fastp report
General
fastp version:0.23.1 (https://github.com/OpenGene/fastp)
sequencing:paired end (150 cycles + 150 cycles)
mean length before filtering:150bp, 150bp
mean length after filtering:143bp, 143bp
duplication rate:19.400852%
Insert size peak:262
Before filtering
total reads:48.001366 M
total bases:7.200205 G
Q20 bases:6.985688 G (97.020685%)
Q30 bases:6.661033 G (92.511719%)
GC content:51.037802%
After filtering
total reads:47.553720 M
total bases:6.826500 G
Q20 bases:6.664993 G (97.634115%)
Q30 bases:6.369382 G (93.303776%)
GC content:50.887333%
Filtering result
reads passed filters:47.553720 M (99.067431%)
reads with low quality:403.432000 K (0.840459%)
reads with too many N:13.058000 K (0.027203%)
reads too short:31.156000 K (0.064906%)
Adapter or bad ligation of read1
The input has little adapter percentage (~0.763251%), probably it's trimmed before.
SequenceOccurrences
A20408
AG20729
AGA21807
AGAT19990
AGATC19466
AGATCG21107
AGATCGG19293
AGATCGGA17872
AGATCGGAA17999
AGATCGGAAG17701
AGATCGGAAGA16803
AGATCGGAAGAG17463
AGATCGGAAGAGC17231
AGATCGGAAGAGCA17382
AGATCGGAAGAGCAC19297
AGATCGGAAGAGCACA18408
AGATCGGAAGAGCACAC16675
AGATCGGAAGAGCACACG15443
AGATCGGAAGAGCACACGT14201
AGATCGGAAGAGCACACGTC14053
AGATCGGAAGAGCACACGTCT14703
AGATCGGAAGAGCACACGTCTG15318
AGATCGGAAGAGCACACGTCTGA15019
AGATCGGAAGAGCACACGTCTGAA14620
AGATCGGAAGAGCACACGTCTGAAC14651
AGATCGGAAGAGCACACGTCTGAACT13992
AGATCGGAAGAGCACACGTCTGAACTC13711
AGATCGGAAGAGCACACGTCTGAACTCC13494
AGATCGGAAGAGCACACGTCTGAACTCCA11934
AGATCGGAAGAGCACACGTCTGAACTCCAG12043
AGATCGGAAGAGCACACGTCTGAACTCCAGT11634
AGATCGGAAGAGCACACGTCTGAACTCCAGTC11868
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA13163
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC12103
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACC11068
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCT12998
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTG11418
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGA11503
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAA13725
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAC11199
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAACGTT11623
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAACGTTGA20135
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAACGTTGAT9632
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAACGTTGATCTCGTATGCCG9481
other adapter sequences259210
Adapter or bad ligation of read2
The input has little adapter percentage (~0.781209%), probably it's trimmed before.
SequenceOccurrences
A22082
AG21269
AGA21563
AGAT19700
AGATC20697
AGATCG25649
AGATCGG18949
AGATCGGA18059
AGATCGGAA15959
AGATCGGAAG16773
AGATCGGAAGA15262
AGATCGGAAGAG21197
AGATCGGAAGAGC17118
AGATCGGAAGAGCG16800
AGATCGGAAGAGCGT27041
AGATCGGAAGAGCGTC15180
AGATCGGAAGAGCGTCG24120
AGATCGGAAGAGCGTCGT16125
AGATCGGAAGAGCGTCGTG12546
AGATCGGAAGAGCGTCGTGTAG13933
AGATCGGAAGAGCGTCGTGTAGG21561
AGATCGGAAGAGCGTCGTGTAGGG15766
AGATCGGAAGAGCGTCGTGTAGGGA12519
AGATCGGAAGAGCGTCGTGTAGGGAAAGA9559
AGATCGGAAGAGCGTCGTGTAGGGAAAGAG10301
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGT11466
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG10137
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT12772
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA10581
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAT10624
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTATG9633
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTATGA9701
other adapter sequences420750
This estimation is based on paired-end overlap analysis, and there are 66.736309% reads found not overlapped.
The nonoverlapped read pairs may have insert size <30 or >270, or contain too much sequencing errors to be detected as overlapped.
Value of each position will be shown on mouse over.
Value of each position will be shown on mouse over.
Darker background means larger counts. The count will be shown on mouse over.
AAATACAGTATTTCTGCACTCCCGGAGTGCGG
AAAAAAAAAAAATAAAACAAAAGAAATAAAATTAAATCAAATGAAACAAAACTAAACCAAACGAAAGAAAAGTAAAGCAAAGG
AATAATAAAATATAATACAATAGAATTAAATTTAATTCAATTGAATCAAATCTAATCCAATCGAATGAAATGTAATGCAATGG
AACAACAAAACATAACACAACAGAACTAAACTTAACTCAACTGAACCAAACCTAACCCAACCGAACGAAACGTAACGCAACGG
AAGAAGAAAAGATAAGACAAGAGAAGTAAAGTTAAGTCAAGTGAAGCAAAGCTAAGCCAAGCGAAGGAAAGGTAAGGCAAGGG
ATAATAAAATAATATAACATAAGATATAATATTATATCATATGATACAATACTATACCATACGATAGAATAGTATAGCATAGG
ATTATTAAATTATATTACATTAGATTTAATTTTATTTCATTTGATTCAATTCTATTCCATTCGATTGAATTGTATTGCATTGG
ATCATCAAATCATATCACATCAGATCTAATCTTATCTCATCTGATCCAATCCTATCCCATCCGATCGAATCGTATCGCATCGG
ATGATGAAATGATATGACATGAGATGTAATGTTATGTCATGTGATGCAATGCTATGCCATGCGATGGAATGGTATGGCATGGG
ACAACAAAACAATACAACACAAGACATAACATTACATCACATGACACAACACTACACCACACGACAGAACAGTACAGCACAGG
ACTACTAAACTATACTACACTAGACTTAACTTTACTTCACTTGACTCAACTCTACTCCACTCGACTGAACTGTACTGCACTGG
ACCACCAAACCATACCACACCAGACCTAACCTTACCTCACCTGACCCAACCCTACCCCACCCGACCGAACCGTACCGCACCGG
ACGACGAAACGATACGACACGAGACGTAACGTTACGTCACGTGACGCAACGCTACGCCACGCGACGGAACGGTACGGCACGGG
AGAAGAAAAGAATAGAACAGAAGAGATAAGATTAGATCAGATGAGACAAGACTAGACCAGACGAGAGAAGAGTAGAGCAGAGG
AGTAGTAAAGTATAGTACAGTAGAGTTAAGTTTAGTTCAGTTGAGTCAAGTCTAGTCCAGTCGAGTGAAGTGTAGTGCAGTGG
AGCAGCAAAGCATAGCACAGCAGAGCTAAGCTTAGCTCAGCTGAGCCAAGCCTAGCCCAGCCGAGCGAAGCGTAGCGCAGCGG
AGGAGGAAAGGATAGGACAGGAGAGGTAAGGTTAGGTCAGGTGAGGCAAGGCTAGGCCAGGCGAGGGAAGGGTAGGGCAGGGG
TAATAAAATAAATTAAACTAAAGTAATATAATTTAATCTAATGTAACATAACTTAACCTAACGTAAGATAAGTTAAGCTAAGG
TATTATAATATATTATACTATAGTATTATATTTTATTCTATTGTATCATATCTTATCCTATCGTATGATATGTTATGCTATGG
TACTACAATACATTACACTACAGTACTATACTTTACTCTACTGTACCATACCTTACCCTACCGTACGATACGTTACGCTACGG
TAGTAGAATAGATTAGACTAGAGTAGTATAGTTTAGTCTAGTGTAGCATAGCTTAGCCTAGCGTAGGATAGGTTAGGCTAGGG
TTATTAAATTAATTTAACTTAAGTTATATTATTTTATCTTATGTTACATTACTTTACCTTACGTTAGATTAGTTTAGCTTAGG
TTTTTTAATTTATTTTACTTTAGTTTTATTTTTTTTTCTTTTGTTTCATTTCTTTTCCTTTCGTTTGATTTGTTTTGCTTTGG
TTCTTCAATTCATTTCACTTCAGTTCTATTCTTTTCTCTTCTGTTCCATTCCTTTCCCTTCCGTTCGATTCGTTTCGCTTCGG
TTGTTGAATTGATTTGACTTGAGTTGTATTGTTTTGTCTTGTGTTGCATTGCTTTGCCTTGCGTTGGATTGGTTTGGCTTGGG
TCATCAAATCAATTCAACTCAAGTCATATCATTTCATCTCATGTCACATCACTTCACCTCACGTCAGATCAGTTCAGCTCAGG
TCTTCTAATCTATTCTACTCTAGTCTTATCTTTTCTTCTCTTGTCTCATCTCTTCTCCTCTCGTCTGATCTGTTCTGCTCTGG
TCCTCCAATCCATTCCACTCCAGTCCTATCCTTTCCTCTCCTGTCCCATCCCTTCCCCTCCCGTCCGATCCGTTCCGCTCCGG
TCGTCGAATCGATTCGACTCGAGTCGTATCGTTTCGTCTCGTGTCGCATCGCTTCGCCTCGCGTCGGATCGGTTCGGCTCGGG
TGATGAAATGAATTGAACTGAAGTGATATGATTTGATCTGATGTGACATGACTTGACCTGACGTGAGATGAGTTGAGCTGAGG
TGTTGTAATGTATTGTACTGTAGTGTTATGTTTTGTTCTGTTGTGTCATGTCTTGTCCTGTCGTGTGATGTGTTGTGCTGTGG
TGCTGCAATGCATTGCACTGCAGTGCTATGCTTTGCTCTGCTGTGCCATGCCTTGCCCTGCCGTGCGATGCGTTGCGCTGCGG
TGGTGGAATGGATTGGACTGGAGTGGTATGGTTTGGTCTGGTGTGGCATGGCTTGGCCTGGCGTGGGATGGGTTGGGCTGGGG
CAACAAAACAAATCAAACCAAAGCAATACAATTCAATCCAATGCAACACAACTCAACCCAACGCAAGACAAGTCAAGCCAAGG
CATCATAACATATCATACCATAGCATTACATTTCATTCCATTGCATCACATCTCATCCCATCGCATGACATGTCATGCCATGG
CACCACAACACATCACACCACAGCACTACACTTCACTCCACTGCACCACACCTCACCCCACCGCACGACACGTCACGCCACGG
CAGCAGAACAGATCAGACCAGAGCAGTACAGTTCAGTCCAGTGCAGCACAGCTCAGCCCAGCGCAGGACAGGTCAGGCCAGGG
CTACTAAACTAATCTAACCTAAGCTATACTATTCTATCCTATGCTACACTACTCTACCCTACGCTAGACTAGTCTAGCCTAGG
CTTCTTAACTTATCTTACCTTAGCTTTACTTTTCTTTCCTTTGCTTCACTTCTCTTCCCTTCGCTTGACTTGTCTTGCCTTGG
CTCCTCAACTCATCTCACCTCAGCTCTACTCTTCTCTCCTCTGCTCCACTCCTCTCCCCTCCGCTCGACTCGTCTCGCCTCGG
CTGCTGAACTGATCTGACCTGAGCTGTACTGTTCTGTCCTGTGCTGCACTGCTCTGCCCTGCGCTGGACTGGTCTGGCCTGGG
CCACCAAACCAATCCAACCCAAGCCATACCATTCCATCCCATGCCACACCACTCCACCCCACGCCAGACCAGTCCAGCCCAGG
CCTCCTAACCTATCCTACCCTAGCCTTACCTTTCCTTCCCTTGCCTCACCTCTCCTCCCCTCGCCTGACCTGTCCTGCCCTGG
CCCCCCAACCCATCCCACCCCAGCCCTACCCTTCCCTCCCCTGCCCCACCCCTCCCCCCCCCGCCCGACCCGTCCCGCCCCGG
CCGCCGAACCGATCCGACCCGAGCCGTACCGTTCCGTCCCGTGCCGCACCGCTCCGCCCCGCGCCGGACCGGTCCGGCCCGGG
CGACGAAACGAATCGAACCGAAGCGATACGATTCGATCCGATGCGACACGACTCGACCCGACGCGAGACGAGTCGAGCCGAGG
CGTCGTAACGTATCGTACCGTAGCGTTACGTTTCGTTCCGTTGCGTCACGTCTCGTCCCGTCGCGTGACGTGTCGTGCCGTGG
CGCCGCAACGCATCGCACCGCAGCGCTACGCTTCGCTCCGCTGCGCCACGCCTCGCCCCGCCGCGCGACGCGTCGCGCCGCGG
CGGCGGAACGGATCGGACCGGAGCGGTACGGTTCGGTCCGGTGCGGCACGGCTCGGCCCGGCGCGGGACGGGTCGGGCCGGGG
GAAGAAAAGAAATGAAACGAAAGGAATAGAATTGAATCGAATGGAACAGAACTGAACCGAACGGAAGAGAAGTGAAGCGAAGG
GATGATAAGATATGATACGATAGGATTAGATTTGATTCGATTGGATCAGATCTGATCCGATCGGATGAGATGTGATGCGATGG
GACGACAAGACATGACACGACAGGACTAGACTTGACTCGACTGGACCAGACCTGACCCGACCGGACGAGACGTGACGCGACGG
GAGGAGAAGAGATGAGACGAGAGGAGTAGAGTTGAGTCGAGTGGAGCAGAGCTGAGCCGAGCGGAGGAGAGGTGAGGCGAGGG
GTAGTAAAGTAATGTAACGTAAGGTATAGTATTGTATCGTATGGTACAGTACTGTACCGTACGGTAGAGTAGTGTAGCGTAGG
GTTGTTAAGTTATGTTACGTTAGGTTTAGTTTTGTTTCGTTTGGTTCAGTTCTGTTCCGTTCGGTTGAGTTGTGTTGCGTTGG
GTCGTCAAGTCATGTCACGTCAGGTCTAGTCTTGTCTCGTCTGGTCCAGTCCTGTCCCGTCCGGTCGAGTCGTGTCGCGTCGG
GTGGTGAAGTGATGTGACGTGAGGTGTAGTGTTGTGTCGTGTGGTGCAGTGCTGTGCCGTGCGGTGGAGTGGTGTGGCGTGGG
GCAGCAAAGCAATGCAACGCAAGGCATAGCATTGCATCGCATGGCACAGCACTGCACCGCACGGCAGAGCAGTGCAGCGCAGG
GCTGCTAAGCTATGCTACGCTAGGCTTAGCTTTGCTTCGCTTGGCTCAGCTCTGCTCCGCTCGGCTGAGCTGTGCTGCGCTGG
GCCGCCAAGCCATGCCACGCCAGGCCTAGCCTTGCCTCGCCTGGCCCAGCCCTGCCCCGCCCGGCCGAGCCGTGCCGCGCCGG
GCGGCGAAGCGATGCGACGCGAGGCGTAGCGTTGCGTCGCGTGGCGCAGCGCTGCGCCGCGCGGCGGAGCGGTGCGGCGCGGG
GGAGGAAAGGAATGGAACGGAAGGGATAGGATTGGATCGGATGGGACAGGACTGGACCGGACGGGAGAGGAGTGGAGCGGAGG
GGTGGTAAGGTATGGTACGGTAGGGTTAGGTTTGGTTCGGTTGGGTCAGGTCTGGTCCGGTCGGGTGAGGTGTGGTGCGGTGG
GGCGGCAAGGCATGGCACGGCAGGGCTAGGCTTGGCTCGGCTGGGCCAGGCCTGGCCCGGCCGGGCGAGGCGTGGCGCGGCGG
GGGGGGAAGGGATGGGACGGGAGGGGTAGGGTTGGGTCGGGTGGGGCAGGGCTGGGCCGGGCGGGGGAGGGGTGGGGCGGGGG
Sampling rate: 1 / 20
overrepresented sequencecount (% of bases)distribution: cycle 1 ~ cycle 150
AAAAAAAAAA11011 (0.061170%)
AAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGA47 (0.002611%)
AAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAA10 (0.000556%)
AAAAAGTTGTGGAGAACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCA181 (0.010055%)
AAAACCGAGATCTGTCCCAGTATATTCGGAACTGCGGAGTCTGACCGCGGTGTGCTTCTACTGCAGCTCATTCGGTCTCTTTCTCACTGTAGGAGTAGAT7 (0.000389%)
AAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCT5 (0.000278%)
AAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAAT9 (0.000500%)
AAAAGACGTTAACCAGCAGGAGTTCGTCAGAGCTCTGGCAGCCTTCCTCAAAAAGTCCGGGAAGCTGAAAGTCCCCGAATGGGTGGACACAGTCAAGCTG3 (0.000167%)
AAAAGAGGTCCCCATTTTATGAGAGAGAGTATGACAGCATTGCCTTCTCATGAACATTACAAAGGATATATATATATATATACACACACATATACATATA10 (0.000556%)
AAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGA30 (0.001667%)
AAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGG605 (0.033610%)
AAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGC28 (0.001556%)
AAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGC10 (0.000556%)
AAAATGGTGAAGGTCGGTGTGAACGGATTTGGCCGTATTGGGCGCCTGGTCACCAGGGCTGCCATTTGCAGTGGCAAAGTGGAGATTGTTGCCATCAACG8 (0.000444%)
AAACAACAGTAAAAGAGGTCCCCATTTTATGAGAGAGAGTATGACAGCATTGCCTTCTCATGAACATTACAAAGGATATATATATATATATACACACACA146 (0.008111%)
AAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAGGGATGAGTTGGATAAAACAATTCCG5 (0.000278%)
AAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATC16 (0.000889%)
AAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGA14 (0.000778%)
AAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTG11 (0.000611%)
AAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAA8 (0.000444%)
AAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGG20 (0.001111%)
AAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAA12 (0.000667%)
AAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTA15 (0.000833%)
AAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGG24 (0.001333%)
AAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCA37 (0.002055%)
AAAGTTCTTTTCAACTTTCCCTTACGGTACTTGTTGACTATCGGTCTCGTGCCGGTATTTAGCCTTAGATGGAGTTTACCACCCGCTTTGGGCTGCATTC4 (0.000222%)
AAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCA21 (0.001167%)
AAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAA4 (0.000222%)
AAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCT16 (0.000889%)
AACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAG4 (0.000222%)
AACAACAGTAAAAGAGGTCCCCATTTTATGAGAGAGAGTATGACAGCATTGCCTTCTCATGAACATTACAAAGGATATATATATATATATACACACACAT4 (0.000222%)
AACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTA7 (0.000389%)
AACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCT15 (0.000833%)
AACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGT9 (0.000500%)
AACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTT10 (0.000556%)
AACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGC13 (0.000722%)
AACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCT6 (0.000333%)
AACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGT5 (0.000278%)
AACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGC8 (0.000444%)
AAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCT6 (0.000333%)
AAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAA5 (0.000278%)
AAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGA11 (0.000611%)
AAGAGCACACGTCTGAACTCCAGTCACCTGAACGTTGATC6 (0.000133%)
AAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAAC4 (0.000222%)
AAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGT4 (0.000222%)
AAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAA3 (0.000167%)
AAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTAT3 (0.000167%)
AAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACA4 (0.000222%)
AAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTA3 (0.000167%)
AAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTT4 (0.000222%)
AAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGC5 (0.000278%)
AAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAG8 (0.000444%)
AAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAG4 (0.000222%)
AATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCAC5 (0.000278%)
AATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAG3 (0.000167%)
AATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAA298 (0.016555%)
AATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAA6 (0.000333%)
AATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGA4 (0.000222%)
AATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTT3 (0.000167%)
AATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTC17 (0.000944%)
ACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGC26 (0.001444%)
ACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTC6 (0.000333%)
ACACGTCTGAACTCCAGTCACCTGAACGTTGATCTCGTAT6 (0.000133%)
ACACTTGTGAGATGAGCAGGAAGCTTCAGGGACAATGGTTTCCCTTTTCTCATCAAAGCAGGGAGTTCATAAAGAAAATCCGTGGGTGGAGAGAATCAGC99 (0.005500%)
ACAGCATTGCCTTCTCATGAACATTACAAAGGATATATATATATATATACACACACATATACATATACATATACATCATATACATATACATATACATATA67 (0.003722%)
ACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTG4 (0.000222%)
ACAGTCCATGCCATCACTGCCACCCAGAAGACTGTGGATGGCCCCTCTGGAAAGCTGTGGCGTGATGGCCGTGGGGCTGCCCAGAACATCATCCCTGCAT3 (0.000167%)
ACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGT4 (0.000222%)
ACCAAATCCAGCAACCAGAACTTCATCATTTTCCTCAATGAAGTTCAGGCAGCCATCATTGGGCACGAACGCTGTGATCTTCTTCCCGTTCTTAATGAGC39 (0.002167%)
ACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCG7 (0.000389%)
ACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGC4 (0.000222%)
ACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCA5 (0.000278%)
ACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTAC4 (0.000222%)
ACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCA22 (0.001222%)
ACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAG5 (0.000278%)
ACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTG3 (0.000167%)
ACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCT5 (0.000278%)
ACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCC16 (0.000889%)
ACGTCTGAACTCCAGTCACCTGAACGTTGATCTCGTATGC7 (0.000156%)
ACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTAT8 (0.000444%)
ACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCAT3 (0.000167%)
ACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTG338 (0.018777%)
ACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAA3 (0.000167%)
ACTGTTTTCATTTTTAAAGGAAATCAGTTCTGGGCTATACGAGGGCACGAGGAGCTAGCAGGTTATCCTAAAAGCATTCACACCCTGGGTCTCCCTGCAA3 (0.000167%)
ACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAA8 (0.000444%)
AGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTC318 (0.017666%)
AGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCT10 (0.000556%)
AGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCT70 (0.003889%)
AGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAAC6 (0.000333%)
AGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATG14 (0.000778%)
AGACACTGTTTTCATTTTTAAAGGAAATCAGTTCTGGGCTATACGAGGGCACGAGGAGCTAGCAGGTTATCCTAAAAGCATTCACACCCTGGGTCTCCCT8 (0.000444%)
AGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGAC4 (0.000222%)
AGAGACACTGTTTTCATTTTTAAAGGAAATCAGTTCTGGGCTATACGAGGGCACGAGGAGCTAGCAGGTTATCCTAAAAGCATTCACACCCTGGGTCTCC4 (0.000222%)
AGAGCACACGTCTGAACTCCAGTCACCTGAACGTTGATCT6 (0.000133%)
AGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGT5 (0.000278%)
AGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCC4 (0.000222%)
AGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGT6 (0.000333%)
AGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAAT29 (0.001611%)
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAC4556 (0.101242%)
AGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAG4 (0.000222%)
AGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAG9 (0.000500%)
AGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCC3 (0.000167%)
AGCACACGTCTGAACTCCAGTCACCTGAACGTTGATCTCG8 (0.000178%)
AGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAAC5 (0.000278%)
AGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTC4 (0.000222%)
AGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCA9 (0.000500%)
AGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGT14 (0.000778%)
AGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAG6 (0.000333%)
AGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCC5 (0.000278%)
AGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACC4 (0.000222%)
AGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAA3 (0.000167%)
AGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTAT5 (0.000278%)
AGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCT10 (0.000556%)
AGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAA8 (0.000444%)
AGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTA45 (0.002500%)
AGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTG7 (0.000389%)
AGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCA4 (0.000222%)
AGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCA8 (0.000444%)
AGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGC6 (0.000333%)
AGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGC5 (0.000278%)
AGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGC7 (0.000389%)
AGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAA4 (0.000222%)
AGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAG4 (0.000222%)
ATAAATTGTATAGCATATTAGAAACTGGATTTGTAATTAAGCAGGTTCAAATGAATCTTCAGAGCATCATGATGCTTGATCACATGTCTCGATCCCAGTA74 (0.004111%)
ATAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGAT3 (0.000167%)
ATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACAT3 (0.000167%)
ATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAG7 (0.000389%)
ATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTA9 (0.000500%)
ATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGG29 (0.001611%)
ATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATAC7 (0.000389%)
ATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGC6 (0.000333%)
ATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACA21 (0.001167%)
ATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGG4 (0.000222%)
ATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACT6 (0.000333%)
ATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAA49 (0.002722%)
ATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCA7 (0.000389%)
ATCGCGTCAACACCCGCCGCGGGCCTTCGCGATGCTTTGTTTTAATTAAACAGTCGGATTCCCCTGGTCCGCACCAGTTCTAAGTCGGCTGCTAGGCGCC39 (0.002167%)
ATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTA10 (0.000556%)
ATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAACGT9 (0.000200%)
ATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGA3 (0.000167%)
ATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGA5 (0.000278%)
ATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCAT5 (0.000278%)
ATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGG4 (0.000222%)
ATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAG11 (0.000611%)
ATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTG23 (0.001278%)
ATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTC3 (0.000167%)
ATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCT6 (0.000333%)
ATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAAC20 (0.001111%)
ATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCA4 (0.000222%)
ATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTAT6 (0.000333%)
ATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTG4 (0.000222%)
ATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGA16 (0.000889%)
ATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTG3 (0.000167%)
ATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACG6 (0.000333%)
ATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTA3 (0.000167%)
ATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCA8 (0.000444%)
ATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTCAACACCTGGAAAGTCCTCAGCTATCTT3 (0.000167%)
ATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATA16 (0.000889%)
ATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAG15 (0.000833%)
ATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTG10 (0.000556%)
ATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAG6 (0.000333%)
ATTTCCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAA8 (0.000444%)
ATTTCCTTTAAAAATGAAAACAGTGTCTCTGTTAGTAACCTCATATGCAGCATCCATGTTGGATGGAAGAGATGGCCAAAATGAAGAGATCAAATAAAAT7 (0.000389%)
ATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTCAACACCTGGAAAGTCC13 (0.000722%)
ATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCA18 (0.001000%)
CAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACG19 (0.001056%)
CAAAACCGAGATCTGTCCCAGTATATTCGGAACTGCGGAGTCTGACCGCGGTGTGCTTCTACTGCAGCTCATTCGGTCTCTTTCTCACTGTAGGAGTAGA10 (0.000556%)
CAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCG12 (0.000667%)
CAAACACTGCTCCCATTGATAGAACATAGTGGAAATGGGCTACTACATAGTATGTATCGTGAAGCACGATGTCAAGGGATGAGTTGGATAAAACAATTCC117 (0.006500%)
CAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGT27 (0.001500%)
CAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAG38 (0.002111%)
CAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACA43 (0.002389%)
CAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCT6 (0.000333%)
CAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGC121 (0.006722%)
CAAAGTTCTTTTCAACTTTCCCTTACGGTACTTGTTGACTATCGGTCTCGTGCCGGTATTTAGCCTTAGATGGAGTTTACCACCCGCTTTGGGCTGCATT5 (0.000278%)
CAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATA20 (0.001111%)
CAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTCAACACCTGGAAAGTCCTCAGCTAT6 (0.000333%)
CAACAGTAAAAGAGGTCCCCATTTTATGAGAGAGAGTATGACAGCATTGCCTTCTCATGAACATTACAAAGGATATATATATATATATACACACACATAT5 (0.000278%)
CAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCG44 (0.002444%)
CAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTC18 (0.001000%)
CAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTCAACACCTGGAAAGTCCTCAGCTATCTTCCTG3 (0.000167%)
CAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCG6 (0.000333%)
CAAGGACCCGGGTGACGTGGTTCCGGTTGGACAGAGGAGAGCGTGGTGTTGGTGCATGTGTTTCGGACTGGCCTTCATGCTTGCTGGCGTCATCCTCGGA21 (0.001167%)
CAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTG3 (0.000167%)
CAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCT509 (0.028277%)
CAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTT9 (0.000500%)
CAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAG4 (0.000222%)
CACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTT108 (0.006000%)
CACACGTCTGAACTCCAGTCACCTGAACGTTGATCTCGTA6 (0.000133%)
CACACTGTCAAAACCGAGATCTGTCCCAGTATATTCGGAACTGCGGAGTCTGACCGCGGTGTGCTTCTACTGCAGCTCATTCGGTCTCTTTCTCACTGTA158 (0.008778%)
CACATCCCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATA9 (0.000500%)
CACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAA11 (0.000611%)
CACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACC50 (0.002778%)
CACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGG14 (0.000778%)
CACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATC4 (0.000222%)
CACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCC18 (0.001000%)
CACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATC6 (0.000333%)
CACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAA28 (0.001556%)
CACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGT53 (0.002944%)
CACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTA7 (0.000389%)
CACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCA9 (0.000500%)
CACTGTCAAAACCGAGATCTGTCCCAGTATATTCGGAACTGCGGAGTCTGACCGCGGTGTGCTTCTACTGCAGCTCATTCGGTCTCTTTCTCACTGTAGG3 (0.000167%)
CACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGC3 (0.000167%)
CACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATC9 (0.000500%)
CAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCAT14 (0.000778%)
CAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGG14 (0.000778%)
CAGAGACACTGTTTTCATTTTTAAAGGAAATCAGTTCTGGGCTATACGAGGGCACGAGGAGCTAGCAGGTTATCCTAAAAGCATTCACACCCTGGGTCTC199 (0.011055%)
CAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTC3 (0.000167%)
CAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCG16 (0.000889%)
CAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAG4 (0.000222%)
CAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAA3803 (0.084509%)
CAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAA6 (0.000333%)
CAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGT7 (0.000389%)
CAGCATTGCCTTCTCATGAACATTACAAAGGATATATATATATATATACACACACATATACATATACATATACATCATATACATATACATATACATATAC4 (0.000222%)
CAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCA4 (0.000222%)
CAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGA3 (0.000167%)
CAGCCTCGTCCCGTAGACAAAATGGTGAAGGTCGGTGTGAACGGATTTGGCCGTATTGGGCGCCTGGTCACCAGGGCTGCCATTTGCAGTGGCAAAGTGG4 (0.000222%)
CAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGA19 (0.001056%)
CAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCA4 (0.000222%)
CAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGA200 (0.011111%)
CAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCCGCAGCATC8 (0.000444%)
CAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCCGCAGCATCTAGCTGAA6 (0.000333%)
CAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCG329 (0.018277%)
CAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTC17 (0.000944%)
CAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAA10 (0.000556%)
CAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTC54 (0.003000%)
CAGGAAGCTTCAGGGACAATGGTTTCCCTTTTCTCATCAAAGCAGGGAGTTCATAAAGAAAATCCGTGGGTGGAGAGAATCAGCCCTTTCTTCTTATCTT8 (0.000444%)
CAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCT5 (0.000278%)
CAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAA9 (0.000500%)
CAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTC16 (0.000889%)
CAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAA24 (0.001333%)
CAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACC4 (0.000222%)
CAGTAAAAGAGGTCCCCATTTTATGAGAGAGAGTATGACAGCATTGCCTTCTCATGAACATTACAAAGGATATATATATATATATACACACACATATACA5 (0.000278%)
CAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGG5 (0.000278%)
CAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCT9 (0.000500%)
CAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCG26 (0.001444%)
CAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCT6 (0.000333%)
CAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATG3 (0.000167%)
CAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATA7 (0.000389%)
CATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGA10 (0.000556%)
CATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGAC4 (0.000222%)
CATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTAC5 (0.000278%)
CATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTT3 (0.000167%)
CATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCATGAGCCAAGACTGTTCCAGGCCCATCAAAAGGGACAAAGT10 (0.000556%)
CATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAG4 (0.000222%)
CATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAA7 (0.000389%)
CATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACT6 (0.000333%)
CATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAG4 (0.000222%)
CATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCT4 (0.000222%)
CATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATA17 (0.000944%)
CATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCG8 (0.000444%)
CATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGA5 (0.000278%)
CCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGAC7 (0.000389%)
CCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATAT6 (0.000333%)
CCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTCAACACCTGGAAAGTCCTCAGCTATCTTCCT3 (0.000167%)
CCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGCTCCTG5 (0.000278%)
CCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTC7 (0.000389%)
CCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGT9 (0.000500%)
CCACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGT328 (0.018222%)
CCACAGTCCATGCCATCACTGCCACCCAGAAGACTGTGGATGGCCCCTCTGGAAAGCTGTGGCGTGATGGCCGTGGGGCTGCCCAGAACATCATCCCTGC43 (0.002389%)
CCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTG6 (0.000333%)
CCACATCCCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAAT8 (0.000444%)
CCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGAT5 (0.000278%)
CCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACAT7 (0.000389%)
CCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCA39 (0.002167%)
CCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCA3 (0.000167%)
CCAGCCTCGTCCCGTAGACAAAATGGTGAAGGTCGGTGTGAACGGATTTGGCCGTATTGGGCGCCTGGTCACCAGGGCTGCCATTTGCAGTGGCAAAGTG5 (0.000278%)
CCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAA3 (0.000167%)
CCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCCGCAGCAT3 (0.000167%)
CCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGT27 (0.001500%)
CCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAG5 (0.000278%)
CCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTT75 (0.004167%)
CCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCAT5 (0.000278%)
CCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTT3 (0.000167%)
CCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTA4 (0.000222%)
CCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCATGAGCCAAGACTGTTCCAGGCCCATCAAAAGGGACAAAG15 (0.000833%)
CCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATA3 (0.000167%)
CCATGCCATCACTGCCACCCAGAAGACTGTGGATGGCCCCTCTGGAAAGCTGTGGCGTGATGGCCGTGGGGCTGCCCAGAACATCATCCCTGCATCCACT3 (0.000167%)
CCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCC5 (0.000278%)
CCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGCTCCT3 (0.000167%)
CCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTC71 (0.003944%)
CCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGG12 (0.000667%)
CCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTA3 (0.000167%)
CCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATT49 (0.002722%)
CCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGAT11 (0.000611%)
CCCCTTTGCATCTCTGGCATCTGGCATCCTCTTGTTGCTATCACTGATAGCTTCCAGTAAGGCCTGTAGCTGTGCCCCACCCCACCCACAGACAGCCTTC9 (0.000500%)
CCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATT35 (0.001944%)
CCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCT7 (0.000389%)
CCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCCGCAGCATCTAGCTGAAGCTGCCCC9 (0.000500%)
CCCGGAGTTACTGTAAAAGACGTTAACCAGCAGGAGTTCGTCAGAGCTCTGGCAGCCTTCCTCAAAAAGTCCGGGAAGCTGAAAGTCCCCGAATGGGTGG3 (0.000167%)
CCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCA3 (0.000167%)
CCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCC20 (0.001111%)
CCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGA12 (0.000667%)
CCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTC8 (0.000444%)
CCGATCTCTCGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGC165 (0.013566%)
CCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTACCAGCATCTGTTCTGATTCTTTGGGCACCCAGAAGTTTATATT169 (0.009389%)
CCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCCGCAGCATCTAGCT5 (0.000278%)
CCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTA7 (0.000389%)
CCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCCGCAGCATCTAGCTGAAGCTGCCCCT5 (0.000278%)
CCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGC13 (0.000722%)
CCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAA29 (0.001611%)
CCGGAGTTACTGTAAAAGACGTTAACCAGCAGGAGTTCGTCAGAGCTCTGGCAGCCTTCCTCAAAAAGTCCGGGAAGCTGAAAGTCCCCGAATGGGTGGA4 (0.000222%)
CCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAAC17 (0.000944%)
CCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAG8 (0.000444%)
CCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACC7 (0.000389%)
CCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCC18 (0.001000%)
CCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATG4 (0.000222%)
CCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACT15 (0.000833%)
CCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGA18 (0.001000%)
CCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCA7 (0.000389%)
CCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATA9 (0.000500%)
CCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCAT18 (0.001000%)
CCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCAT4 (0.000222%)
CCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAG23 (0.001278%)
CCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTT3 (0.000167%)
CCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATA5 (0.000278%)
CCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAG3 (0.000167%)
CCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAA26 (0.001444%)
CCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCTG7 (0.000389%)
CCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACCTAGAA3 (0.000167%)
CCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGC35 (0.001944%)
CCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTA60 (0.003333%)
CGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTCAACACCTGGAAAGTCCTCAGCTATCTTCCTGGGAAAT44 (0.002444%)
CGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCAC24 (0.001333%)
CGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGG15 (0.000833%)
CGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGT7 (0.000389%)
CGATCTCTCGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCT21 (0.001727%)
CGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCA285 (0.015833%)
CGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTG59 (0.003278%)
CGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCCGCAGCATCTAGCTG22 (0.001222%)
CGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAA55 (0.003055%)
CGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCCGCAGCATCTAGCTGAAGCTGCCCCTT6 (0.000333%)
CGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAG42 (0.002333%)
CGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCCGCAGCATCTAGCTGAAGCTGCC3 (0.000167%)
CGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCT15 (0.000833%)
CGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAAC24 (0.001333%)
CGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGA54 (0.003000%)
CGCGTCAACACCCGCCGCGGGCCTTCGCGATGCTTTGTTTTAATTAAACAGTCGGATTCCCCTGGTCCGCACCAGTTCTAAGTCGGCTGCTAGGCGCCGG4 (0.000222%)
CGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCA670 (0.037221%)
CGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGC24 (0.001333%)
CGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTC24 (0.001333%)
CGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGG6 (0.000333%)
CGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTC4 (0.000222%)
CGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCT38 (0.002111%)
CGGAAGGCCATGCCAGTGAGCTTCCCGTTCAGCTCTGGGATGACCTTGCCCACAGCCTTGGCAGCACCAGTGGATGCAGGGATGATGTTCTGGGCAGCCC14 (0.000778%)
CGGAGTTACTGTAAAAGACGTTAACCAGCAGGAGTTCGTCAGAGCTCTGGCAGCCTTCCTCAAAAAGTCCGGGAAGCTGAAAGTCCCCGAATGGGTGGAC5 (0.000278%)
CGGCACGTCAGATCCACGACGGACACATTGGGGGTAGGAACACGGAAGGCCATGCCAGTGAGCTTCCCGTTCAGCTCTGGGATGACCTTGCCCACAGCCT7 (0.000389%)
CGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATA105 (0.005833%)
CGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCA92 (0.005111%)
CGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACT3 (0.000167%)
CGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCAC14 (0.000778%)
CGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGT26 (0.001444%)
CGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACCT13 (0.000722%)
CGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCG44 (0.002444%)
CGGTTTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTC67 (0.003722%)
CGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGT8 (0.000444%)
CGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGC480 (0.026666%)
CGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGC5 (0.000278%)
CGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCAT10 (0.000556%)
CGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGG10 (0.000556%)
CGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTT6 (0.000333%)
CTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAG3 (0.000167%)
CTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTAT5 (0.000278%)
CTAGATTTCCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAG11 (0.000611%)
CTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATAC6 (0.000333%)
CTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCC5 (0.000278%)
CTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACT7 (0.000389%)
CTCAAGGTAATGGCTGGTGTAGGGGAAGGGGGAGGCATAAGGGCAGGAGTGGGGCTTGTGGCAGGGCCTGCGGTAGAATTGAGGCGACGCAGTCGCATCT27 (0.001500%)
CTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGC3 (0.000167%)
CTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAG4 (0.000222%)
CTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGA5 (0.000278%)
CTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAG6 (0.000333%)
CTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCCGCAGC3 (0.000167%)
CTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCC20 (0.001111%)
CTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAG26 (0.001444%)
CTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCCGCAGCATCTAGCTGAAGCT4 (0.000222%)
CTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGG487 (0.027055%)
CTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCA44 (0.002444%)
CTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACG41 (0.003371%)
CTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCC3 (0.000167%)
CTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCC75 (0.004167%)
CTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGC31 (0.001722%)
CTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATC13 (0.000722%)
CTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGA14 (0.000778%)
CTCGGATGCTGGGATGGGGATGGGGGTGGGAGGTATGGCAGGCAGAGCCACAACAGCAGGCACTACAAACCGCACTAGTCTAGGGAGAGGCTAGGATGCA126 (0.007000%)
CTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGA172 (0.009555%)
CTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTT50 (0.002778%)
CTCGTCCCGTAGACAAAATGGTGAAGGTCGGTGTGAACGGATTTGGCCGTATTGGGCGCCTGGTCACCAGGGCTGCCATTTGCAGTGGCAAAGTGGAGAT3 (0.000167%)
CTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGG9 (0.000500%)
CTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTT4 (0.000222%)
CTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAG60 (0.003333%)
CTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTT14 (0.000778%)
CTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCATGAGCCAAGACTGTTCCAGGCCCATCAAAAGGG130 (0.007222%)
CTCTGTTAGTAACCTCATATGCAGCATCCATGTTGGATGGAAGAGATGGCCAAAATGAAGAGATCAAATAAAATTCAGGCTCAGGAGTCCTGAGAGATTT3 (0.000167%)
CTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGC4 (0.000222%)
CTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTG23 (0.001278%)
CTGAACTCCAGTCACCTGAACGTTGATCTCGTATGCCGTC8 (0.000178%)
CTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTAT32 (0.001778%)
CTGACAGGCAAGACCATCACCCTGGAGGTCGAGCCCAGTGACACCATAGAGAATGTCAAGGCAAAGATCCAGGACAAGGAGGGCATCCCCCCTGACCAGC3 (0.000167%)
CTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGA43 (0.002389%)
CTGAGCCTGGGCTGGCATATAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATG8 (0.000444%)
CTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTT5 (0.000278%)
CTGATTTCCTTTAAAAATGAAAACAGTGTCTCTGTTAGTAACCTCATATGCAGCATCCATGTTGGATGGAAGAGATGGCCAAAATGAAGAGATCAAATAA232 (0.012889%)
CTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGT7 (0.000389%)
CTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATT13 (0.000722%)
CTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAA30 (0.001667%)
CTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAG19 (0.001056%)
CTGCCACCCAGAAGACTGTGGATGGCCCCTCTGGAAAGCTGTGGCGTGATGGCCGTGGGGCTGCCCAGAACATCATCCCTGCATCCACTGGTGCTGCCAA5 (0.000278%)
CTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCT26 (0.001444%)
CTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTC30 (0.001667%)
CTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATG8 (0.000444%)
CTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTCAACACCTGGAAAGTCCTCAGCTATCTTCCTGGGA3 (0.000167%)
CTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTT17 (0.000944%)
CTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGC3 (0.000167%)
CTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCT8 (0.000444%)
CTGGCATATAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTA29 (0.001611%)
CTGGCATCCTCTTGTTGCTATCACTGATAGCTTCCAGTAAGGCCTGTAGCTGTGCCCCACCCCACCCACAGACAGCCTTCTGCAACTCGGACCTGGTCAT14 (0.000778%)
CTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCC30 (0.001667%)
CTGGCATCTGGCATCCTCTTGTTGCTATCACTGATAGCTTCCAGTAAGGCCTGTAGCTGTGCCCCACCCCACCCACAGACAGCCTTCTGCAACTCGGACC11 (0.000611%)
CTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAAT19 (0.001056%)
CTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACT14 (0.000778%)
CTGGGCTGGCATATAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAG5 (0.000278%)
CTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGA3 (0.000167%)
CTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGG11 (0.000611%)
CTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAG677 (0.037610%)
CTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCATGAGCCAAGACTGTTCCAGGCCCATCAAAAGGGAC4 (0.000222%)
CTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTG3 (0.000167%)
CTGTTAGTAACCTCATATGCAGCATCCATGTTGGATGGAAGAGATGGCCAAAATGAAGAGATCAAATAAAATTCAGGCTCAGGAGTCCTGAGAGATTTGC5 (0.000278%)
CTGTTTTCATTTTTAAAGGAAATCAGTTCTGGGCTATACGAGGGCACGAGGAGCTAGCAGGTTATCCTAAAAGCATTCACACCCTGGGTCTCCCTGCAAC5 (0.000278%)
CTTACGTCTGAGCCTGGGCTGGCATATAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTT135 (0.007500%)
CTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTA9 (0.000500%)
CTTCAAAGTTCTTTTCAACTTTCCCTTACGGTACTTGTTGACTATCGGTCTCGTGCCGGTATTTAGCCTTAGATGGAGTTTACCACCCGCTTTGGGCTGC104 (0.005778%)
CTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCA84 (0.004667%)
CTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTC646 (0.035888%)
CTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTC12 (0.000667%)
CTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCC36 (0.002000%)
CTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACA13 (0.000722%)
CTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAA4 (0.000222%)
CTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTG15 (0.000833%)
CTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTC15 (0.000833%)
CTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTAT28 (0.001556%)
CTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACC119 (0.006611%)
CTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAG43 (0.002389%)
CTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTC5 (0.000278%)
CTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTG10 (0.000556%)
CTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCA15 (0.000833%)
CTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAA7 (0.000389%)
CTTTAAAAATGAAAACAGTGTCTCTGTTAGTAACCTCATATGCAGCATCCATGTTGGATGGAAGAGATGGCCAAAATGAAGAGATCAAATAAAATTCAGG3 (0.000167%)
CTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAG66 (0.003667%)
CTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCAT43 (0.002389%)
CTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTAT31 (0.001722%)
CTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCA9 (0.000500%)
CTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAA21 (0.001167%)
CTTTGCATCTCTGGCATCTGGCATCCTCTTGTTGCTATCACTGATAGCTTCCAGTAAGGCCTGTAGCTGTGCCCCACCCCACCCACAGACAGCCTTCTGC6 (0.000333%)
CTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACA3 (0.000167%)
CTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAG43 (0.002389%)
CTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTC7 (0.000389%)
CTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGATCAAT10 (0.000556%)
GAAAACAGTGTCTCTGTTAGTAACCTCATATGCAGCATCCATGTTGGATGGAAGAGATGGCCAAAATGAAGAGATCAAATAAAATTCAGGCTCAGGAGTC3 (0.000167%)
GAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCC10 (0.000556%)
GAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTG18 (0.001000%)
GAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAG41 (0.002278%)
GAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGG7 (0.000389%)
GAAAGGTTAACAACCAATGATTCTTGACTTACACACTAAAGTATCACAATTTCCGATAGTGTGACAGATAGGAAAGAATAGGAAATATTTTTGCTAAATA378 (0.020999%)
GAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTG17 (0.000944%)
GAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCA16 (0.000889%)
GAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTC34 (0.001889%)
GAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCG9 (0.000500%)
GAACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACT10 (0.000556%)
GAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAG3 (0.000167%)
GAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCG23 (0.001278%)
GAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAG47 (0.002611%)
GAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTG7 (0.000389%)
GAAGAGCACACGTCTGAACTCCAGTCACCTGAACGTTGAT23 (0.000511%)
GAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTC86 (0.004778%)
GAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGA7 (0.000389%)
GAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGAC16 (0.000889%)
GAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGA25 (0.001389%)
GAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCT8 (0.000444%)
GAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTG16 (0.000889%)
GAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGT3 (0.000167%)
GACACTGTTTTCATTTTTAAAGGAAATCAGTTCTGGGCTATACGAGGGCACGAGGAGCTAGCAGGTTATCCTAAAAGCATTCACACCCTGGGTCTCCCTG4 (0.000222%)
GACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACT3 (0.000167%)
GACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGA4 (0.000222%)
GACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAG5 (0.000278%)
GACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACC6 (0.000333%)
GACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTA714 (0.039666%)
GACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGA11 (0.000611%)
GAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATC12 (0.000667%)
GAGACACTGTTTTCATTTTTAAAGGAAATCAGTTCTGGGCTATACGAGGGCACGAGGAGCTAGCAGGTTATCCTAAAAGCATTCACACCCTGGGTCTCCC13 (0.000722%)
GAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCAT6 (0.000333%)
GAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATC3 (0.000167%)
GAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGG6 (0.000333%)
GAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAA69 (0.003833%)
GAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAA4043 (0.089842%)
GAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTC4 (0.000222%)
GAGCACACGTCTGAACTCCAGTCACCTGAACGTTGATCTC6 (0.000133%)
GAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGG8 (0.000444%)
GAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTC8 (0.000444%)
GAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCC9 (0.000500%)
GAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGA11 (0.000611%)
GAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGG18 (0.001000%)
GAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCT5 (0.000278%)
GAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCAT6 (0.000333%)
GAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAA3 (0.000167%)
GATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATG4 (0.000222%)
GATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCT4 (0.000222%)
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAACG43 (0.000956%)
GATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGA3 (0.000167%)
GATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGA8 (0.000444%)
GATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGT27 (0.001500%)
GATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACA8 (0.000444%)
GATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTC19 (0.001056%)
GATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGC5 (0.000278%)
GATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGA44 (0.002444%)
GATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCA6 (0.000333%)
GATTTCCTCCATTTTGGCGAACCTGGGAAGGTACTGAAGCCACCAACATCAGGAACACCACACCTGGGCTTATGCATCAGCTCCATAGTGTTGGAGTCCA3 (0.000167%)
GCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGG91 (0.005055%)
GCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACT16 (0.000889%)
GCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCA53 (0.002944%)
GCACGTCAGATCCACGACGGACACATTGGGGGTAGGAACACGGAAGGCCATGCCAGTGAGCTTCCCGTTCAGCTCTGGGATGACCTTGCCCACAGCCTTG3 (0.000167%)
GCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTA4 (0.000222%)
GCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGT11 (0.000611%)
GCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCC12 (0.000667%)
GCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTAT7 (0.000389%)
GCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCT118 (0.009702%)
GCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGG36 (0.002000%)
GCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAG8 (0.000444%)
GCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTC13 (0.000722%)
GCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATA27 (0.001500%)
GCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTT6 (0.000333%)
GCAGGAAGCTTCAGGGACAATGGTTTCCCTTTTCTCATCAAAGCAGGGAGTTCATAAAGAAAATCCGTGGGTGGAGAGAATCAGCCCTTTCTTCTTATCT4 (0.000222%)
GCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTC66 (0.003667%)
GCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAAC15 (0.000833%)
GCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCCGCAGCATCTAGCTGAAGCTGCCCCTTC7 (0.000389%)
GCATCTCTGGCATCTGGCATCCTCTTGTTGCTATCACTGATAGCTTCCAGTAAGGCCTGTAGCTGTGCCCCACCCCACCCACAGACAGCCTTCTGCAACT4 (0.000222%)
GCATCTGGCATCCTCTTGTTGCTATCACTGATAGCTTCCAGTAAGGCCTGTAGCTGTGCCCCACCCCACCCACAGACAGCCTTCTGCAACTCGGACCTGG3 (0.000167%)
GCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTC10 (0.000556%)
GCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGA8 (0.000444%)
GCATGGGCTAGATTTCCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTG139 (0.007722%)
GCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGA16 (0.000889%)
GCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATA32 (0.001778%)
GCCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGT50 (0.002778%)
GCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCA16 (0.000889%)
GCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCT22 (0.001222%)
GCCACATCCCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAA357 (0.019833%)
GCCACCCAGAAGACTGTGGATGGCCCCTCTGGAAAGCTGTGGCGTGATGGCCGTGGGGCTGCCCAGAACATCATCCCTGCATCCACTGGTGCTGCCAAGG6 (0.000333%)
GCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGA18 (0.001000%)
GCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACA19 (0.001056%)
GCCAGCCTCGTCCCGTAGACAAAATGGTGAAGGTCGGTGTGAACGGATTTGGCCGTATTGGGCGCCTGGTCACCAGGGCTGCCATTTGCAGTGGCAAAGT186 (0.010333%)
GCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAG64 (0.003555%)
GCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTT9 (0.000500%)
GCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCT7 (0.000389%)
GCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAA19 (0.001056%)
GCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAG6 (0.000333%)
GCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGT7 (0.000389%)
GCCCCCTTTGCATCTCTGGCATCTGGCATCCTCTTGTTGCTATCACTGATAGCTTCCAGTAAGGCCTGTAGCTGTGCCCCACCCCACCCACAGACAGCCT181 (0.010055%)
GCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGC7 (0.000389%)
GCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCCGCAGCATCTAGCTGAAGCTGCCC3 (0.000167%)
GCCCGGAGTTACTGTAAAAGACGTTAACCAGCAGGAGTTCGTCAGAGCTCTGGCAGCCTTCCTCAAAAAGTCCGGGAAGCTGAAAGTCCCCGAATGGGTG48 (0.002667%)
GCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATG103 (0.005722%)
GCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCC10 (0.000556%)
GCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTG7 (0.000389%)
GCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGT11 (0.000611%)
GCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAA14 (0.000778%)
GCCTGGGCTGGCATATAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTA4 (0.000222%)
GCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAG3 (0.000167%)
GCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATG18 (0.001000%)
GCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACC17 (0.000944%)
GCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAG6 (0.000333%)
GCGGCACGTCAGATCCACGACGGACACATTGGGGGTAGGAACACGGAAGGCCATGCCAGTGAGCTTCCCGTTCAGCTCTGGGATGACCTTGCCCACAGCC96 (0.005333%)
GCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCA58 (0.003222%)
GCGGTTTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTT1178 (0.065443%)
GCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTG8 (0.000444%)
GCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCG3 (0.000167%)
GCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTA8 (0.000444%)
GCTAGATTTCCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGA7 (0.000389%)
GCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCC36 (0.002000%)
GCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTA57 (0.003167%)
GCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGC22 (0.001222%)
GCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAG24 (0.001333%)
GCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAA3 (0.000167%)
GCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAA24 (0.001333%)
GCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTA136 (0.007555%)
GCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCT12 (0.000667%)
GCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATG23 (0.001278%)
GCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCG30 (0.001667%)
GCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACCTAGAAAAC3 (0.000167%)
GCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCC10 (0.000556%)
GCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCT7 (0.000389%)
GCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCAC6 (0.000333%)
GCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACA38 (0.002111%)
GCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGC8 (0.000444%)
GCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCAC20 (0.001111%)
GCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTC27 (0.001500%)
GGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGT32 (0.001778%)
GGAACACGGAAGGCCATGCCAGTGAGCTTCCCGTTCAGCTCTGGGATGACCTTGCCCACAGCCTTGGCAGCACCAGTGGATGCAGGGATGATGTTCTGGG3 (0.000167%)
GGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCC11 (0.000611%)
GGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTC39 (0.002167%)
GGAAGAGCACACGTCTGAACTCCAGTCACCTGAACGTTGA16 (0.000356%)
GGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTT61 (0.003389%)
GGAAGGCCATGCCAGTGAGCTTCCCGTTCAGCTCTGGGATGACCTTGCCCACAGCCTTGGCAGCACCAGTGGATGCAGGGATGATGTTCTGGGCAGCCCC4 (0.000222%)
GGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTG258 (0.014333%)
GGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCT5 (0.000278%)
GGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGC5 (0.000278%)
GGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGAT15 (0.000833%)
GGAGAACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGC6 (0.000333%)
GGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGAT16 (0.000889%)
GGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAAC182 (0.010111%)
GGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAG40 (0.002222%)
GGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAG5 (0.000278%)
GGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATT31 (0.001722%)
GGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAG6 (0.000333%)
GGATTTCCTCCATTTTGGCGAACCTGGGAAGGTACTGAAGCCACCAACATCAGGAACACCACACCTGGGCTTATGCATCAGCTCCATAGTGTTGGAGTCC6 (0.000333%)
GGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATG62 (0.003444%)
GGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGG4 (0.000222%)
GGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGT27 (0.001500%)
GGCATATAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGA3 (0.000167%)
GGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAG9 (0.000500%)
GGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAG18 (0.001000%)
GGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTCAACACCTGGAAAG5 (0.000278%)
GGCCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGG12 (0.000667%)
GGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGC29 (0.001611%)
GGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCAC36 (0.002000%)
GGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAG3 (0.000167%)
GGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTT3 (0.000167%)
GGCTAGATTTCCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGG3 (0.000167%)
GGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTT3 (0.000167%)
GGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGA38 (0.002111%)
GGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGG3 (0.000167%)
GGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCT31 (0.001722%)
GGGATTTCCTCCATTTTGGCGAACCTGGGAAGGTACTGAAGCCACCAACATCAGGAACACCACACCTGGGCTTATGCATCAGCTCCATAGTGTTGGAGTC54 (0.003000%)
GGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTG9 (0.000500%)
GGGCTAGATTTCCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAG5 (0.000278%)
GGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACT8 (0.000444%)
GGGCTGGCATATAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTT3 (0.000167%)
GGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTC24 (0.001333%)
GGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGT38 (0.002111%)
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG445 (0.009889%)
GGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCC28 (0.001556%)
GGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCT19 (0.001056%)
GGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTC3 (0.000167%)
GGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTT4 (0.000222%)
GGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCA34 (0.001889%)
GGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAG13 (0.000722%)
GGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCAC21 (0.001167%)
GGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGA7 (0.000389%)
GGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTG3 (0.000167%)
GGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTG23 (0.001278%)
GGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCC6 (0.000333%)
GGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTCA3 (0.000167%)
GGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAG7 (0.000389%)
GGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGC4 (0.000222%)
GGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTT17 (0.000944%)
GGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTAT3 (0.000167%)
GGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCG3 (0.000167%)
GGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACC4 (0.000222%)
GGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTC9 (0.000500%)
GGTTTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCC12 (0.000667%)
GGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAA14 (0.000778%)
GTAAAAGAGGTCCCCATTTTATGAGAGAGAGTATGACAGCATTGCCTTCTCATGAACATTACAAAGGATATATATATATATATACACACACATATACATA6 (0.000333%)
GTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCA10 (0.000556%)
GTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTC19 (0.001056%)
GTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTT3 (0.000167%)
GTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAG17 (0.000944%)
GTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGAT6 (0.000333%)
GTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCA4 (0.000222%)
GTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGG7 (0.000389%)
GTCAAAACCGAGATCTGTCCCAGTATATTCGGAACTGCGGAGTCTGACCGCGGTGTGCTTCTACTGCAGCTCATTCGGTCTCTTTCTCACTGTAGGAGTA15 (0.000833%)
GTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGG30 (0.001667%)
GTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTC27 (0.001500%)
GTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGC18 (0.001000%)
GTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCA20 (0.001111%)
GTCAGATCCACGACGGACACATTGGGGGTAGGAACACGGAAGGCCATGCCAGTGAGCTTCCCGTTCAGCTCTGGGATGACCTTGCCCACAGCCTTGGCAG4 (0.000222%)
GTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGG10 (0.000556%)
GTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCC16 (0.000889%)
GTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCATGAGCCAAGACTGTTCCAGGCCCATCAAAAGGGACAA3 (0.000167%)
GTCCATGCCATCACTGCCACCCAGAAGACTGTGGATGGCCCCTCTGGAAAGCTGTGGCGTGATGGCCGTGGGGCTGCCCAGAACATCATCCCTGCATCCA5 (0.000278%)
GTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGT30 (0.001667%)
GTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGA591 (0.032832%)
GTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGC7 (0.000389%)
GTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCA16 (0.000889%)
GTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACCTAG9 (0.000500%)
GTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCC47 (0.002611%)
GTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATG8 (0.000444%)
GTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAA7 (0.000389%)
GTCTGAACTCCAGTCACCTGAACGTTGATCTCGTATGCCG6 (0.000133%)
GTCTGAGCCTGGGCTGGCATATAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAA7 (0.000389%)
GTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAA5 (0.000278%)
GTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATG3 (0.000167%)
GTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGA43 (0.002389%)
GTGAAGGTCGGTGTGAACGGATTTGGCCGTATTGGGCGCCTGGTCACCAGGGCTGCCATTTGCAGTGGCAAAGTGGAGATTGTTGCCATCAACGACCCCT6 (0.000333%)
GTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTC22 (0.001222%)
GTGATCAGTCATGGCATGCCCTCTGGATCAGGCCATTGGCCTTCTCGTGGCCATCTTCCACAAGTACTCTGGCAAGGAAGGTGACAAGCACACCCTGAGC125 (0.006944%)
GTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGA11 (0.000611%)
GTGATGTGGGATTTCCTCCATTTTGGCGAACCTGGGAAGGTACTGAAGCCACCAACATCAGGAACACCACACCTGGGCTTATGCATCAGCTCCATAGTGT375 (0.020833%)
GTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGAC23 (0.001278%)
GTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCC21 (0.001167%)
GTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGT10 (0.000556%)
GTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTG7 (0.000389%)
GTGGAGAACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCT3 (0.000167%)
GTGGCCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCT230 (0.012777%)
GTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCC4 (0.000222%)
GTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACCTAGAAAACTAC4 (0.000222%)
GTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATG6 (0.000333%)
GTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTG13 (0.000722%)
GTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGG3 (0.000167%)
GTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAG9 (0.000500%)
GTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCT3 (0.000167%)
GTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGC3 (0.000167%)
GTTAACCAGCAGGAGTTCGTCAGAGCTCTGGCAGCCTTCCTCAAAAAGTCCGGGAAGCTGAAAGTCCCCGAATGGGTGGACACAGTCAAGCTGGCCAAAC3 (0.000167%)
GTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCT24 (0.001333%)
GTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCT4 (0.000222%)
GTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATAT5 (0.000278%)
GTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCA13 (0.000722%)
GTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCC48 (0.002667%)
GTTCTTTTCAACTTTCCCTTACGGTACTTGTTGACTATCGGTCTCGTGCCGGTATTTAGCCTTAGATGGAGTTTACCACCCGCTTTGGGCTGCATTCCCA9 (0.000500%)
GTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAA4 (0.000222%)
GTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTA13 (0.000722%)
GTTTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCG90 (0.005000%)
GTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGA19 (0.001056%)
GTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAA72 (0.004000%)
GTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCT22 (0.001222%)
GTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGATCAATGTGTTCTC18 (0.001000%)
GTTTTCATTTTTAAAGGAAATCAGTTCTGGGCTATACGAGGGCACGAGGAGCTAGCAGGTTATCCTAAAAGCATTCACACCCTGGGTCTCCCTGCAACCG6 (0.000333%)
TAAAAATGAAAACAGTGTCTCTGTTAGTAACCTCATATGCAGCATCCATGTTGGATGGAAGAGATGGCCAAAATGAAGAGATCAAATAAAATTCAGGCTC6 (0.000333%)
TAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCAC3 (0.000167%)
TAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGATC4 (0.000222%)
TACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGC5 (0.000278%)
TAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGA6 (0.000333%)
TAGATTTCCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGT16 (0.000889%)
TAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTC18 (0.001000%)
TAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGT11 (0.000611%)
TAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGC4 (0.000222%)
TATAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGA3 (0.000167%)
TATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACA5 (0.000278%)
TATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTG9 (0.000500%)
TATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCG5 (0.000278%)
TATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTG5 (0.000278%)
TCAAAACCGAGATCTGTCCCAGTATATTCGGAACTGCGGAGTCTGACCGCGGTGTGCTTCTACTGCAGCTCATTCGGTCTCTTTCTCACTGTAGGAGTAG19 (0.001056%)
TCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTCAACACCTGGAAAGTCCTCAGCTA4 (0.000222%)
TCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGC12 (0.000667%)
TCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCT3 (0.000167%)
TCACTGCCACCCAGAAGACTGTGGATGGCCCCTCTGGAAAGCTGTGGCGTGATGGCCGTGGGGCTGCCCAGAACATCATCCCTGCATCCACTGGTGCTGC3 (0.000167%)
TCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGC5 (0.000278%)
TCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAA158 (0.008778%)
TCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATA3 (0.000167%)
TCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGA11 (0.000611%)
TCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGC9 (0.000500%)
TCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACAT9 (0.000500%)
TCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACA7 (0.000389%)
TCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTG3 (0.000167%)
TCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCA107 (0.005944%)
TCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCCGCAGCA8 (0.000444%)
TCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGC14 (0.000778%)
TCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCA6 (0.000333%)
TCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCATGAGCCAAGACTGTTCCAGGCCCATCAAAAGGGACAAA8 (0.000444%)
TCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCC9 (0.000500%)
TCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGC5 (0.000278%)
TCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAAT14 (0.000778%)
TCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGG23 (0.001278%)
TCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCCGCAGCATCTAGCTGAAGCTG3 (0.000167%)
TCCGGCTAGAGGTGGGTAGACTGTTCATCCTGTTCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAA22 (0.001222%)
TCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATAC8 (0.000444%)
TCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCAT5 (0.000278%)
TCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAA4 (0.000222%)
TCCTGCTCCTGCTTCTACTATTGATGATGCTAGGAGAAGGAGAAATGATGGTGGTAGGAGTCAAAAACTTATATTATTTATTCGTGGGAATGCTATATCT5 (0.000278%)
TCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCG28 (0.001556%)
TCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCA32 (0.001778%)
TCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCT7 (0.000389%)
TCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCA11 (0.000611%)
TCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGG404 (0.022444%)
TCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAG22 (0.001222%)
TCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAG19 (0.001056%)
TCGGATGCTGGGATGGGGATGGGGGTGGGAGGTATGGCAGGCAGAGCCACAACAGCAGGCACTACAAACCGCACTAGTCTAGGGAGAGGCTAGGATGCAG4 (0.000222%)
TCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGAT78 (0.004333%)
TCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCC16 (0.000889%)
TCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAAC4 (0.000222%)
TCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAG53 (0.002944%)
TCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGT28 (0.001556%)
TCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTT5 (0.000278%)
TCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTT45 (0.002500%)
TCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAA9 (0.000500%)
TCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTC9 (0.000500%)
TCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCT4 (0.000222%)
TCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGT4 (0.000222%)
TCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTC3 (0.000167%)
TCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCATGAGCCAAGACTGTTCCAGGCCCATCAAAAGGGA11 (0.000611%)
TCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAG7 (0.000389%)
TCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTC5 (0.000278%)
TCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCA7 (0.000389%)
TCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAA15 (0.000833%)
TCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATT5 (0.000278%)
TCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTA57 (0.003167%)
TCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTA10 (0.000556%)
TGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGA573 (0.031832%)
TGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACC6 (0.000333%)
TGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGT29 (0.001611%)
TGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGC6 (0.000333%)
TGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAA10 (0.000556%)
TGAAGACCCTGACAGGCAAGACCATCACCCTGGAGGTCGAGCCCAGTGACACCATAGAGAATGTCAAGGCAAAGATCCAGGACAAGGAGGGCATCCCCCC54 (0.003000%)
TGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGA12 (0.000667%)
TGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGC29 (0.001611%)
TGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCT5 (0.000278%)
TGAAGGTCGGTGTGAACGGATTTGGCCGTATTGGGCGCCTGGTCACCAGGGCTGCCATTTGCAGTGGCAAAGTGGAGATTGTTGCCATCAACGACCCCTT5 (0.000278%)
TGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATG17 (0.000944%)
TGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAAC9 (0.000500%)
TGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAG4 (0.000222%)
TGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCA6 (0.000333%)
TGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAG8 (0.000444%)
TGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACT17 (0.000944%)
TGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCAT8 (0.000444%)
TGAGCAGGAAGCTTCAGGGACAATGGTTTCCCTTTTCTCATCAAAGCAGGGAGTTCATAAAGAAAATCCGTGGGTGGAGAGAATCAGCCCTTTCTTCTTA3 (0.000167%)
TGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCC19 (0.001056%)
TGAGCCTGGGCTGGCATATAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGT6 (0.000333%)
TGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATG9 (0.000500%)
TGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGG3 (0.000167%)
TGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCA9 (0.000500%)
TGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGAT10 (0.000556%)
TGATCCCACAGGCATTCACAGCTCTTGGGGTTTTGCCATCATTACACCAGTATCGGCTATTGATCTGAAATATCCCATAGTCAGTGCTTTGGTCTCCACG89 (0.004944%)
TGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGC35 (0.001944%)
TGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGAC20 (0.001111%)
TGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTT4 (0.000222%)
TGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGT36 (0.002000%)
TGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTA15 (0.000833%)
TGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCA372 (0.020666%)
TGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAAT57 (0.003167%)
TGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGT5 (0.000278%)
TGCATCTCTGGCATCTGGCATCCTCTTGTTGCTATCACTGATAGCTTCCAGTAAGGCCTGTAGCTGTGCCCCACCCCACCCACAGACAGCCTTCTGCAAC4 (0.000222%)
TGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGA8 (0.000444%)
TGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATT10 (0.000556%)
TGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGAT4 (0.000222%)
TGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAA3 (0.000167%)
TGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCC3 (0.000167%)
TGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCA15 (0.000833%)
TGCCGCCGTGGGTGCCGTGGAGGCCTCCTTCAAGTGCTGCAGTGGGGCCATTATCGTGCTCACCAAGTCTGGCAGGAGTGCTCACCAAGTGGCCAGGTAC15 (0.000833%)
TGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTT6 (0.000333%)
TGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTC3 (0.000167%)
TGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGT8 (0.000444%)
TGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCC8 (0.000444%)
TGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAA4 (0.000222%)
TGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTC4 (0.000222%)
TGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTT15 (0.000833%)
TGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAG3 (0.000167%)
TGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTG10 (0.000556%)
TGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGA5 (0.000278%)
TGGAGAACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTG8 (0.000444%)
TGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCAT6 (0.000333%)
TGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGAT75 (0.004167%)
TGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCA3 (0.000167%)
TGGCATCTGGCATCCTCTTGTTGCTATCACTGATAGCTTCCAGTAAGGCCTGTAGCTGTGCCCCACCCCACCCACAGACAGCCTTCTGCAACTCGGACCT3 (0.000167%)
TGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTCAACACCTGGAAA18 (0.001000%)
TGGCCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTG4 (0.000222%)
TGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATG10 (0.000556%)
TGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTC566 (0.031444%)
TGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGT272 (0.015111%)
TGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACT4 (0.000222%)
TGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGT29 (0.001611%)
TGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGC11 (0.000611%)
TGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGT23 (0.001278%)
TGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGT19 (0.001056%)
TGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGA7 (0.000389%)
TGTCAAAACCGAGATCTGTCCCAGTATATTCGGAACTGCGGAGTCTGACCGCGGTGTGCTTCTACTGCAGCTCATTCGGTCTCTTTCTCACTGTAGGAGT4 (0.000222%)
TGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACT8 (0.000444%)
TGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCATGAGCCAAGACTGTTCCAGGCCCATCAAAAGGGACA7 (0.000389%)
TGTGAGATGAGCAGGAAGCTTCAGGGACAATGGTTTCCCTTTTCTCATCAAAGCAGGGAGTTCATAAAGAAAATCCGTGGGTGGAGAGAATCAGCCCTTT6 (0.000333%)
TGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGA6 (0.000333%)
TGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGG5 (0.000278%)
TGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTG3 (0.000167%)
TGTTAGTAACCTCATATGCAGCATCCATGTTGGATGGAAGAGATGGCCAAAATGAAGAGATCAAATAAAATTCAGGCTCAGGAGTCCTGAGAGATTTGCG4 (0.000222%)
TTAAAAATGAAAACAGTGTCTCTGTTAGTAACCTCATATGCAGCATCCATGTTGGATGGAAGAGATGGCCAAAATGAAGAGATCAAATAAAATTCAGGCT9 (0.000500%)
TTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTG4 (0.000222%)
TTACGTCTGAGCCTGGGCTGGCATATAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTC7 (0.000389%)
TTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGT6 (0.000333%)
TTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAG6 (0.000333%)
TTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTT5 (0.000278%)
TTCAAAGTTCTTTTCAACTTTCCCTTACGGTACTTGTTGACTATCGGTCTCGTGCCGGTATTTAGCCTTAGATGGAGTTTACCACCCGCTTTGGGCTGCA4 (0.000222%)
TTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAG33 (0.001833%)
TTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCC6 (0.000333%)
TTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAAT3 (0.000167%)
TTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCG52 (0.002889%)
TTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACAT40 (0.002222%)
TTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAG5 (0.000278%)
TTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGT36 (0.002000%)
TTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTCAACACCTGGAAAGTCCTCAGCTATCTTC3 (0.000167%)
TTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAA96 (0.005333%)
TTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGG6 (0.000333%)
TTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATA21 (0.001167%)
TTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCC11 (0.000611%)
TTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCT3 (0.000167%)
TTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGC34 (0.001889%)
TTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACC5 (0.000278%)
TTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACA24 (0.001333%)
TTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATT48 (0.002667%)
TTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAA6 (0.000333%)
TTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCT269 (0.014944%)
TTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTC35 (0.001944%)
TTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCT5 (0.000278%)
TTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGT4 (0.000222%)
TTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCG20 (0.001111%)
TTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAA5 (0.000278%)
TTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAA6 (0.000333%)
TTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGC18 (0.001000%)
TTGCATCTCTGGCATCTGGCATCCTCTTGTTGCTATCACTGATAGCTTCCAGTAAGGCCTGTAGCTGTGCCCCACCCCACCCACAGACAGCCTTCTGCAA4 (0.000222%)
TTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGA17 (0.000944%)
TTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGC6 (0.000333%)
TTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGA28 (0.001556%)
TTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTCAACACCTGGAA7 (0.000389%)
TTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAG4 (0.000222%)
TTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGG8 (0.000444%)
TTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCAC9 (0.000500%)
TTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAG11 (0.000611%)
TTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATG18 (0.001000%)
TTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCC4 (0.000222%)
TTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATT91 (0.005055%)
TTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAA10 (0.000556%)
TTTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGC7 (0.000389%)
TTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAAC5 (0.000278%)
TTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGAC10 (0.000556%)
TTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAG19 (0.001056%)
TTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTT10 (0.000556%)
TTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGA11 (0.000611%)
TTTGCATCTCTGGCATCTGGCATCCTCTTGTTGCTATCACTGATAGCTTCCAGTAAGGCCTGTAGCTGTGCCCCACCCCACCCACAGACAGCCTTCTGCA11 (0.000611%)
TTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACAT31 (0.001722%)
TTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGG14 (0.000778%)
TTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTCAACACCTGGA7 (0.000389%)
TTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCC10 (0.000556%)
TTTTCATTTTTAAAGGAAATCAGTTCTGGGCTATACGAGGGCACGAGGAGCTAGCAGGTTATCCTAAAAGCATTCACACCCTGGGTCTCCCTGCAACCGT3 (0.000167%)
TTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAG71 (0.003944%)
TTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTCAACACCTGG8 (0.000444%)
TTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTCAACACCTG67 (0.003722%)
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT731 (0.016244%)
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT97 (0.005389%)
Value of each position will be shown on mouse over.
Value of each position will be shown on mouse over.
Darker background means larger counts. The count will be shown on mouse over.
AAATACAGTATTTCTGCACTCCCGGAGTGCGG
AAAAAAAAAAAATAAAACAAAAGAAATAAAATTAAATCAAATGAAACAAAACTAAACCAAACGAAAGAAAAGTAAAGCAAAGG
AATAATAAAATATAATACAATAGAATTAAATTTAATTCAATTGAATCAAATCTAATCCAATCGAATGAAATGTAATGCAATGG
AACAACAAAACATAACACAACAGAACTAAACTTAACTCAACTGAACCAAACCTAACCCAACCGAACGAAACGTAACGCAACGG
AAGAAGAAAAGATAAGACAAGAGAAGTAAAGTTAAGTCAAGTGAAGCAAAGCTAAGCCAAGCGAAGGAAAGGTAAGGCAAGGG
ATAATAAAATAATATAACATAAGATATAATATTATATCATATGATACAATACTATACCATACGATAGAATAGTATAGCATAGG
ATTATTAAATTATATTACATTAGATTTAATTTTATTTCATTTGATTCAATTCTATTCCATTCGATTGAATTGTATTGCATTGG
ATCATCAAATCATATCACATCAGATCTAATCTTATCTCATCTGATCCAATCCTATCCCATCCGATCGAATCGTATCGCATCGG
ATGATGAAATGATATGACATGAGATGTAATGTTATGTCATGTGATGCAATGCTATGCCATGCGATGGAATGGTATGGCATGGG
ACAACAAAACAATACAACACAAGACATAACATTACATCACATGACACAACACTACACCACACGACAGAACAGTACAGCACAGG
ACTACTAAACTATACTACACTAGACTTAACTTTACTTCACTTGACTCAACTCTACTCCACTCGACTGAACTGTACTGCACTGG
ACCACCAAACCATACCACACCAGACCTAACCTTACCTCACCTGACCCAACCCTACCCCACCCGACCGAACCGTACCGCACCGG
ACGACGAAACGATACGACACGAGACGTAACGTTACGTCACGTGACGCAACGCTACGCCACGCGACGGAACGGTACGGCACGGG
AGAAGAAAAGAATAGAACAGAAGAGATAAGATTAGATCAGATGAGACAAGACTAGACCAGACGAGAGAAGAGTAGAGCAGAGG
AGTAGTAAAGTATAGTAC