fastp report
General
fastp version:0.23.1 (https://github.com/OpenGene/fastp)
sequencing:paired end (150 cycles + 150 cycles)
mean length before filtering:150bp, 150bp
mean length after filtering:143bp, 142bp
duplication rate:18.556495%
Insert size peak:263
Before filtering
total reads:41.950854 M
total bases:6.292628 G
Q20 bases:6.108669 G (97.076586%)
Q30 bases:5.825622 G (92.578518%)
GC content:50.786852%
After filtering
total reads:41.624738 M
total bases:5.953089 G
Q20 bases:5.813704 G (97.658611%)
Q30 bases:5.556415 G (93.336663%)
GC content:50.658398%
Filtering result
reads passed filters:41.624738 M (99.222624%)
reads with low quality:299.024000 K (0.712796%)
reads with too many N:11.252000 K (0.026822%)
reads too short:15.840000 K (0.037758%)
Adapter or bad ligation of read1
SequenceOccurrences
A21967
AG22706
AGA24053
AGAT21990
AGATC21525
AGATCG23620
AGATCGG21957
AGATCGGA20263
AGATCGGAA20184
AGATCGGAAG20335
AGATCGGAAGA19501
AGATCGGAAGAG20124
AGATCGGAAGAGC19974
AGATCGGAAGAGCA20270
AGATCGGAAGAGCAC22739
AGATCGGAAGAGCACA22408
AGATCGGAAGAGCACAC18959
AGATCGGAAGAGCACACG18020
AGATCGGAAGAGCACACGT17381
AGATCGGAAGAGCACACGTC17211
AGATCGGAAGAGCACACGTCT19494
AGATCGGAAGAGCACACGTCTG18253
AGATCGGAAGAGCACACGTCTGA18462
AGATCGGAAGAGCACACGTCTGAA16954
AGATCGGAAGAGCACACGTCTGAAC17240
AGATCGGAAGAGCACACGTCTGAACT16225
AGATCGGAAGAGCACACGTCTGAACTC17177
AGATCGGAAGAGCACACGTCTGAACTCC16638
AGATCGGAAGAGCACACGTCTGAACTCCA15403
AGATCGGAAGAGCACACGTCTGAACTCCAG14669
AGATCGGAAGAGCACACGTCTGAACTCCAGT14800
AGATCGGAAGAGCACACGTCTGAACTCCAGTC16396
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA15467
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC15317
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACG15129
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGC18831
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCG14739
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGA14473
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAA11677
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAATG15332
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAATGA32183
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAATGAC21098
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAATGACA14382
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAATGACAA74635
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAATGACAAT12700
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAATGACAATCT38322
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAATGACAATCTC30728
other adapter sequences186135
Adapter or bad ligation of read2
SequenceOccurrences
A23246
AG23940
AGA24740
AGAT22295
AGATC23206
AGATCG30972
AGATCGG21140
AGATCGGA20265
AGATCGGAA17300
AGATCGGAAG18206
AGATCGGAAGA16793
AGATCGGAAGAG24326
AGATCGGAAGAGC19525
AGATCGGAAGAGCG19615
AGATCGGAAGAGCGT30277
AGATCGGAAGAGCGTC17983
AGATCGGAAGAGCGTCG26912
AGATCGGAAGAGCGTCGT19045
AGATCGGAAGAGCGTCGTG15514
AGATCGGAAGAGCGTCGTGTAG17798
AGATCGGAAGAGCGTCGTGTAGG27752
AGATCGGAAGAGCGTCGTGTAGGG20924
AGATCGGAAGAGCGTCGTGTAGGGA15229
AGATCGGAAGAGCGTCGTGTAGGGAAAG12929
AGATCGGAAGAGCGTCGTGTAGGGAAAGAG16000
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG15811
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTG13423
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTT14509
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTTG13702
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTTGGC13374
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTTGGCAGTTGTG12444
other adapter sequences551528
This estimation is based on paired-end overlap analysis, and there are 60.544963% reads found not overlapped.
The nonoverlapped read pairs may have insert size <30 or >270, or contain too much sequencing errors to be detected as overlapped.
Value of each position will be shown on mouse over.
Value of each position will be shown on mouse over.
Darker background means larger counts. The count will be shown on mouse over.
AAATACAGTATTTCTGCACTCCCGGAGTGCGG
AAAAAAAAAAAATAAAACAAAAGAAATAAAATTAAATCAAATGAAACAAAACTAAACCAAACGAAAGAAAAGTAAAGCAAAGG
AATAATAAAATATAATACAATAGAATTAAATTTAATTCAATTGAATCAAATCTAATCCAATCGAATGAAATGTAATGCAATGG
AACAACAAAACATAACACAACAGAACTAAACTTAACTCAACTGAACCAAACCTAACCCAACCGAACGAAACGTAACGCAACGG
AAGAAGAAAAGATAAGACAAGAGAAGTAAAGTTAAGTCAAGTGAAGCAAAGCTAAGCCAAGCGAAGGAAAGGTAAGGCAAGGG
ATAATAAAATAATATAACATAAGATATAATATTATATCATATGATACAATACTATACCATACGATAGAATAGTATAGCATAGG
ATTATTAAATTATATTACATTAGATTTAATTTTATTTCATTTGATTCAATTCTATTCCATTCGATTGAATTGTATTGCATTGG
ATCATCAAATCATATCACATCAGATCTAATCTTATCTCATCTGATCCAATCCTATCCCATCCGATCGAATCGTATCGCATCGG
ATGATGAAATGATATGACATGAGATGTAATGTTATGTCATGTGATGCAATGCTATGCCATGCGATGGAATGGTATGGCATGGG
ACAACAAAACAATACAACACAAGACATAACATTACATCACATGACACAACACTACACCACACGACAGAACAGTACAGCACAGG
ACTACTAAACTATACTACACTAGACTTAACTTTACTTCACTTGACTCAACTCTACTCCACTCGACTGAACTGTACTGCACTGG
ACCACCAAACCATACCACACCAGACCTAACCTTACCTCACCTGACCCAACCCTACCCCACCCGACCGAACCGTACCGCACCGG
ACGACGAAACGATACGACACGAGACGTAACGTTACGTCACGTGACGCAACGCTACGCCACGCGACGGAACGGTACGGCACGGG
AGAAGAAAAGAATAGAACAGAAGAGATAAGATTAGATCAGATGAGACAAGACTAGACCAGACGAGAGAAGAGTAGAGCAGAGG
AGTAGTAAAGTATAGTACAGTAGAGTTAAGTTTAGTTCAGTTGAGTCAAGTCTAGTCCAGTCGAGTGAAGTGTAGTGCAGTGG
AGCAGCAAAGCATAGCACAGCAGAGCTAAGCTTAGCTCAGCTGAGCCAAGCCTAGCCCAGCCGAGCGAAGCGTAGCGCAGCGG
AGGAGGAAAGGATAGGACAGGAGAGGTAAGGTTAGGTCAGGTGAGGCAAGGCTAGGCCAGGCGAGGGAAGGGTAGGGCAGGGG
TAATAAAATAAATTAAACTAAAGTAATATAATTTAATCTAATGTAACATAACTTAACCTAACGTAAGATAAGTTAAGCTAAGG
TATTATAATATATTATACTATAGTATTATATTTTATTCTATTGTATCATATCTTATCCTATCGTATGATATGTTATGCTATGG
TACTACAATACATTACACTACAGTACTATACTTTACTCTACTGTACCATACCTTACCCTACCGTACGATACGTTACGCTACGG
TAGTAGAATAGATTAGACTAGAGTAGTATAGTTTAGTCTAGTGTAGCATAGCTTAGCCTAGCGTAGGATAGGTTAGGCTAGGG
TTATTAAATTAATTTAACTTAAGTTATATTATTTTATCTTATGTTACATTACTTTACCTTACGTTAGATTAGTTTAGCTTAGG
TTTTTTAATTTATTTTACTTTAGTTTTATTTTTTTTTCTTTTGTTTCATTTCTTTTCCTTTCGTTTGATTTGTTTTGCTTTGG
TTCTTCAATTCATTTCACTTCAGTTCTATTCTTTTCTCTTCTGTTCCATTCCTTTCCCTTCCGTTCGATTCGTTTCGCTTCGG
TTGTTGAATTGATTTGACTTGAGTTGTATTGTTTTGTCTTGTGTTGCATTGCTTTGCCTTGCGTTGGATTGGTTTGGCTTGGG
TCATCAAATCAATTCAACTCAAGTCATATCATTTCATCTCATGTCACATCACTTCACCTCACGTCAGATCAGTTCAGCTCAGG
TCTTCTAATCTATTCTACTCTAGTCTTATCTTTTCTTCTCTTGTCTCATCTCTTCTCCTCTCGTCTGATCTGTTCTGCTCTGG
TCCTCCAATCCATTCCACTCCAGTCCTATCCTTTCCTCTCCTGTCCCATCCCTTCCCCTCCCGTCCGATCCGTTCCGCTCCGG
TCGTCGAATCGATTCGACTCGAGTCGTATCGTTTCGTCTCGTGTCGCATCGCTTCGCCTCGCGTCGGATCGGTTCGGCTCGGG
TGATGAAATGAATTGAACTGAAGTGATATGATTTGATCTGATGTGACATGACTTGACCTGACGTGAGATGAGTTGAGCTGAGG
TGTTGTAATGTATTGTACTGTAGTGTTATGTTTTGTTCTGTTGTGTCATGTCTTGTCCTGTCGTGTGATGTGTTGTGCTGTGG
TGCTGCAATGCATTGCACTGCAGTGCTATGCTTTGCTCTGCTGTGCCATGCCTTGCCCTGCCGTGCGATGCGTTGCGCTGCGG
TGGTGGAATGGATTGGACTGGAGTGGTATGGTTTGGTCTGGTGTGGCATGGCTTGGCCTGGCGTGGGATGGGTTGGGCTGGGG
CAACAAAACAAATCAAACCAAAGCAATACAATTCAATCCAATGCAACACAACTCAACCCAACGCAAGACAAGTCAAGCCAAGG
CATCATAACATATCATACCATAGCATTACATTTCATTCCATTGCATCACATCTCATCCCATCGCATGACATGTCATGCCATGG
CACCACAACACATCACACCACAGCACTACACTTCACTCCACTGCACCACACCTCACCCCACCGCACGACACGTCACGCCACGG
CAGCAGAACAGATCAGACCAGAGCAGTACAGTTCAGTCCAGTGCAGCACAGCTCAGCCCAGCGCAGGACAGGTCAGGCCAGGG
CTACTAAACTAATCTAACCTAAGCTATACTATTCTATCCTATGCTACACTACTCTACCCTACGCTAGACTAGTCTAGCCTAGG
CTTCTTAACTTATCTTACCTTAGCTTTACTTTTCTTTCCTTTGCTTCACTTCTCTTCCCTTCGCTTGACTTGTCTTGCCTTGG
CTCCTCAACTCATCTCACCTCAGCTCTACTCTTCTCTCCTCTGCTCCACTCCTCTCCCCTCCGCTCGACTCGTCTCGCCTCGG
CTGCTGAACTGATCTGACCTGAGCTGTACTGTTCTGTCCTGTGCTGCACTGCTCTGCCCTGCGCTGGACTGGTCTGGCCTGGG
CCACCAAACCAATCCAACCCAAGCCATACCATTCCATCCCATGCCACACCACTCCACCCCACGCCAGACCAGTCCAGCCCAGG
CCTCCTAACCTATCCTACCCTAGCCTTACCTTTCCTTCCCTTGCCTCACCTCTCCTCCCCTCGCCTGACCTGTCCTGCCCTGG
CCCCCCAACCCATCCCACCCCAGCCCTACCCTTCCCTCCCCTGCCCCACCCCTCCCCCCCCCGCCCGACCCGTCCCGCCCCGG
CCGCCGAACCGATCCGACCCGAGCCGTACCGTTCCGTCCCGTGCCGCACCGCTCCGCCCCGCGCCGGACCGGTCCGGCCCGGG
CGACGAAACGAATCGAACCGAAGCGATACGATTCGATCCGATGCGACACGACTCGACCCGACGCGAGACGAGTCGAGCCGAGG
CGTCGTAACGTATCGTACCGTAGCGTTACGTTTCGTTCCGTTGCGTCACGTCTCGTCCCGTCGCGTGACGTGTCGTGCCGTGG
CGCCGCAACGCATCGCACCGCAGCGCTACGCTTCGCTCCGCTGCGCCACGCCTCGCCCCGCCGCGCGACGCGTCGCGCCGCGG
CGGCGGAACGGATCGGACCGGAGCGGTACGGTTCGGTCCGGTGCGGCACGGCTCGGCCCGGCGCGGGACGGGTCGGGCCGGGG
GAAGAAAAGAAATGAAACGAAAGGAATAGAATTGAATCGAATGGAACAGAACTGAACCGAACGGAAGAGAAGTGAAGCGAAGG
GATGATAAGATATGATACGATAGGATTAGATTTGATTCGATTGGATCAGATCTGATCCGATCGGATGAGATGTGATGCGATGG
GACGACAAGACATGACACGACAGGACTAGACTTGACTCGACTGGACCAGACCTGACCCGACCGGACGAGACGTGACGCGACGG
GAGGAGAAGAGATGAGACGAGAGGAGTAGAGTTGAGTCGAGTGGAGCAGAGCTGAGCCGAGCGGAGGAGAGGTGAGGCGAGGG
GTAGTAAAGTAATGTAACGTAAGGTATAGTATTGTATCGTATGGTACAGTACTGTACCGTACGGTAGAGTAGTGTAGCGTAGG
GTTGTTAAGTTATGTTACGTTAGGTTTAGTTTTGTTTCGTTTGGTTCAGTTCTGTTCCGTTCGGTTGAGTTGTGTTGCGTTGG
GTCGTCAAGTCATGTCACGTCAGGTCTAGTCTTGTCTCGTCTGGTCCAGTCCTGTCCCGTCCGGTCGAGTCGTGTCGCGTCGG
GTGGTGAAGTGATGTGACGTGAGGTGTAGTGTTGTGTCGTGTGGTGCAGTGCTGTGCCGTGCGGTGGAGTGGTGTGGCGTGGG
GCAGCAAAGCAATGCAACGCAAGGCATAGCATTGCATCGCATGGCACAGCACTGCACCGCACGGCAGAGCAGTGCAGCGCAGG
GCTGCTAAGCTATGCTACGCTAGGCTTAGCTTTGCTTCGCTTGGCTCAGCTCTGCTCCGCTCGGCTGAGCTGTGCTGCGCTGG
GCCGCCAAGCCATGCCACGCCAGGCCTAGCCTTGCCTCGCCTGGCCCAGCCCTGCCCCGCCCGGCCGAGCCGTGCCGCGCCGG
GCGGCGAAGCGATGCGACGCGAGGCGTAGCGTTGCGTCGCGTGGCGCAGCGCTGCGCCGCGCGGCGGAGCGGTGCGGCGCGGG
GGAGGAAAGGAATGGAACGGAAGGGATAGGATTGGATCGGATGGGACAGGACTGGACCGGACGGGAGAGGAGTGGAGCGGAGG
GGTGGTAAGGTATGGTACGGTAGGGTTAGGTTTGGTTCGGTTGGGTCAGGTCTGGTCCGGTCGGGTGAGGTGTGGTGCGGTGG
GGCGGCAAGGCATGGCACGGCAGGGCTAGGCTTGGCTCGGCTGGGCCAGGCCTGGCCCGGCCGGGCGAGGCGTGGCGCGGCGG
GGGGGGAAGGGATGGGACGGGAGGGGTAGGGTTGGGTCGGGTGGGGCAGGGCTGGGCCGGGCGGGGGAGGGGTGGGGCGGGGG
Sampling rate: 1 / 20
overrepresented sequencecount (% of bases)distribution: cycle 1 ~ cycle 150
