCCAAAACCTTACTTCCCCGAATCAAGCCTAGATTTTGAAGTGTCTGATCCTCCCTGGGCACATGGGGGACACTGGACCAGCAGCAC4 (0.000250%)
CTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTT9 (0.000563%)
CTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAA6 (0.000375%)
CTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTATCGCAG12 (0.000750%)
CTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTTG4 (0.000250%)
CTCACCTAATATCCACATTACTATGCCTGGAAGGCATAGTATTATCCTTATTTATTATAACTTCAGTAACTTCCCTAAACTCCAACTCCATAAGCTCCAT7 (0.000438%)
CTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTA48 (0.003001%)
CTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAAC24 (0.001501%)
CTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGG30 (0.001876%)
CTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTG41 (0.002564%)
CTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCT74 (0.004627%)
CTCAGCAACAGGGATACAGAGTAATCAGGGTGTCTTCTTGAATATTCATACAAGAACGTGCCCAGGAAGACATCCTTGGCCTCAGCATAGTTCTTGCACA35 (0.002189%)
CTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAG24 (0.001501%)
CTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCA168 (0.010505%)
CTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCA47 (0.002939%)
CTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACA148 (0.009254%)
CTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTC198 (0.012381%)
CTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGT69 (0.004315%)
CTCATACACCACTCCGAAGGGCCGCCGAGACCACACCTTGACTTTGTCGATCTGATTCAAGACCTGTTTGAATCCCTGAAGAAGATGATTATTGAGGTAG196 (0.012256%)
CTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCAC4 (0.000250%)
CTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCT6 (0.000375%)
CTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTT27 (0.001688%)
CTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATC56 (0.003502%)
CTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCC112 (0.007003%)
CTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACT25 (0.001563%)
CTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATG4 (0.000250%)
CTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTC19 (0.001188%)
CTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGG45 (0.002814%)
CTCCACAAAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAAC3 (0.000188%)
CTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCC18 (0.001126%)
CTCCACCAGCTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAG16 (0.001000%)
CTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCA25 (0.001563%)
CTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAA17 (0.001063%)
CTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACA4 (0.000250%)
CTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCC27 (0.001688%)
CTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGC31 (0.001938%)
CTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGC8 (0.000500%)
CTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAA71 (0.004440%)
CTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGC30 (0.001876%)
CTCCATCCAAAGTCATGGCGTCCGCTTCTCCGTTCACAATCTTTTCAATGCAGTCCTCAGTGGTCTCTGCTGACTCACACTCTATCTTTCCCTCACTGAT6 (0.000375%)
CTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTCACA5 (0.000313%)
CTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGG42 (0.002626%)
CTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACT13 (0.000813%)
CTCCGAAGGGCCGCCGAGACCACACCTTGACTTTGTCGATCTGATTCAAGACCTGTTTGAATCCCTGAAGAAGATGATTATTGAGGTAGTCCACGGCCAA8 (0.000500%)
CTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATG40 (0.002501%)
CTCCGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATCAAG13 (0.000813%)
CTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGC10 (0.000625%)
CTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAG7 (0.000438%)
CTCCTCCAGCGGGATCAAAGAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTAC11 (0.000688%)
CTCCTCCTCGTATCCATCTGGAAACAGATCTATAGAAGTTGGAACCTGCCCCCAGGACCTTTCCCAATTCCTTTCTTTGGAAACATTTTTCAGCTGGATT4 (0.000250%)
CTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGGCTGTACCTTGGCCATAACTATGT3 (0.000188%)
CTCCTGCATGGGCTAGATTTCCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGA18 (0.001126%)
CTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGC7 (0.000438%)
CTCCTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCT8 (0.000500%)
CTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGA51 (0.003189%)
CTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGAT7 (0.000438%)
CTCCTTCTCTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAG24 (0.001501%)
CTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCT19 (0.001188%)
CTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATTTGCTGGGTCTGTTCCTCCATCTTGGAGCGCACCTCCTCCATGTGCTCACGCACCTCCTCTAGGCGGTCACGGGCCTGGTTGCCCACTTCCTCCAGC88 (0.008144%)
CTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCT43 (0.002689%)
CTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTCAAT17 (0.001063%)
CTCGCTGGACTGGTATTTGTGTCTGAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCC5 (0.000313%)
CTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGC325 (0.020322%)
CTCGGAGCCGACATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGC42 (0.002626%)
CTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGG82 (0.005127%)
CTCGGCCAGAGAACTCATTCTTGTGGTTCAGTAGCACCTCCTTGACAGCCTTGTAGCCATGCAGGACCACGATGCGCCTCTGACCCAGGTGCAGTGTGAA5 (0.000313%)
CTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCT17 (0.001063%)
CTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCT8 (0.000500%)
CTCGTATCCATCTGGAAACAGATCTATAGAAGTTGGAACCTGCCCCCAGGACCTTTCCCAATTCCTTTCTTTGGAAACATTTTTCAGCTGGATTTGAAGG15 (0.000938%)
CTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAA35 (0.002189%)
CTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGT39 (0.002439%)
CTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTG7 (0.000438%)
CTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATG7 (0.000438%)
CTCTCACCTAATATCCACATTACTATGCCTGGAAGGCATAGTATTATCCTTATTTATTATAACTTCAGTAACTTCCCTAAACTCCAACTCCATAAGCTCC16 (0.001000%)
CTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTT9 (0.000563%)
CTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCG3 (0.000188%)
CTCTCCTCTTGGGAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGGCTGTACCTTGGCCATAACTAT5 (0.000313%)
CTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGC34 (0.002126%)
CTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGC33 (0.002063%)
CTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGAT32 (0.002001%)
CTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAA13 (0.000813%)
CTCTGACTACCCTCCACTTGGTCGCTTTGCTGTTCGTGACATGAGGCAGACAGTTGCTGTGGGTGTCATCAAAGCTGTGGACAAGAAGGCTGCTGGAGCT8 (0.000500%)
CTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGGTCATTGTTGACAAAG8 (0.000500%)
CTCTGAGGGATCCTGGGAGCCCTTTGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAGGAGTGTAC239 (0.014945%)
CTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAA25 (0.001563%)
CTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGG51 (0.003189%)
CTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAG88 (0.005503%)
CTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAA14 (0.000875%)
CTCTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGC6 (0.000375%)
CTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGT17 (0.001063%)
CTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCAC4 (0.000250%)
CTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTT21 (0.001313%)
CTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTG3 (0.000188%)
CTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACAC16 (0.001000%)
CTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCA28 (0.001751%)
CTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACT10 (0.000625%)
CTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATG22 (0.001376%)
CTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTG146 (0.009129%)
CTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCA24 (0.001501%)
CTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTA49 (0.003064%)
CTGAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCTGCTGTAGACGTGGCTGTAAA3 (0.000188%)
CTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCT95 (0.005940%)
CTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAA18 (0.001126%)
CTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTA51 (0.003189%)
CTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTA11 (0.000688%)
CTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAA85 (0.005315%)
CTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTT128 (0.008004%)
CTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATC26 (0.001626%)
CTGACGGCACTGATGGAGGACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGC11 (0.000688%)
CTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGA26 (0.001626%)
CTGACTTCCTTAACGATTTCCTCGTATCTCTTCTGACTGTATGGTGGCTCGGTGGAATCCATTTTGTTGACACCAACAATCAGCTGTTTCACACCCAGGG7 (0.000438%)
CTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGA85 (0.005315%)
CTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAG6 (0.000375%)
CTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCC111 (0.006941%)
CTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTC136 (0.008504%)
CTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATC6 (0.000375%)
CTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTC20 (0.001251%)
CTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGA33 (0.002063%)
CTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATA83 (0.005190%)
CTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGA48 (0.003001%)
CTGAGGGATCCTGGGAGCCCTTTGCCTCTGGGAAGACCGCGGAGTCTGGAGAGCTGCACGGGCTCACCACAGATGAGAAGTTTGTAGAAGGAGTGTACAG10 (0.000625%)
CTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTA104 (0.006503%)
CTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGAC23 (0.001438%)
CTGAGTTCCACGTGGACGAGTCCACCACGGTGAAGGTGCCCATGATGACCCTCTCGGGAATGCTTGATGTGCACCATTGCAGCACGCTGTCCAGCTGGGT92 (0.005753%)
CTGATAGCAAGTCTAGCTAATCTAGCTCTACCCCCTTCAATCAATCTAATAGGAGAATTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCA290 (0.018134%)
CTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACT88 (0.005503%)
CTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGT8 (0.000500%)
CTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACT53 (0.003314%)
CTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGA43 (0.002689%)
CTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTG44 (0.002751%)
CTGATGCTCCTGCATGGGCTAGATTTCCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAG10 (0.000625%)
CTGATGGAGGACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAG6 (0.000375%)
CTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCAC31 (0.001938%)
CTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATG20 (0.001251%)
CTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGA25 (0.001563%)
CTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGG27 (0.001688%)
CTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCG14 (0.000875%)
CTGCAAGGCAAATCTCATGCATAATCTTGGTGGGGAAGAAGTTTCAGTGGCCTGCAAGTTATTCCAAACACAGCCCCAGCCAGCCAATGCCAACGCAGTA7 (0.000438%)
CTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATG119 (0.007441%)
CTGCAATGTAGGCATGTCCTCCATCCAAAGTCATGGCGTCCGCTTCTCCGTTCACAATCTTTTCAATGCAGTCCTCAGTGGTCTCTGCTGACTCACACTC11 (0.000688%)
CTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACT17 (0.001063%)
CTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGT16 (0.001000%)
CTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTG13 (0.000813%)
CTGCAGAGGACGTTCGTAAGTTGTGCCCACGGTGCCCACTCCTGACTCCGTTCAACGATACCAACGTGGTCCACACCGTCAACACTGCCCTGGCTGCCTT4 (0.000250%)
CTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCC17 (0.001063%)
CTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACACACGTAGACTCTC4 (0.000250%)
CTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTG8 (0.000500%)
CTGCAGTTTGCTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCC47 (0.002939%)
CTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCC22 (0.001376%)
CTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAA9 (0.000563%)
CTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAA9 (0.000563%)
CTGCCATCATGAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCA46 (0.002876%)
CTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGC34 (0.002126%)
CTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAG28 (0.001751%)
CTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATC13 (0.000813%)
CTGCCCCATCCAACATTTCATCATGATGAAACTTTGGGTCCCTTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCCATACACTA387 (0.024199%)
CTGCCCTGGCTGCCTTCAACACACAGAATAATGGAACCTATTTTAAACTGGTGGAGATTTCCCGGGCTCAAAATGTGCCTCTCCCAGTGTCTACTCTGGT5 (0.000313%)
CTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTG33 (0.002063%)
CTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGA20 (0.001251%)
CTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATT44 (0.002751%)
CTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTTCACAGGCTTCCTGGTGCCATCAGGGCAGAG8 (0.000500%)
CTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTG64 (0.004002%)
CTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAG43 (0.002689%)
CTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTG3 (0.000188%)
CTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGAT45 (0.002814%)
CTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATGTTGGAAGTGTTGGACTGATGG17 (0.001063%)
CTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTC9 (0.000563%)
CTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGG10 (0.000625%)
CTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTCACTC8 (0.000500%)
CTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCA38 (0.002376%)
CTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTA9 (0.000563%)
CTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCC3 (0.000188%)
CTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATG21 (0.001313%)
CTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCAC9 (0.000563%)
CTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCC20 (0.001251%)
CTGCTTCTCCTTCTCTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCA12 (0.000750%)
CTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAA17 (0.001063%)
CTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCG40 (0.002501%)
CTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGT97 (0.006065%)
CTGGACCAAGACACAGTTTTCGCCCTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCC19 (0.001188%)
CTGGACTCCAGCCGTGATGGATGGCATAGCTGGCCCATTGCTCATCACTGGCCTCAGGGTCCTTCAACAGTAGATGCTGCCTTTTCCTGGGATGATAAAG9 (0.000563%)
CTGGACTGGTATTTGTGTCTGAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCTGC7 (0.000438%)
CTGGAGAAAGAAACAGATTGGGTGAGACAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAAT4 (0.000250%)
CTGGAGATAGTCGCCTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTT22 (0.001376%)
CTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCAC43 (0.002689%)
CTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATC8 (0.000500%)
CTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTG19 (0.001188%)
CTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTAGCCTAAACACATC24 (0.001501%)
CTGGCAACTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGC664 (0.041520%)
CTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGG60 (0.003752%)
CTGGCCAATCACAATTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGAT290 (0.018134%)
CTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCTGCTGTAGACGTGGCTGTAAAAGTGTT18 (0.001126%)
CTGGCCTGCAATGTAGGCATGTCCTCCATCCAAAGTCATGGCGTCCGCTTCTCCGTTCACAATCTTTTCAATGCAGTCCTCAGTGGTCTCTGCTGACTCA12 (0.000750%)
CTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTC43 (0.002689%)
CTGGCGAGTTGTCGATCGAGCCCTCCGGGCACACGCCTTCCTGCTGATTCCGAATGGCAGTGACATAGTTATGGCCAAGGTACAGCCTGTAGTCCATCCT3 (0.000188%)
CTGGCTAGTCAGTACAGCCTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTTC7 (0.000438%)
CTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCT44 (0.002751%)
CTGGCTCCCACTACTGGCGTCTGGACTCCAGCCGTGATGGATGGCATAGCTGGCCCATTGCTCATCACTGGCCTCAGGGTCCTTCAACAGTAGATGCTGC4 (0.000250%)
CTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGG24 (0.001501%)
CTGGGATGGCATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGGAAGTTCTATTGGCAG10 (0.000625%)
CTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGT31 (0.001938%)
CTGGGCCAGAGCACAGAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCC35 (0.002189%)
CTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGAC72 (0.004502%)
CTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCACAC3 (0.000188%)
CTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACCTTGCTCCACCAGAGGCCCCAGGCGCTCACGGATGGCA14 (0.000875%)
CTGGGGCTGTGTTTGGAATAACTTGCAGGCCACTGAAACTTCTTCCCCACCAAGATTATGCATGAGATTTGCCTTGCAGAAGCCATGTTGCTTCTCTGCC193 (0.012068%)
CTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTT83 (0.005190%)
CTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTG35 (0.002189%)
CTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCAACCGAC7 (0.000438%)
CTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACA40 (0.002501%)
CTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGATCGTTCTGAAACTCGAGGAGACGCTCCGCGCCC113 (0.007066%)
CTGGTATTTGTGTCTGAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCTGCTGTAG6 (0.000375%)
CTGGTCCATCAGTCCAACACTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACA20 (0.001251%)
CTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGGTTTA99 (0.006190%)
CTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGT20 (0.001251%)
CTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGG10 (0.000625%)
CTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCT49 (0.003064%)
CTGGTTTTCACACATGTACTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTT72 (0.004502%)
CTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATG5 (0.000313%)
CTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTC40 (0.002501%)
CTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGC29 (0.001813%)
CTGTATCTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGG386 (0.024137%)
CTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCTGCAAAGTCAGCATTGG29 (0.001813%)
CTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATG11 (0.000688%)
CTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGC9 (0.000563%)
CTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGC24 (0.001501%)
CTGTCTGCCAAAACCTTACTTCCCCGAATCAAGCCTAGATTTTGAAGTGTCTGATCCTCCCTGGGCACATGGGGGACACTGGACCAGCAGCACCAGGCTG4 (0.000250%)
CTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAG13 (0.000813%)
CTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAA17 (0.001063%)
CTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTG17 (0.001063%)
CTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAA4 (0.000250%)
CTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGG6 (0.000375%)
CTGTGGTGAAGGCATCGGACACTAGCATCACCTGGAACAACCTGAAAGGCAAGAAGTCCTGCCACACTGGGGTAGACAGAACCGCTGGTTGGAACATCCC5 (0.000313%)
CTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAATGTTGTTCTCC7 (0.000438%)
CTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTAT6 (0.000375%)
CTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGT4 (0.000250%)
CTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAG8 (0.000500%)
CTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTC11 (0.000688%)
CTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGA3 (0.000188%)
CTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTGGTGCT10 (0.000625%)
CTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGC62 (0.003877%)
CTTAACAGCCCAAAGGCAGAATCTTTAAACAGCAGGTCTTTCCCAAGAGGAGAGCTGAACAGTTGGAAGTCTTTTGATTTGCCTTTGCCAAAGTGTTCCT10 (0.000625%)
CTTAACCCGGGCTGCCTTCTCTTTTCGTGAGACCACAACATGGTTTGGAGCTTGGGCCAGGTGGCAGCTGGCAAAATCTTTCACAGGCTTCCTGGTGCCA24 (0.001501%)
CTTAATCTGCTTCTCCTTCTCTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTC34 (0.002126%)
CTTAATGTAGGTGCTGACTTCCTTAACGATTTCCTCGTATCTCTTCTGACTGTATGGTGGCTCGGTGGAATCCATTTTGTTGACACCAACAATCAGCTGT98 (0.006128%)
CTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGC4 (0.000250%)
CTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAA6 (0.000375%)
CTTACTTTACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCC369 (0.023074%)
CTTAGATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAATTATTA20 (0.001251%)
CTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCG35 (0.002189%)
CTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTT22 (0.001376%)
CTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAACTATGCTGAGGCCA14 (0.000875%)
CTTATATTTCGCTCTCACCTAATATCCACATTACTATGCCTGGAAGGCATAGTATTATCCTTATTTATTATAACTTCAGTAACTTCCCTAAACTCCAACT19 (0.001188%)
CTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTG132 (0.008254%)
CTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATC10 (0.000625%)
CTTATTTCAACTAAAAGTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGA524 (0.032766%)
CTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCA121 (0.011198%)
CTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATAT39 (0.002439%)
CTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGT64 (0.004002%)
CTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAA119 (0.007441%)
CTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGA195 (0.012193%)
CTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCT113 (0.007066%)
CTTCACTGGCGAGTTGTCGATCGAGCCCTCCGGGCACACGCCTTCCTGCTGATTCCGAATGGCAGTGACATAGTTATGGCCAAGGTACAGCCTGTAGTCC3 (0.000188%)
CTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCG13 (0.000813%)
CTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGG35 (0.002189%)
CTTCAGTATCATTGGTGCCCTATGGTTTTAACGGTTAATACGGGGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGAGAGGGGAGAGCAATTATGA23 (0.001438%)
CTTCATGCAAATAGTGTCCCATAAAGGTGGTTGGGTTTTCCTTAAAGGAGGTGCACATGGCCTCAGCCTCTGGCCTTTCAAATGGTGGCAGGCTGGGGTT52 (0.003252%)
CTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAG23 (0.001438%)
CTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGG78 (0.004877%)
CTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCAC22 (0.001376%)
CTTCCAACATCTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCT10 (0.000625%)
CTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACAC81 (0.005065%)
CTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCG24 (0.001501%)
CTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGG8 (0.000500%)
CTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTT5 (0.000313%)
CTTCCAGGAGTCGTGAGGTTGAGCACTTCCTCATGTTACCGACAGATTGCATGTACTCCGCTCCTAAGTATTTTTCAGGTGTGGTACCCTCTGGAAGTTT4 (0.000250%)
CTTCCTCCAGCCGCCCTCGGATGCGGTCACCAAAAGCCTGGGCGCGATCGCGCAGAGGCTGGGCGGCCCCAGCGCCTAGGTTGGCAGTGCGCTGGCGACC16 (0.001000%)
CTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATG11 (0.000688%)
CTTCCTGAGCTGCTAACACGGTTTATAGAGCAAGAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTC10 (0.000625%)
CTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAA25 (0.001563%)
CTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTCAACAGTGG50 (0.003126%)
CTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGAT12 (0.000750%)
CTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCT51 (0.003189%)
CTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAA24 (0.001501%)
CTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCAATGATGAC3 (0.000188%)
CTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTGGGGCTCCGAT3 (0.000188%)
CTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCC10 (0.000625%)
CTTCTCCACAAAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGA13 (0.000813%)
CTTCTCCACCAGCTTCAGGTCATTGTTGACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGG21 (0.001313%)
CTTCTCCATCAGGTTTGCCCACTGGCGATGCATGTCTTCCACTATTGGCTCGAACCAGCCCTTGAGGCGGGCCTGGAAGATCTCCGCCTGCAGGCGTATT35 (0.002189%)
CTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAACCTC37 (0.002314%)
CTTCTCCGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGACATC3 (0.000188%)
CTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAG12 (0.000750%)
CTTCTCCTTCTCTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAG20 (0.001251%)
CTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTG5 (0.000313%)
CTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTCATGT3 (0.000188%)
CTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAG161 (0.010067%)
CTTCTCTGGAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCAT11 (0.000688%)
CTTCTGCAAGGCAAATCTCATGCATAATCTTGGTGGGGAAGAAGTTTCAGTGGCCTGCAAGTTATTCCAAACACAGCCCCAGCCAGCCAATGCCAACGCA5 (0.000313%)
CTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCA82 (0.005127%)
CTTCTTCTCCCCAGTGAGCATTGCCACAGCCTTTGCTATGCTCTCCCTAGGGAGCAAGGGTGACACTCACACGCAGATCCTAGAGGGCCTGCAGTTCAAC9 (0.000563%)
CTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGT51 (0.003189%)
CTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACT9 (0.000563%)
CTTGACTTTGTCGATCTGATTCAAGACCTGTTTGAATCCCTGAAGAAGATGATTATTGAGGTAGTCCACGGCCAACAAAGCTACTTGCTCTGCTTCTGGA5 (0.000313%)
CTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCATTCATTACCCCAACAATAATAGGATTCCCAATCGTTGTAGCCATCATTATATTTCCTTCAATC4 (0.000250%)
CTTGATAGTCAGGTTAGTGGTAGTAGCATTAGTGAGGGAAGAATAATTTTTAGCATTGTAGTAGGTTGAGATTTTGGACGTAATCTGTTCCGTACGTGTT3 (0.000188%)
CTTGATGCGGGATGCCGAGGATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCATCCGTGAGCGC14 (0.000875%)
CTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGG49 (0.003064%)
CTTGATTTAGTCGGCCTGGGATGGCATCAGTTTTAAGTCCTAGGGAGGGGACTGCTCATGAGTGGAGGACGTCTTCAGATGAAATTAATATACGGATTGG37 (0.002314%)
CTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGCTCAGCAAGAGCC48 (0.003001%)
CTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTG9 (0.000563%)
CTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTAAGACAGTGGGCTTTCTTC33 (0.002063%)
CTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGG34 (0.002126%)
CTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAG18 (0.001126%)
CTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCA9 (0.000563%)
CTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTG372 (0.023261%)
CTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGT17 (0.001063%)
CTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAG15 (0.000938%)
CTTGGCAAGTTCCGCCCTGTCATCTGCGCATTCCAGCAGGTCACCATGGCAGCACTCCTTGTTGACTTTGGTCAGGTCTGTTGCCAATTTGGTGATTTCT16 (0.001000%)
CTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACCTCACTA51 (0.003189%)
CTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGGTCATTG28 (0.001751%)
CTTGGGTTCCCTTCTCCACAAAATCATTAATCACTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGC42 (0.002626%)
CTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCT24 (0.001501%)
CTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCA36 (0.002251%)
CTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGG59 (0.003689%)
CTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCC18 (0.001126%)
CTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAA39 (0.002439%)
CTTGTCAGCAGCCTTGCAACATGTATCCAGGAACTGTGCAAAGTCATCCATGACAGTCTTCAGTTGCTCCGCTGTAGCCTTGGGCTTGTGCTTCACCAGC35 (0.002189%)
CTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGGCAACT47 (0.002939%)
CTTGTGGATGTCAGCCTCCGATGTTTGTGTGAGGTTGAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCA49 (0.003064%)
CTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATC106 (0.006628%)
CTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACA50 (0.003126%)
CTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGG20 (0.001251%)
CTTTAAACAGCAGGTCTTTCCCAAGAGGAGAGCTGAACAGTTGGAAGTCTTTTGATTTGCCTTTGCCAAAGTGTTCCTGTGCCACTTTGAGAATCTCCCA4 (0.000250%)
CTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTC35 (0.002189%)
CTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAG48 (0.003001%)
CTTTACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCT15 (0.000938%)
CTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTG42 (0.002626%)
CTTTCAAATGGTGGCAGGCTGGGGTTGTCATCTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCAT36 (0.002251%)
CTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATTGCAGACAGATAGT57 (0.003564%)
CTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTAAAGAAGTTCTGGGGCATAGAAATAAGGATGTCTTCTGG55 (0.003439%)
CTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGG102 (0.006378%)
CTTTCTCCTCCTCCTCTTCGTCTCCGGCTCTGCTTTTTCCAGGGGTGTGTTTCGCCGAGAAGCACACAAGAGTGAGATCGCCCATCGGTATAATGATTTGGGAGAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTAT543 (0.050251%)
CTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCAGCATAGTA50 (0.003126%)
CTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTC43 (0.002689%)
CTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTG34 (0.002126%)
CTTTCTTGGCCTCCTCTGACTCTGCAAAGTTGACAGAGAAGACTTCTGCCTGATAATGGTTCTTGGCCTCTTCCAGAAACTTCTCCACCAGCTTCAGGTC69 (0.004315%)
CTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGT30 (0.001876%)
CTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCATTTCTGGAGATACTGGGAAAAGGCAATCAGGACTAGGCCTTTGAAA8 (0.000500%)
CTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACTAGATGCAAAGACGCCTTA30 (0.001876%)
CTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTT23 (0.001438%)
CTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGG54 (0.003377%)
CTTTGTGTTGCAGGAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAA59 (0.003689%)
CTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAA14 (0.000875%)
CTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCG106 (0.006628%)
CTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATA14 (0.000875%)
CTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCC17 (0.001063%)
CTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTT32 (0.002001%)
CTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAG44 (0.002751%)
GAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGC71 (0.004440%)
GAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCC395 (0.036555%)
GAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCAT61 (0.003814%)
GAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTG127 (0.007941%)
GAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCA134 (0.008379%)
GAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTG16 (0.001000%)
GAAACAGATTGGGTGAGACAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGG8 (0.000500%)
GAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGG72 (0.004502%)
GAAACATTCGTTTCTTTCGGGCTCTTGTTTTGTACAGCAGTCAGCCAGTTCACCATAGTTTTCACGGAGGTTTGGAATGGCACACAACTTATCTCCAAAA85 (0.005315%)
GAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTG8 (0.000500%)
GAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCC9 (0.000563%)
GAAAGAAACAGATTGGGTGAGACAGGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAA8 (0.000500%)
GAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAA6 (0.000375%)
GAAAGAATGGAGACGGTTGTTGATTAGGCGTTTTGAGGATGGGAATAGGATTGAAGGAAATATAATGATGGCTACAACGATTGGGAATCCTATTATTGTT6 (0.000375%)
GAAAGACCTGCTGTTTAAAGATTCTGCCTTTGGGCTGTTAAGGGTCCCCCCAAGGATGGACTACAGGCTGTACCTTGGCCATAACTATGTCACTGCCATT6 (0.000375%)
GAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTG3 (0.000188%)
GAAAGCACCTCAGGTGTCAACCCCAACTCTCGTGGAGGCTGCAAGAAACCTAGGAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTG23 (0.001438%)
GAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGC13 (0.000813%)
GAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAGAAC23 (0.001438%)
GAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAG60 (0.003752%)
GAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATGAAGTTGCCAGAAGACATCCTTATT32 (0.002001%)
GAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACAC34 (0.002126%)
GAAAGTTGTGTTTAGGTTGCGGTCTGTTAGTAGTATAGTAATGCCTGCGGCTAGCACTGGTAGTGATAATAGGAGCAGTACGGCTGTAATAAGTACGGAT15 (0.000938%)
GAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCT56 (0.003502%)
GAAATCACCAAATTGGCAACAGACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGT26 (0.001626%)
GAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCAC11 (0.000688%)
GAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCC26 (0.001626%)
GAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTAGCCTGAGAAGGTTGTGG60 (0.003752%)
GAACAACATTTCAAAGGCCTAGTCCTGATTGCCTTTTCCCAGTATCTCCAGAAATGCTCATACGATGAGCATGCCAAATTAGTGCAGGAAGTAACAGACT21 (0.001313%)
GAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTG4 (0.000250%)
GAACACTGTTTTGGTACAAATGGGATGCTACTGCTTTGGCAAGATCCTGGTCCTCCTGGGCTGAGTCTCTCAATTCTGGGGGTTGCTGACGACAGCCGTG10 (0.000625%)
GAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGACATGGAGGATCTACGCA14 (0.000875%)
GAACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGG43 (0.002689%)
GAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCT54 (0.003377%)
GAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAA15 (0.000938%)
GAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCT26 (0.001626%)
GAACTGACGGCACTGATGGAGGACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCA5 (0.000313%)
GAACTGCAGGCCCTCTAGGATCTGCGTGTGAGTGTCACCCTTGCTCCCTAGGGAGAGCATAGCAAAGGCTGTGGCAATGCTCACTGGGGAGAAGAAGATG15 (0.000938%)
GAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAG27 (0.001688%)
GAACTTCTCCGGCAAGTACCAATTGCAGAGCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGAC22 (0.001376%)
GAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACTGTCTTAGTG38 (0.002376%)
GAAGAAAGCCCACTGTCTTAGTGAGGTGGAGCATGACACCATGCCTGCTGATCTGCCTGCCATTGCTGCTGATTTTGTTGAGGACCAGGAAGTGTGCAAG13 (0.000813%)
GAAGAAGTTCACCAGACTAGTTCCTGCTGACCTGACAAGGGGTGTCAGCTGCTCGTGTGTCTTCTCAAAGTATGCCTTGGCCTGGCTCTGAATCTCTGAG4 (0.000250%)
GAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATG39 (0.002439%)
GAAGACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCC8 (0.000500%)
GAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGGAAAGGCGGCCATGCTTCTCTGCTCTGACAGTTGATGAAACATATGTC84 (0.005253%)
GAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCATGAGAAGACCCCAGTGAGTGAGCATGTTACCAAGTGCTGTAGTGGATCCCTGGTGG19 (0.001188%)
GAAGACTGGGCCTGGCACATCTCACTTAGCCGCAGGAGCCGGTTTCTCCTCAAGGTTCATTAAACTGCTGAAGAAGTTCACCAGACTAGTTCCTGCTGAC39 (0.002439%)
GAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACCTGCTTCTCGACTGAGGGTCCAAACCTTGTCACT25 (0.001563%)
GAAGAGCACACGTCTGAACTCCAGTCACCTATCCAGTGAT15 (0.000375%)
GAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAGTTCGCTACACCCAGAAAG25 (0.001563%)
GAAGAGTGGGCACCAAGTGTTGTACACTTCCTGAAGATCAGAGACTGCCTTGTGTGGAAGACTATCTGTCTGCAATCCTGAACCGTGTGTGTCTGCTGCA9 (0.000563%)
GAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGC12 (0.000750%)
GAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGTAAGCAT3 (0.000188%)
GAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAGTTCCTGGATACATGTTGCAAGGCTGCTGACAAGGACACC33 (0.002063%)
GAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTTGCACAG7 (0.000438%)
GAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATGAGAACAGCTGTTAGTGAAATAAATGATCCTA14 (0.000875%)
GAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTCTCATGCAGCAGACACACACGGTTCAGGATT35 (0.002189%)
GAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACG18 (0.001126%)
GAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTACGGCACAGTGCTTGCTGAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACT15 (0.000938%)
GAAGCCCGTGGCGGCGGAGTTTTATGGATCAGTGGAACATCCACAGACCTACTACTACGCTGTGGCTGTGGTAAAGAAGGGAACAGACTTCCAGCTGAAC273 (0.017071%)
GAAGCTGCTCGCAATGGTCGCACTGCTGGTCACCATCTGTAGCCTGGAAGGAGCTTTGGTTAAGAGACAGGCAGACGGACCGGATATGCAGAGCCTGTTC10 (0.000625%)
GAAGCTGGCCCCGCGGGTGCTGGAGAATCCAAATGTCCTCTGATGGTCAAAGTCCTGGATGCTGTCCGAGGCAGCCCTGCTGTAGACGTGGCTGTAAAAG5 (0.000313%)
GAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCA27 (0.001688%)
GAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGT20 (0.001251%)
GAAGGAGAAGCAGATTAAGAAACAAACGGCTCTTGCTGAGCTGGTGAAGCACAAGCCCAAGGCTACAGCGGAGCAACTGAAGACTGTCATGGATGACTTT4 (0.000250%)
GAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGGTGACAGATCAGCTCGAGTGGCAAAGCAACCAA8 (0.000500%)
GAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTCCTGCACTAATTTGGCATGCTCATCGTATGAGCA8 (0.000500%)
GAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTG38 (0.002376%)
GAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAG5 (0.000313%)
GAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAG19 (0.001188%)
GAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGAC9 (0.000563%)
GAAGGTTGTGGTTGTGATGTGTTTAGGCTAAGGCGTCTTTGCATCTAGTGACAAGGTTTGGACCCTCAGTCGAGAAGCAGGTGTCCTTGTCAGCAGCCTT9 (0.000563%)
GAAGTAACAGACTTTGCAAAGACGTGTGTTGCCGATGAGTCTGCCGCCAACTGTGACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTC15 (0.000938%)
GAAGTCAAATGTTTAAAGAAATTTGTGTTCCTTAGGGTGTTGATTTTACACCAACAGAAAAGATGAGTCCTGAGTCTTCATGTCTTTTTTTCTCAGGGTA9 (0.000563%)
GAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATC29 (0.001813%)
GAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTGGGGTTGACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAG12 (0.000750%)
GAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGC14 (0.000875%)
GAAGTGTGCAGATATCAGAGTGGAAGGTGAAGGTCTCAGCTTTAAACTCTTTGGGGACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCT7 (0.000438%)
GAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGAAATCACCAAATTGGCAACAGAC8 (0.000500%)
GAATACGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATT24 (0.001501%)
GAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGC3 (0.000188%)
GAATATTCAAGAAGACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATC31 (0.001938%)
GAATCAGTGAACAAATCCTGCTATGATAGCAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATG18 (0.001126%)
GAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTTAAAGCATGGGCAGTAGCTCGTCTGAGCCAGACATTCCCCAATGCTGACTTTGCAGA31 (0.001938%)
GAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGA7 (0.000438%)
GAATGGCACACAACTTATCTCCAAAAAGAGTGTGAAGGGATTTGTCACAGTTGGCGGCAGACTCATCGGCAACACACGTCTTTGCAAAGTCTGTTACTTC5 (0.000313%)
GAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGC7 (0.000438%)
GAATGTCTGGCTCAGACGAGCTACTGCCCATGCTTTAAAAGCTCTCTCTCCAAACTTCTGCATACTGGAGCACTTCATTCTCTGACGGACAGATGAGACC7 (0.000438%)
GAATGTTTCCTGCAACACAAAGATGACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCA15 (0.000938%)
GAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGC5 (0.000313%)
GAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAA3 (0.000188%)
GAATTCCAGAAGAAATGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGCGCCAGAAGCTGCAGG5 (0.000313%)
GAATTTCAGCCTCTTGTAGAAGAGCCTAAGAACTTGGTCAAAACCAACTGTGATCTTTACGAGAAGCTTGGAGAATATGGATTCCAAAATGCCATTCTAG20 (0.001251%)
GACAAAGAGGCCATTGCCTGTGCTCAGCTGCAGCTCACTGTCTGGTCTGTTGAGGGTTTGGAGGAGGTGTTGGAAGGACTTGTGGATGTCAGCCTCCGAT5 (0.000313%)
GACAAAGTGAAGGATTTCGCTAATGTGTATGTGGATGCGGTCAAAGACAGCGGCAGAGACTATGTGTCCCAGTTTGAATCCTCCTCCTTGGGCCAACAGC13 (0.000813%)
GACAAATCCCTTCACACTCTTTTTGGAGATAAGTTGTGTGCCATTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGC33 (0.002063%)
GACAACCCCAGCCTGCCACCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACACTATTTGCATG93 (0.005815%)
GACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGT22 (0.001376%)
GACACACACGGTTCAGGATTGCAGACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTT13 (0.000813%)
GACACCCTGATTACTCTGTATCCCTGTTGCTGAGACTTGCTAAGAAATATGAAGCCACTCTGGAAAAGTGCTGCGCTGAAGCCAATCCTCCCGCATGCTA11 (0.000688%)
GACACCTGAGGTGCTTTCTGGGTGTAGCGAACTAGAATGGCATTTTGGAATCCATATTCTCCAAGCTTCTCGTAAAGATCACAGTTGGTTTTGACCAAGT20 (0.001251%)
GACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTCCAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGG7 (0.000438%)
GACAGATAGTCTTCCACACAAGGCAGTCTCTGATCTTCAGGAAGTGTACAACACTTGGTGCCCACTCTTCCTAGGTTTCTTGCAGCCTCCACGAGAGTTG10 (0.000625%)
GACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCTGCGCTGGGTGCAGACGCTGTCTGACCAGGTC5 (0.000313%)
GACAGATGAGACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTG14 (0.000875%)
GACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAACCACTGTTGAAGAAAGCCCACT5 (0.000313%)
GACAGTTGATGAAACATATGTCCCCAAAGAGTTTAAAGCTGAGACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAG6 (0.000375%)
GACATATGTTTCATCAACTGTCAGAGCAGAGAAGCATGGCCGCCTTTCCACCAGGGATCCACTACAGCACTTGGTAACATGCTCACTCACTGGGGTCTTC13 (0.000813%)
GACATCCTTATTTCTATGCCCCAGAACTTCTTTACTATGCTGAGCAGTACAATGAGATTCTGACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCT748 (0.046772%)
GACATCCTTGGCCTCAGCATAGTTCTTGCACACTTCCTGGTCCTCAACAAAATCAGCAGCAATGGCAGGCAGATCAGCAGGCATGGTGTCATGCTCCACC12 (0.000750%)
GACCAAGACACAGTTTTCGCCCTGGCAAATTACATTCTCTTTAAAGGCAAATGGAAGAAGCCATTCGATCCTGAGAACACTGAGGAAGCTGAGTTCCACG4 (0.000250%)
GACCAAGTTCTTAGGCTCTTCTACAAGAGGCTGAAATTCAGCAAGCACTGTGCCGTAGCATGCGGGAGGATTGGCTTCAGCGCAGCACTTTTCCAGAGTG5 (0.000313%)
GACCAATGCTTTCTCCTTCACACCATCAAGCTTCGGGGTCAGGCAGCTTTCCTTGTCAGCCTCTGCACAACACTGGGTCAGAATCTCATTGTACTGCTCA12 (0.000750%)
GACCAGGAAGTGTGCAAGAACTATGCTGAGGCCAAGGATGTCTTCCTGGGCACGTTCTTGTATGAATATTCAAGAAGACACCCTGATTACTCTGTATCCC3 (0.000188%)
GACCCAGTGTTGTGCAGAGGCTGACAAGGAAAGCTGCCTGACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATG7 (0.000438%)
GACCCCGAAGCTTGATGGTGTGAAGGAGAAAGCATTGGTCTCATCTGTCCGTCAGAGAATGAAGTGCTCCAGTATGCAGAAGTTTGGAGAGAGAGCTTTT13 (0.000813%)
GACCTGACCAAAGTCAACAAGGAGTGCTGCCATGGTGACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGA11 (0.000688%)
GACCTGCTGGAATGCGCAGATGACAGGGCGGAACTTGCCAAGTACATGTGTGAAAACCAGGCGACTATCTCCAGCAAACTGCAGACTTGCTGCGATAAAC4 (0.000250%)
GACCTTCACCTTCCACTCTGATATCTGCACACTTCCAGAGAAGGAGAAGCAGATTAAGAAACAAACGG