AAAACAAGATGAACACATGGATGTGGTTTTTGTTTTGCTGGGGTTTCAGAGAGTTTGGCTTATAAAAAGCAAACAGGGCCAATGTCCACACCAAATTCTT40 (0.002543%)
AAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGA22 (0.001398%)
AAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGC17 (0.001081%)
AAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTG7 (0.000445%)
AAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGA7 (0.000445%)
AAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAA11 (0.000699%)
AAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTA5 (0.000318%)
AAAGCAGGGAGTTCATAAAGAAAATCCGTGGGTGGAGAGAATCAGCCCTTTCTTCTTATCTTCACTGGGGTCAGAGTCCTCAGAAATCTTTCTATTGAAC4 (0.000254%)
AAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGG16 (0.001017%)
AAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCA43 (0.002733%)
AAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCA32 (0.002034%)
AAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGC13 (0.000826%)
AACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTG7 (0.000445%)
AACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTA6 (0.000381%)
AACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCT12 (0.000763%)
AACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGT4 (0.000254%)
AACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCG3 (0.000191%)
AACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGC3 (0.000191%)
AACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAAT3 (0.000191%)
AACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGC17 (0.001081%)
AAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGA10 (0.000636%)
AAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGAT5 (0.000318%)
AAGAGATCAAATAAAATTCAGGCTCAGGAGTCCTGAGAGATTTGCGCCAAAAGTGCCTGTCTTTAAAAAACAGGACTTCTCCCCGGAGGGTGCTGACTGC290 (0.018434%)
AAGAGCACACGTCTGAACTCCAGTCACGCGAATGACAATC7 (0.000178%)
AAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAAC8 (0.000509%)
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAA4064 (0.103334%)
AAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACA4 (0.000254%)
AAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGC4 (0.000254%)
AAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGC580 (0.036869%)
AAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGG5 (0.000318%)
AAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGC12 (0.000763%)
AAGTCCATGACCATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGC4 (0.000254%)
AAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCA5 (0.000318%)
AAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAG11 (0.000699%)
AAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAG4 (0.000254%)
AATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCAC4 (0.000254%)
AATAGTCACCTTCAGTTCAAGACATTTTGAAAGGTTAACAACCAATGATTCTTGACTTACACACTAAAGTATCACAATTTCCGATAGTGTGACAGATAGG3 (0.000191%)
AATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTC15 (0.000953%)
ACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGC6 (0.000381%)
ACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCT3 (0.000191%)
ACAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGA1525 (0.038776%)
ACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTG3 (0.000191%)
ACCAAGTCTAACTCTCTGGAACCTGAGACATCACCAATGTGCAGCTCTACTTTGTTCTTTGATGCAGTCAGCACCCTCCGGGGAGAAGTCCTGTTTTTTA12 (0.000763%)
ACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCA6 (0.000381%)
ACCGTAGGGCACTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCG3 (0.000191%)
ACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTA5 (0.000318%)
ACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCA455 (0.028923%)
ACGACGGACACATTGGGGGTAGGAACACGGAAGGCCATGCCAGTGAGCTTCCCGTTCAGCTCTGGGATGACCTTGCCCACAGCCTTGGCAGCACCAGTGG91 (0.005785%)
ACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAG8 (0.000509%)
ACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCT4 (0.000254%)
ACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCC14 (0.000890%)
ACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGACTGGTCC4 (0.000254%)
ACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGG5 (0.000318%)
ACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCT5 (0.000318%)
ACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCT4 (0.000254%)
AGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTC19 (0.001208%)
AGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGATCAATGTGTTCTCATCTTATAATTTTAGACATTTGATG6 (0.000381%)
AGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCT6 (0.000381%)
AGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCG4 (0.000254%)
AGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATG5 (0.000318%)
AGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGA2152 (0.054718%)
AGAGCACACGTCTGAACTCCAGTCACGCGAATGACAATCT7 (0.000178%)
AGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGT3 (0.000191%)
AGAGTCCCAGGGAGTGGCCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATC4 (0.000254%)
AGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACA3 (0.000191%)
AGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCGCAGTTGGAATT5 (0.000318%)
AGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAAT33 (0.002098%)
AGCACACGTCTGAACTCCAGTCACGCGAATGACAATCTCG6 (0.000153%)
AGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAAC3 (0.000191%)
AGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTC6 (0.000381%)
AGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCAT9 (0.000572%)
AGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCC4 (0.000254%)
AGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAG11 (0.000699%)
AGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCC3 (0.000191%)
AGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACC3 (0.000191%)
AGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAA3 (0.000191%)
AGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACC3 (0.000191%)
AGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATG13 (0.000826%)
AGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAAC6 (0.000381%)
AGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCT6 (0.000381%)
AGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAA8 (0.000509%)
AGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGT4 (0.000254%)
AGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTA4 (0.000254%)
AGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTA23 (0.001462%)
AGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCT4 (0.000254%)
AGGGCACTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCG7 (0.000445%)
AGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCA3 (0.000191%)
AGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCA7 (0.000445%)
AGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCC3 (0.000191%)
AGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGC6 (0.000381%)
AGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGA4 (0.000254%)
AGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTG4 (0.000254%)
AGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGC9 (0.000572%)
AGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAG3 (0.000191%)
AGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGT6 (0.000381%)
AGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAG7 (0.000445%)
ATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAA367 (0.023329%)
ATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTA4 (0.000254%)
ATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCA4 (0.000254%)
ATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGG23 (0.001462%)
ATATGAGGTTACTAACAGAGACACTGTTTTCATTTTTAAAGGAAATCAGTTCTGGGCTATACGAGGGCACGAGGAGCTAGCAGGTTATCCTAAAAGCATT9 (0.000572%)
ATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATAC5 (0.000318%)
ATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCA5 (0.000318%)
ATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGC3 (0.000191%)
ATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCT9 (0.000572%)
ATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGCAG19 (0.001208%)
ATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGAT383 (0.024346%)
ATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATC8 (0.000509%)
ATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACA11 (0.000699%)
ATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGG5 (0.000318%)
ATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACT5 (0.000318%)
ATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATG11 (0.000699%)
ATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCA9 (0.000572%)
ATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAATGA11 (0.000280%)
ATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAG3 (0.000191%)
ATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGA5 (0.000318%)
ATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCAT3 (0.000191%)
ATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAG14 (0.000890%)
ATGACTTCCACCGTAGGGCACTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAAC13 (0.000826%)
ATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAAC18 (0.001144%)
ATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCA6 (0.000381%)
ATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTT4 (0.000254%)
ATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGA9 (0.000572%)
ATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGA4 (0.000254%)
ATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACG9 (0.000572%)
ATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCA7 (0.000445%)
ATGTCCTCGTGGTACCCACCAAGTCTAACTCTCTGGAACCTGAGACATCACCAATGTGCAGCTCTACTTTGTTCTTTGATGCAGTCAGCACCCTCCGGGG194 (0.012332%)
ATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAAT6 (0.000381%)
ATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCA4 (0.000254%)
ATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAG18 (0.001144%)
ATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGT15 (0.000953%)
ATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTG9 (0.000572%)
ATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAG6 (0.000381%)
ATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAG6 (0.000381%)
ATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTA11 (0.000699%)
ATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCAC5 (0.000318%)
ATTTCCTCCATTTTGGCGAACCTGGGAAGGTACTGAAGCCACCAACATCAGGAACACCACACCTGGGCTTATGCATCAGCTCCATAGTGTTGGAGTCCAG431 (0.027397%)
ATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTT31 (0.001971%)
ATTTTGAAAGGTTAACAACCAATGATTCTTGACTTACACACTAAAGTATCACAATTTCCGATAGTGTGACAGATAGGAAAGAATAGGAAATATTTTTGCT3 (0.000191%)
ATTTTGGCGAACCTGGGAAGGTACTGAAGCCACCAACATCAGGAACACCACACCTGGGCTTATGCATCAGCTCCATAGTGTTGGAGTCCAGCTTCCCTGT26 (0.001653%)
CAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCG6 (0.000381%)
CAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGT38 (0.002416%)
CAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAG26 (0.001653%)
CAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCT4 (0.000254%)
CAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGC140 (0.008899%)
CAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATA10 (0.000636%)
CAACAGCATGCCCTCCCGCATCTGCGAGTTCTCCAGCATGATGAACAGCTTGTCCCACTCCGAGTGCTCCTGGCGGCAGTCGCATGGCGTGGGGTCCTCG3 (0.000191%)
CAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCG32 (0.002034%)
CAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTC9 (0.000572%)
CAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCATG3 (0.000191%)
CAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAA6 (0.000381%)
CAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCA24 (0.001526%)
CAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCG13 (0.000826%)
CAAGTCCATGACCATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGG5 (0.000318%)
CAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTT9 (0.000572%)
CAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCC6 (0.000381%)
CAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAG3 (0.000191%)
CAATAGTCACCTTCAGTTCAAGACATTTTGAAAGGTTAACAACCAATGATTCTTGACTTACACACTAAAGTATCACAATTTCCGATAGTGTGACAGATAG9 (0.000572%)
CAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTT6 (0.000381%)
CACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCAGGA4 (0.000254%)
CACAGCCCCGCCTCATGGAGCCTATCTATCTGGTGGAGATCCAGTGTCCTGAGCAAGTGGTGGGTGGCATCTACGGTGTCCTGAACAGGAAGCGTGGCCA3 (0.000191%)
CACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTG18 (0.001144%)
CACATAGGTGCTGGACTTGTCACTGTTGTACTTATGGTGGACCCAGCAGGCTATGTCAAGTATCTTGCAATGAATGGAGGGGACCCACAGGTTAGAGGAG84 (0.005340%)
CACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAA5 (0.000318%)
CACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATG3 (0.000191%)
CACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGG5 (0.000318%)
CACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATC5 (0.000318%)
CACCGTAGGGCACTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCC9 (0.000572%)
CACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTT7 (0.000445%)
CACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATC7 (0.000445%)
CACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAA19 (0.001208%)
CACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGACTGGTC4 (0.000254%)
CACGGCCCCCGCGATCGTTCTGAAACTCGAGGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGC6 (0.000381%)
CACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTG30 (0.001907%)
CACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGT48 (0.003051%)
CACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTA6 (0.000381%)
CACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTC3 (0.000191%)
CACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATC6 (0.000381%)
CAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGATCAATGTGTTCTCATCTTATAATTTTAGACATTTGAT35 (0.002225%)
CAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACC11 (0.000699%)
CAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCAT11 (0.000699%)
CAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGG6 (0.000381%)
CAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCG19 (0.001208%)
CAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCG3 (0.000191%)
CAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAA2601 (0.066135%)
CAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGC11 (0.000699%)
CAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGT3 (0.000191%)
CAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCA19 (0.001208%)
CAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATATCA3 (0.000191%)
CAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGA29 (0.001843%)
CAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTC18 (0.001144%)
CAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAA13 (0.000826%)
CAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTC74 (0.004704%)
CAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCGCAGTTG19 (0.001208%)
CAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTC43 (0.002733%)
CAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCATGAGCC6 (0.000381%)
CAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGG3 (0.000191%)
CAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCT20 (0.001271%)
CAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATC197 (0.012523%)
CAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAG6 (0.000381%)
CAGGGAGTGGCCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTA16 (0.001017%)
CAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGG28 (0.001780%)
CAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAA12 (0.000763%)
CAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTC7 (0.000445%)
CAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCG19 (0.001208%)
CAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCT9 (0.000572%)
CAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATA4 (0.000254%)
CATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGA8 (0.000509%)
CATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTC15 (0.000953%)
CATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCC6 (0.000381%)
CATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTC3 (0.000191%)
CATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCA5 (0.000318%)
CATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAA4 (0.000254%)
CATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAG4 (0.000254%)
CATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGATCAATGTGTTCTCATCTTATAATTTTAGACATT3 (0.000191%)
CATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGAC4 (0.000254%)
CATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCT3 (0.000191%)
CATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGA5 (0.000318%)
CATTTTGAAAGGTTAACAACCAATGATTCTTGACTTACACACTAAAGTATCACAATTTCCGATAGTGTGACAGATAGGAAAGAATAGGAAATATTTTTGC5 (0.000318%)
CCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATAT3 (0.000191%)
CCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGCAGCTTCAGC6 (0.000381%)
CCAAGTCCATGACCATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTG6 (0.000381%)
CCAAGTCTAACTCTCTGGAACCTGAGACATCACCAATGTGCAGCTCTACTTTGTTCTTTGATGCAGTCAGCACCCTCCGGGGAGAAGTCCTGTTTTTTAA3 (0.000191%)
CCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTC9 (0.000572%)
CCACCGTAGGGCACTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTC5 (0.000318%)
CCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACAT13 (0.000826%)
CCACTATGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAA63 (0.004005%)
CCACTGCCCGGAGACCCGACGGCGACGCAGCCTCGCAGCCGCGCACGCCCATTCTTCTGCTGCGTGACAACCGCACCGCCTCTACCCGTGCGAGGACGCC76 (0.004831%)
CCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGT3 (0.000191%)
CCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGAC8 (0.000509%)
CCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCA44 (0.002797%)
CCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGA1587 (0.040352%)
CCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCC46 (0.002924%)
CCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAA5 (0.000318%)
CCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGT16 (0.001017%)
CCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCGCAGTT3 (0.000191%)
CCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCATGAGC5 (0.000318%)
CCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTT55 (0.003496%)
CCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGC8 (0.000509%)
CCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATA5 (0.000318%)
CCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAAT4 (0.000254%)
CCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCG5 (0.000318%)
CCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTC60 (0.003814%)
CCCAGGGAGTGGCCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCAT4 (0.000254%)
CCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATT37 (0.002352%)
CCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGAT10 (0.000636%)
CCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCG13 (0.000826%)
CCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCT4 (0.000254%)
CCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGT14 (0.000890%)
CCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCA3 (0.000191%)
CCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTG5 (0.000318%)
CCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCC13 (0.000826%)
CCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATG3 (0.000191%)
CCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGA10 (0.000636%)
CCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGG7 (0.000445%)
CCCTTTTCTCATCAAAGCAGGGAGTTCATAAAGAAAATCCGTGGGTGGAGAGAATCAGCCCTTTCTTCTTATCTTCACTGGGGTCAGAGTCCTCAGAAAT6 (0.000381%)
CCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTT4 (0.000254%)
CCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCA23 (0.001462%)
CCGACGGCGACGCAGCCTCGCAGCCGCGCACGCCCATTCTTCTGCTGCGTGACAACCGCACCGCCTCTACCCGTGCGAGGACGCCAAGCCCGTCTGGGGT7 (0.000445%)
CCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGG92 (0.005848%)
CCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTA11 (0.000699%)
CCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCA5 (0.000318%)
CCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTA9 (0.000572%)
CCGCGATCGTTCTGAAACTCGAGGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCAT11 (0.000699%)
CCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAA29 (0.001843%)
CCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCT27 (0.001716%)
CCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAG7 (0.000445%)
CCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACC4 (0.000254%)
CCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCC10 (0.000636%)
CCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTAC203 (0.012904%)
CCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGA9 (0.000572%)
CCGTAGGGCACTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGT23 (0.001462%)
CCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAA13 (0.000826%)
CCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGATCAATGTGTTCTCATCTTATAATTTTAGACATTTGATGTCTTC4 (0.000254%)
CCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATA6 (0.000381%)
CCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTC6 (0.000381%)
CCTCCATTTTGGCGAACCTGGGAAGGTACTGAAGCCACCAACATCAGGAACACCACACCTGGGCTTATGCATCAGCTCCATAGTGTTGGAGTCCAGCTTC4 (0.000254%)
CCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGA4 (0.000254%)
CCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCAT17 (0.001081%)
CCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGG10 (0.000636%)
CCTCGTGGTACCCACCAAGTCTAACTCTCTGGAACCTGAGACATCACCAATGTGCAGCTCTACTTTGTTCTTTGATGCAGTCAGCACCCTCCGGGGAGAA4 (0.000254%)
CCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAG11 (0.000699%)
CCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAA12 (0.000763%)
CCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGC32 (0.002034%)
CCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGC5 (0.000318%)
CCTTGGCTGAGTGGTAGAGTCCCAGGGAGTGGCCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATC181 (0.011506%)
CCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGC11 (0.000699%)
CCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAAT6 (0.000381%)
CCTTTTCTCATCAAAGCAGGGAGTTCATAAAGAAAATCCGTGGGTGGAGAGAATCAGCCCTTTCTTCTTATCTTCACTGGGGTCAGAGTCCTCAGAAATC4 (0.000254%)
CGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCAC7 (0.000445%)
CGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCAC20 (0.001271%)
CGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGG13 (0.000826%)
CGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGA28 (0.001780%)
CGATCGTTCTGAAACTCGAGGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCC3 (0.000191%)
CGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTG48 (0.003051%)
CGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTG67 (0.004259%)
CGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAA49 (0.003115%)
CGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAG37 (0.002352%)
CGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAG4 (0.000254%)
CGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGT11 (0.000699%)
CGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTAT6 (0.000381%)
CGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCT12 (0.000763%)
CGCGATCGTTCTGAAACTCGAGGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATC8 (0.000509%)
CGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAAC27 (0.001716%)
CGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTG17 (0.001081%)
CGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGG4 (0.000254%)
CGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTC15 (0.000953%)
CGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTC3 (0.000191%)
CGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCT31 (0.001971%)
CGGAAGAGCACACGTCTGAACTCCAGTCACGCGAATGACA10 (0.000254%)
CGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCAGGAAGTACATTTGCATTGTTT3 (0.000191%)
CGGACACATTGGGGGTAGGAACACGGAAGGCCATGCCAGTGAGCTTCCCGTTCAGCTCTGGGATGACCTTGCCCACAGCCTTGGCAGCACCAGTGGATGC4 (0.000254%)
CGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAA13 (0.000826%)
CGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGACTGGTCCT7 (0.000445%)
CGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATA77 (0.004895%)
CGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCA72 (0.004577%)
CGGCGACGCAGCCTCGCAGCCGCGCACGCCCATTCTTCTGCTGCGTGACAACCGCACCGCCTCTACCCGTGCGAGGACGCCAAGCCCGTCTGGGGTCGCC6 (0.000381%)
CGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTG10 (0.000636%)
CGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCAC18 (0.001144%)
CGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGT21 (0.001335%)
CGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCT3 (0.000191%)
CGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACCT4 (0.000254%)
CGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGT4 (0.000254%)
CGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCG32 (0.002034%)
CGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGGGT3 (0.000191%)
CGGTTTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTC53 (0.003369%)
CGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGT7 (0.000445%)
CGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAA4 (0.000254%)
CGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGC22 (0.001398%)
CGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTT5 (0.000318%)
CGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAAT19 (0.001208%)
CGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGA6 (0.000381%)
CTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACT6 (0.000381%)
CTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGAT3 (0.000191%)
CTCACTTCTGCTTAGAGAAATACTCTTTGCTCTTATTGACATCAGGCTTGATGGTATCACTGCCAGGTTTCCAGCCAGCTGGACACACTTCACCATGTTTGTCAGTGAACTGGAAGGCCTGGACTAGTCGTATAATCTCATCCACAGA21 (0.001976%)
CTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTCA6 (0.000381%)
CTCATCAAAGCAGGGAGTTCATAAAGAAAATCCGTGGGTGGAGAGAATCAGCCCTTTCTTCTTATCTTCACTGGGGTCAGAGTCCTCAGAAATCTTTCTA3 (0.000191%)
CTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGT15 (0.000953%)
CTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATAC5 (0.000318%)
CTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGCAGCTTCA3 (0.000191%)
CTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCG37 (0.002352%)
CTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATC101 (0.006420%)
CTCCATTTTGGCGAACCTGGGAAGGTACTGAAGCCACCAACATCAGGAACACCACACCTGGGCTTATGCATCAGCTCCATAGTGTTGGAGTCCAGCTTCC7 (0.000445%)
CTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAG24 (0.001526%)
CTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCT10 (0.000636%)
CTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGAC20 (0.001271%)
CTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAG379 (0.024092%)
CTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCA43 (0.002733%)
CTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATC32 (0.002034%)
CTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATA15 (0.000953%)
CTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCC72 (0.004577%)
CTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGC27 (0.001716%)
CTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGA16 (0.001017%)
CTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATC11 (0.000699%)
CTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGA121 (0.007692%)
CTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTT56 (0.003560%)
CTCGTGGTACCCACCAAGTCTAACTCTCTGGAACCTGAGACATCACCAATGTGCAGCTCTACTTTGTTCTTTGATGCAGTCAGCACCCTCCGGGGAGAAG16 (0.001017%)
CTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCA13 (0.000826%)
CTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGG5 (0.000318%)
CTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCA300 (0.019070%)
CTCTCTGGAACCTGAGACATCACCAATGTGCAGCTCTACTTTGTTCTTTGATGCAGTCAGCACCCTCCGGGGAGAAGTCCTGTTTTTTAAAGACAGGCAC27 (0.001716%)
CTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTT6 (0.000381%)
CTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTT17 (0.001081%)
CTCTTTTACTGTTGTTTCTTGGGTGTGTTAAGAGTGTTCTTACGTCTGAGCCTGGGCTGGCATATAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGC3 (0.000191%)
CTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAAC5 (0.000318%)
CTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTAT18 (0.001144%)
CTGCAACAGCATGCCCTCCCGCATCTGCGAGTTCTCCAGCATGATGAACAGCTTGTCCCACTCCGAGTGCTCCTGGCGGCAGTCGCATGGCGTGGGGTCC68 (0.004323%)
CTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATT15 (0.000953%)
CTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCAGGAAGTACATT4 (0.000254%)
CTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAA14 (0.000890%)
CTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAG29 (0.001843%)
CTGCATATGAGGTTACTAACAGAGACACTGTTTTCATTTTTAAAGGAAATCAGTTCTGGGCTATACGAGGGCACGAGGAGCTAGCAGGTTATCCTAAAAG196 (0.012459%)
CTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCT24 (0.001526%)
CTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTT35 (0.002225%)
CTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTC20 (0.001271%)
CTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACCTAGAAA4 (0.000254%)
CTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGATCAATGTGTTCTCATCTTATAATT3 (0.000191%)
CTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCT15 (0.000953%)
CTGGACTTGTCACTGTTGTACTTATGGTGGACCCAGCAGGCTATGTCAAGTATCTTGCAATGAATGGAGGGGACCCACAGGTTAGAGGAGCCAGTATCAA5 (0.000318%)
CTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCT5 (0.000318%)
CTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACT8 (0.000509%)
CTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGG5 (0.000318%)
CTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGC14 (0.000890%)
CTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGG5 (0.000318%)
CTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAG55 (0.003496%)
CTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTC3 (0.000191%)
CTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTC411 (0.026126%)
CTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCA77 (0.004895%)
CTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTC576 (0.036614%)
CTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCC28 (0.001780%)
CTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACA7 (0.000445%)
CTTCAGTTCAAGACATTTTGAAAGGTTAACAACCAATGATTCTTGACTTACACACTAAAGTATCACAATTTCCGATAGTGTGACAGATAGGAAAGAATAG11 (0.000699%)
CTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAA7 (0.000445%)
CTTCCACCGTAGGGCACTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAG11 (0.000699%)
CTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTG20 (0.001271%)
CTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTC22 (0.001398%)
CTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGA8 (0.000509%)
CTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACC98 (0.006230%)
CTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAA19 (0.001208%)
CTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTC3 (0.000191%)
CTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTG7 (0.000445%)
CTTGGATCCACTTTAATTTCGGGTCAATGCACACTTGTCTGTTGTTGTTCTTCAGCCGTGCAACAATCTGAAGGGCACAGTTTGGAGTGTTGAGGATTTT4 (0.000254%)
CTTGGCTGAGTGGTAGAGTCCCAGGGAGTGGCCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCG8 (0.000509%)
CTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCA5 (0.000318%)
CTTGGGTGTGTTAAGAGTGTTCTTACGTCTGAGCCTGGGCTGGCATATAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAAC6 (0.000381%)
CTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCA17 (0.001081%)
CTTGTCACTGTTGTACTTATGGTGGACCCAGCAGGCTATGTCAAGTATCTTGCAATGAATGGAGGGGACCCACAGGTTAGAGGAGCCAGTATCAAAGACG3 (0.000191%)
CTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTG12 (0.000763%)
CTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCAGGAAGTACATTTGCAT4 (0.000254%)
CTTGTTTAAAGCTTTCTCCAGGTACTCTTGGATCCACTTTAATTTCGGGTCAATGCACACTTGTCTGTTGTTGTTCTTCAGCCGTGCAACAATCTGAAGG16 (0.001017%)
CTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTAT26 (0.001653%)
CTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCA11 (0.000699%)
CTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACA6 (0.000381%)
CTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAG287 (0.018244%)
CTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTC7 (0.000445%)
CTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATA5 (0.000318%)
CTTTTCTCATCAAAGCAGGGAGTTCATAAAGAAAATCCGTGGGTGGAGAGAATCAGCCCTTTCTTCTTATCTTCACTGGGGTCAGAGTCCTCAGAAATCT6 (0.000381%)
GAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCC8 (0.000509%)
GAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTG11 (0.000699%)
GAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGATCAATGTGTTCTCATCTTATAATTTTAGACATTTGATGT3 (0.000191%)
GAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGATCAATGTGTTCTCATCTTA6 (0.000381%)
GAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTG15 (0.000953%)
GAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCA13 (0.000826%)
GAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCT4 (0.000254%)
GAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTC596 (0.037886%)
GAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCG6 (0.000381%)
GAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCG8 (0.000509%)
GAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGA4 (0.000254%)
GAAGAATGGGCGTGCGCGGCTGCGAGGCTGCGTCGCCGTCGGGTCTCCGGGCAGTGGCACTGGGGTCGCGGCGTCGCTGAGGCTGGTACTGCGCCCCGAG106 (0.006738%)
GAAGAGCACACGTCTGAACTCCAGTCACGCGAATGACAAT17 (0.000432%)
GAAGAGTGCACGGCCCCCGCGATCGTTCTGAAACTCGAGGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCC9 (0.000572%)
GAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTC64 (0.004068%)
GAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGAC18 (0.001144%)
GAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGA25 (0.001589%)
GAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAA7 (0.000445%)
GACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACG7 (0.000445%)
GACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACC9 (0.000572%)
GACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGAC4 (0.000254%)
GACGCAGCCTCGCAGCCGCGCACGCCCATTCTTCTGCTGCGTGACAACCGCACCGCCTCTACCCGTGCGAGGACGCCAAGCCCGTCTGGGGTCGCCGCGG3 (0.000191%)
GAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGT12 (0.000763%)
GAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATC6 (0.000381%)
GAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGC229 (0.014557%)
GAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAA41 (0.002606%)
GAGATCAAATAAAATTCAGGCTCAGGAGTCCTGAGAGATTTGCGCCAAAAGTGCCTGTCTTTAAAAAACAGGACTTCTCCCCGGAGGGTGCTGACTGCAT3 (0.000191%)
GAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAA3326 (0.084569%)
GAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTC4 (0.000254%)
GAGCACACGTCTGAACTCCAGTCACGCGAATGACAATCTC8 (0.000203%)
GAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATA5 (0.000318%)
GAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGG6 (0.000381%)
GAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTC9 (0.000572%)
GAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCC443 (0.028160%)
GAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGA8 (0.000509%)
GAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGAT5 (0.000318%)
GAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGG6 (0.000381%)
GAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGG8 (0.000509%)
GAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGA5 (0.000318%)
GAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGAC139 (0.008836%)
GAGTGGCCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCC3 (0.000191%)
GATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATA10 (0.000636%)
GATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGCA3 (0.000191%)
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAATG43 (0.001093%)
GATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGA4 (0.000254%)
GATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGC8 (0.000509%)
GATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGA34 (0.002161%)
GATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCA9 (0.000572%)
GCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGG88 (0.005594%)
GCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCAT7 (0.000445%)
GCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACC23 (0.001462%)
GCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGT8 (0.000509%)
GCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAA4 (0.000254%)
GCAATAGTCACCTTCAGTTCAAGACATTTTGAAAGGTTAACAACCAATGATTCTTGACTTACACACTAAAGTATCACAATTTCCGATAGTGTGACAGATA221 (0.014048%)
GCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACT16 (0.001017%)
GCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCAGG11 (0.000699%)
GCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCA34 (0.002161%)
GCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGT4 (0.000254%)
GCACTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCT19 (0.001208%)
GCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTAT5 (0.000318%)
GCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGATCAATGTGTTCTCATCTTATAATTTTAGACATTTGA9 (0.000572%)
GCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGG8 (0.000509%)
GCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGG27 (0.001716%)
GCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCA3 (0.000191%)
GCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATA24 (0.001526%)
GCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGACTGGTCCTAG12 (0.000763%)
GCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTT6 (0.000381%)
GCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTC49 (0.003115%)
GCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAG20 (0.001271%)
GCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAAC10 (0.000636%)
GCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATT7 (0.000445%)
GCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAA3 (0.000191%)
GCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGA9 (0.000572%)
GCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATA21 (0.001335%)
GCCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGT42 (0.002670%)
GCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCT24 (0.001526%)
GCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGA8 (0.000509%)
GCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACA21 (0.001335%)
GCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGA32 (0.002034%)
GCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAG52 (0.003305%)
GCCAGTGTGCTGACCGCACAGCCCCGCCTCATGGAGCCTATCTATCTGGTGGAGATCCAGTGTCCTGAGCAAGTGGTGGGTGGCATCTACGGTGTCCTGA25 (0.001589%)
GCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTT7 (0.000445%)
GCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAA11 (0.000699%)
GCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGC3 (0.000191%)
GCCCCCGCGATCGTTCTGAAACTCGAGGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACG5 (0.000318%)
GCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTT5 (0.000318%)
GCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGC8 (0.000509%)
GCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCC77 (0.007244%)
GCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTG5 (0.000318%)
GCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGT9 (0.000572%)
GCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGT5 (0.000318%)
GCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATG11 (0.000699%)
GCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAA18 (0.001144%)
GCGACGCAGCCTCGCAGCCGCGCACGCCCATTCTTCTGCTGCGTGACAACCGCACCGCCTCTACCCGTGCGAGGACGCCAAGCCCGTCTGGGGTCGCCGC3 (0.000191%)
GCGATCGTTCTGAAACTCGAGGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCC6 (0.000381%)
GCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACC17 (0.001081%)
GCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGA75 (0.004767%)
GCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCA44 (0.002797%)
GCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGGG11 (0.000699%)
GCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGA9 (0.000572%)
GCGGTTTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTT905 (0.057528%)
GCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTG8 (0.000509%)
GCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCAC4 (0.000254%)
GCTCACTTCTGCTTAGAGAAATACTCTTTGCTCTTATTGACATCAGGCTTGATGGTATCACTGCCAGGTTTCCAGCCAGCTGGACACACTTCACCATGTTTGTCAGTGAACTGGAAGGCCTGGACTAGTCGTATAATCTCATCCACAG10 (0.000941%)
GCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTA29 (0.001843%)
GCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGC4 (0.000254%)
GCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGC16 (0.001017%)
GCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAG28 (0.001780%)
GCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCC6 (0.000381%)
GCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAA19 (0.001208%)
GCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTA119 (0.007564%)
GCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCAGGAAGTACAT3 (0.000191%)
GCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACT5 (0.000318%)
GCTGGACTTGTCACTGTTGTACTTATGGTGGACCCAGCAGGCTATGTCAAGTATCTTGCAATGAATGGAGGGGACCCACAGGTTAGAGGAGCCAGTATCA4 (0.000254%)
GCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGG20 (0.001271%)
GCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCG25 (0.001589%)
GCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACCTAGAAAAC4 (0.000254%)
GCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGATCAATGTGTTCTCATCTTATAATTTT4 (0.000254%)
GCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACCTAGAAAACTACTAT7 (0.000445%)
GCTTACTTGTTTAAAGCTTTCTCCAGGTACTCTTGGATCCACTTTAATTTCGGGTCAATGCACACTTGTCTGTTGTTGTTCTTCAGCCGTGCAACAATCT41 (0.002606%)
GCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCC12 (0.000763%)
GCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCAC8 (0.000509%)
GCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACA21 (0.001335%)
GCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCAC9 (0.000572%)
GCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTC24 (0.001526%)
GGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGT23 (0.001462%)
GGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCC11 (0.000699%)
GGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTC40 (0.002543%)
GGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTT15 (0.000953%)
GGAAGAGCACACGTCTGAACTCCAGTCACGCGAATGACAA48 (0.001220%)
GGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCGCAGTTGGA14 (0.000890%)
GGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTT53 (0.003369%)
GGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCAGGAAGTACATTTGCATTGTTTG4 (0.000254%)
GGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCATGAGCCAA4 (0.000254%)
GGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTG3 (0.000191%)
GGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCT3 (0.000191%)
GGACTTGTCACTGTTGTACTTATGGTGGACCCAGCAGGCTATGTCAAGTATCTTGCAATGAATGGAGGGGACCCACAGGTTAGAGGAGCCAGTATCAAAG3 (0.000191%)
GGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGAT31 (0.001971%)
GGAGACCCGACGGCGACGCAGCCTCGCAGCCGCGCACGCCCATTCTTCTGCTGCGTGACAACCGCACCGCCTCTACCCGTGCGAGGACGCCAAGCCCGTC8 (0.000509%)
GGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCA5 (0.000318%)
GGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAG26 (0.001653%)
GGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAG7 (0.000445%)
GGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAG19 (0.001208%)
GGAGTGGCCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATC15 (0.000953%)
GGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATT25 (0.001589%)
GGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGC12 (0.000763%)
GGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAG11 (0.000699%)
GGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTT8 (0.000509%)
GGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATG57 (0.003623%)
GGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTC9 (0.000572%)
GGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGACTGGTCCTA5 (0.000318%)
GGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAG22 (0.001398%)
GGCCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGG10 (0.000636%)
GGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCAC28 (0.001780%)
GGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAG9 (0.000572%)
GGCGACGCAGCCTCGCAGCCGCGCACGCCCATTCTTCTGCTGCGTGACAACCGCACCGCCTCTACCCGTGCGAGGACGCCAAGCCCGTCTGGGGTCGCCG7 (0.000445%)
GGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAG5 (0.000318%)
GGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTT5 (0.000318%)
GGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAAC4 (0.000254%)
GGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACCTAGAAAACTACTA3 (0.000191%)
GGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACAT25 (0.001589%)
GGGACCTCTTTTACTGTTGTTTCTTGGGTGTGTTAAGAGTGTTCTTACGTCTGAGCCTGGGCTGGCATATAACTTTTATGGTTTTAGAAAGCTGCTGTGT129 (0.008200%)
GGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAAT7 (0.000445%)
GGGAGTTCATAAAGAAAATCCGTGGGTGGAGAGAATCAGCCCTTTCTTCTTATCTTCACTGGGGTCAGAGTCCTCAGAAATCTTTCTATTGAACACTGGC3 (0.000191%)
GGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGG10 (0.000636%)
GGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCT28 (0.001780%)
GGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTG7 (0.000445%)
GGGCACTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGG21 (0.001335%)
GGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACT3 (0.000191%)
GGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACT17 (0.001081%)
GGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAA3 (0.000191%)
GGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTC30 (0.001907%)
GGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGT24 (0.001526%)
GGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCAC4 (0.000254%)
GGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCA5 (0.000318%)
GGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCA6 (0.000381%)
GGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCC195 (0.012395%)
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG302 (0.007679%)
GGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCA13 (0.000826%)
GGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCA570 (0.036233%)
GGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAG8 (0.000509%)
GGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCAC13 (0.000826%)
GGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGA302 (0.019197%)
GGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTG8 (0.000509%)
GGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAG7 (0.000445%)
GGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTG3 (0.000191%)
GGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGC3 (0.000191%)
GGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGC6 (0.000381%)
GGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGC5 (0.000318%)
GGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTT8 (0.000509%)
GGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCG3 (0.000191%)
GGTTTCCCTTTTCTCATCAAAGCAGGGAGTTCATAAAGAAAATCCGTGGGTGGAGAGAATCAGCCCTTTCTTCTTATCTTCACTGGGGTCAGAGTCCTCA184 (0.011696%)
GGTTTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCC8 (0.000509%)
GGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAA6 (0.000381%)
GTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAA5 (0.000318%)
GTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTC13 (0.000826%)
GTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAA4 (0.000254%)
GTACCCACCAAGTCTAACTCTCTGGAACCTGAGACATCACCAATGTGCAGCTCTACTTTGTTCTTTGATGCAGTCAGCACCCTCCGGGGAGAAGTCCTGT6 (0.000381%)
GTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTT4 (0.000254%)
GTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATG4 (0.000254%)
GTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAG12 (0.000763%)
GTAGGGCACTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTG7 (0.000445%)
GTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGAT5 (0.000318%)
GTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGG15 (0.000953%)
GTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGG22 (0.001398%)
GTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTC33 (0.002098%)
GTCACCTTCAGTTCAAGACATTTTGAAAGGTTAACAACCAATGATTCTTGACTTACACACTAAAGTATCACAATTTCCGATAGTGTGACAGATAGGAAAG11 (0.000699%)
GTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCA11 (0.000699%)
GTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGGGTCGGAG3 (0.000191%)
GTCCACCCTCAGGAACAGAGTGACTTTTGGCCATCTCTACAGTGGTAGCCACCAGCTCCCCGTTTGCCCACAGGGACATGCTCCCCTGCTCTGAACTCCA34 (0.002161%)
GTCCATGACCATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCT3 (0.000191%)
GTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGT25 (0.001589%)
GTCCCAGGGAGTGGCCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCC7 (0.000445%)
GTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGA29 (0.001843%)
GTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTT4 (0.000254%)
GTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTT6 (0.000381%)
GTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACCTAG9 (0.000572%)
GTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCC46 (0.002924%)
GTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCAGGAAGTACATTTGCATTGT6 (0.000381%)
GTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCG19 (0.001208%)
GTCTCATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATAAAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGC174 (0.011061%)
GTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGG15 (0.000953%)
GTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAA5 (0.000318%)
GTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGA9 (0.000572%)
GTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCATGAGCCAAGACTGTTCCAGGCCCAT23 (0.001462%)
GTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCG8 (0.000509%)
GTGCACGGCCCCCGCGATCGTTCTGAAACTCGAGGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAG3 (0.000191%)
GTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGAC23 (0.001462%)
GTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATT6 (0.000381%)
GTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCC8 (0.000509%)
GTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCC23 (0.001462%)
GTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCC6 (0.000381%)
GTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGT8 (0.000509%)
GTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGAC10 (0.000636%)
GTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTG4 (0.000254%)
GTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACCTAGAAAACTAC4 (0.000254%)
GTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTG12 (0.000763%)
GTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACA5 (0.000318%)
GTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGG6 (0.000381%)
GTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATG3 (0.000191%)
GTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGT7 (0.000445%)
GTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAG7 (0.000445%)
GTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCT8 (0.000509%)
GTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACCTAGAAAACTACTATGGCCT3 (0.000191%)
GTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGCAGCTTCAGCTAGATGCTGCGGCAGCGTGAACAGCAACAGAAATG6 (0.000381%)
GTTCAAGACATTTTGAAAGGTTAACAACCAATGATTCTTGACTTACACACTAAAGTATCACAATTTCCGATAGTGTGACAGATAGGAAAGAATAGGAAAT10 (0.000636%)
GTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGACTG17 (0.001081%)
GTTCATAAAGAAAATCCGTGGGTGGAGAGAATCAGCCCTTTCTTCTTATCTTCACTGGGGTCAGAGTCCTCAGAAATCTTTCTATTGAACACTGGCCGTT3 (0.000191%)
GTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGG7 (0.000445%)
GTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAG6 (0.000381%)
GTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCA10 (0.000636%)
GTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATC11 (0.000699%)
GTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCC53 (0.003369%)
GTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGA6 (0.000381%)
GTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCATGAGCCAAGACTGTT4 (0.000254%)
GTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTA17 (0.001081%)
GTTGTTTCTTGGGTGTGTTAAGAGTGTTCTTACGTCTGAGCCTGGGCTGGCATATAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTAT7 (0.000445%)
GTTTCCCTTTTCTCATCAAAGCAGGGAGTTCATAAAGAAAATCCGTGGGTGGAGAGAATCAGCCCTTTCTTCTTATCTTCACTGGGGTCAGAGTCCTCAG6 (0.000381%)
GTTTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCG74 (0.004704%)
GTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGA14 (0.000890%)
GTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAA78 (0.004958%)
GTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCT21 (0.001335%)
GTTTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGATCAATGTGTTCTC146 (0.009281%)
TAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAG17 (0.001081%)
TAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTT4 (0.000254%)
TAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATAT4 (0.000254%)
TAATTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAAC3 (0.000191%)
TAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGATCAATGTGTTCTCATCT5 (0.000318%)
TAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGA9 (0.000572%)
TAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGG5 (0.000318%)
TAGAGTCCCAGGGAGTGGCCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCAT5 (0.000318%)
TAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAA2313 (0.058812%)
TAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCAC7 (0.000445%)
TAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGT9 (0.000572%)
TAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATC3 (0.000191%)
TAGTCACCTTCAGTTCAAGACATTTTGAAAGGTTAACAACCAATGATTCTTGACTTACACACTAAAGTATCACAATTTCCGATAGTGTGACAGATAGGAA3 (0.000191%)
TATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTG3 (0.000191%)
TATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGC6 (0.000381%)
TATGACTTCCACCGTAGGGCACTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAA322 (0.020468%)
TATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACG6 (0.000381%)
TATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGT6 (0.000381%)
TCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGC5 (0.000318%)
TCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCT3 (0.000191%)
TCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAA5 (0.000318%)
TCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTT5 (0.000318%)
TCACCTTCAGTTCAAGACATTTTGAAAGGTTAACAACCAATGATTCTTGACTTACACACTAAAGTATCACAATTTCCGATAGTGTGACAGATAGGAAAGA3 (0.000191%)
TCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATT11 (0.000699%)
TCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGC5 (0.000318%)
TCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATA4 (0.000254%)
TCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACAT6 (0.000381%)
TCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGCAGCTTCAG3 (0.000191%)
TCCAAGTCCATGACCATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTT205 (0.013031%)
TCCACCGTAGGGCACTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCT3 (0.000191%)
TCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCA3 (0.000191%)
TCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACC13 (0.000826%)
TCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTT5 (0.000318%)
TCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGAT3 (0.000191%)
TCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGC6 (0.000381%)
TCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGG13 (0.000826%)
TCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACC5 (0.000318%)
TCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATAC4 (0.000254%)
TCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCAT4 (0.000254%)
TCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCT4 (0.000254%)
TCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAA3 (0.000191%)
TCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCG19 (0.001208%)
TCCTGGAAGAGTGCACGGCCCCCGCGATCGTTCTGAAACTCGAGGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTA82 (0.005212%)
TCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCA32 (0.002034%)
TCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTT242 (0.015383%)
TCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCA8 (0.000509%)
TCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAG4 (0.000254%)
TCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAATGAC6 (0.000153%)
TCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCAGGAAGTACATTTGCATTGTT4 (0.000254%)
TCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGAT75 (0.004767%)
TCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCC18 (0.001144%)
TCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCAT4 (0.000254%)
TCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAG36 (0.002288%)
TCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGT20 (0.001271%)
TCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAA4 (0.000254%)
TCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAA7 (0.000445%)
TCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTC12 (0.000763%)
TCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTC5 (0.000318%)
TCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGA7 (0.000445%)
TCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAA6 (0.000381%)
TCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTA9 (0.000572%)
TCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGAC3 (0.000191%)
TGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACC4 (0.000254%)
TGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGA7 (0.000445%)
TGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGC8 (0.000509%)
TGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGA13 (0.000826%)
TGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATG14 (0.000890%)
TGACTTCCACCGTAGGGCACTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACG4 (0.000254%)
TGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACT13 (0.000826%)
TGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCAT10 (0.000636%)
TGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGAT5 (0.000318%)
TGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGC5 (0.000318%)
TGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCAC340 (0.021613%)
TGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGA8 (0.000509%)
TGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTA16 (0.001017%)
TGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCAGGAAGTACATTT3 (0.000191%)
TGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCAGGAAGTACATTTGCATTGTTTGCATTTGCAGGC7 (0.000445%)
TGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAAT33 (0.002098%)
TGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGT8 (0.000509%)
TGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAA7 (0.000445%)
TGCATATGAGGTTACTAACAGAGACACTGTTTTCATTTTTAAAGGAAATCAGTTCTGGGCTATACGAGGGCACGAGGAGCTAGCAGGTTATCCTAAAAGC5 (0.000318%)
TGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGA7 (0.000445%)
TGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGAT3 (0.000191%)
TGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTT11 (0.000699%)
TGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCA5 (0.000318%)
TGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGT6 (0.000381%)
TGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCG5 (0.000318%)
TGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTC4 (0.000254%)
TGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTT8 (0.000509%)
TGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAG5 (0.000318%)
TGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACT16 (0.001017%)
TGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGA4 (0.000254%)
TGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTC5 (0.000318%)
TGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGCAGCTTCAGCTAGATGCTGCGGCAGCGTGAACAGCAACAGA5 (0.000318%)
TGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGAT28 (0.001780%)
TGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTG5 (0.000318%)
TGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGC6 (0.000381%)
TGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGGGTCGG3 (0.000191%)
TGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCG18 (0.001144%)
TGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGT16 (0.001017%)
TGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGT13 (0.000826%)
TGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGA180 (0.011442%)
TGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGA6 (0.000381%)
TGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACT6 (0.000381%)
TGTCACTGTTGTACTTATGGTGGACCCAGCAGGCTATGTCAAGTATCTTGCAATGAATGGAGGGGACCCACAGGTTAGAGGAGCCAGTATCAAAGACGAC4 (0.000254%)
TGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTG15 (0.000953%)
TGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGA6 (0.000381%)
TGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGA6 (0.000381%)
TTACAGGCTTCCGACACAAACTAAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAAT7 (0.000445%)
TTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGCAGCTTCAGCTAGAT6 (0.000381%)
TTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCA9 (0.000572%)
TTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTT6 (0.000381%)
TTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAG15 (0.000953%)
TTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCC8 (0.000509%)
TTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGACTGG6 (0.000381%)
TTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCG42 (0.002670%)
TTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATAT4 (0.000254%)
TTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACAT39 (0.002479%)
TTCAGTTCAAGACATTTTGAAAGGTTAACAACCAATGATTCTTGACTTACACACTAAAGTATCACAATTTCCGATAGTGTGACAGATAGGAAAGAATAGG8 (0.000509%)
TTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAG6 (0.000381%)
TTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGT14 (0.000890%)
TTCCACCGTAGGGCACTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGC17 (0.001081%)
TTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAA3 (0.000191%)
TTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGG7 (0.000445%)
TTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCAC7 (0.000445%)
TTCCCTTTTCTCATCAAAGCAGGGAGTTCATAAAGAAAATCCGTGGGTGGAGAGAATCAGCCCTTTCTTCTTATCTTCACTGGGGTCAGAGTCCTCAGAA3 (0.000191%)
TTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATA8 (0.000509%)
TTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCC3 (0.000191%)
TTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGC22 (0.001398%)
TTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGAC7 (0.000445%)
TTCTCATCAAAGCAGGGAGTTCATAAAGAAAATCCGTGGGTGGAGAGAATCAGCCCTTTCTTCTTATCTTCACTGGGGTCAGAGTCCTCAGAAATCTTTC3 (0.000191%)
TTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACA15 (0.000953%)
TTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCT25 (0.001589%)
TTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTC11 (0.000699%)
TTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCT3 (0.000191%)
TTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGT7 (0.000445%)
TTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCG12 (0.000763%)
TTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAG7 (0.000445%)
TTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATG4 (0.000254%)
TTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGA6 (0.000381%)
TTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGC9 (0.000572%)
TTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGA20 (0.001271%)
TTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGCAGCTTCAGCTAGATGCTGCGGCAGCGTGAACAGCAACAG7 (0.000445%)
TTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCAC29 (0.001843%)
TTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGG12 (0.000763%)
TTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCAC9 (0.000572%)
TTTAGAAAGCTGCTGTGTCATGCAGAAACCTATGTAGAACACAGTTCCTTATTTAGAATTTCTAAATGTGTAAGTTCTAGAAGGATCAATGTGTTCTCAT3 (0.000191%)
TTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCC4 (0.000254%)
TTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATT95 (0.006039%)
TTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATATA12 (0.000763%)
TTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACA4 (0.000254%)
TTTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGC6 (0.000381%)
TTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGAC10 (0.000636%)
TTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAG29 (0.001843%)
TTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTT6 (0.000381%)
TTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCAGGAAGTACATTTGCATTGTTTGCATTTGCAG3 (0.000191%)
TTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACAT29 (0.001843%)
TTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGG8 (0.000509%)
TTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGCAGCTTCAGCTAGATGCTGCGGCAGCGTGAACAGCAACA119 (0.007564%)
TTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTG3 (0.000191%)
TTTGGCGAACCTGGGAAGGTACTGAAGCCACCAACATCAGGAACACCACACCTGGGCTTATGCATCAGCTCCATAGTGTTGGAGTCCAGCTTCCCTGTCA3 (0.000191%)
TTTTACTGTTGTTTCTTGGGTGTGTTAAGAGTGTTCTTACGTCTGAGCCTGGGCTGGCATATAACTTTTATGGTTTTAGAAAGCTGCTGTGTCATGCAGA22 (0.001398%)
TTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCC6 (0.000381%)
TTTTCAGCCCTCCTTCTAACATCAGGTCTAGTAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTCACCAATATCCTCACAATAT5 (0.000318%)
TTTTGAAAGGTTAACAACCAATGATTCTTGACTTACACACTAAAGTATCACAATTTCCGATAGTGTGACAGATAGGAAAGAATAGGAAATATTTTTGCTA4 (0.000254%)
TTTTGGCGAACCTGGGAAGGTACTGAAGCCACCAACATCAGGAACACCACACCTGGGCTTATGCATCAGCTCCATAGTGTTGGAGTCCAGCTTCCCTGTC7 (0.000445%)
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT327 (0.008314%)
Value of each position will be shown on mouse over.
Value of each position will be shown on mouse over.
Darker background means larger counts. The count will be shown on mouse over.
AAATACAGTATTTCTGCACTCCCGGAGTGCGG
AAAAAAAAAAAATAAAACAAAAGAAATAAAATTAAATCAAATGAAACAAAACTAAACCAAACGAAAGAAAAGTAAAGCAAAGG
AATAATAAAATATAATACAATAGAATTAAATTTAATTCAATTGAATCAAATCTAATCCAATCGAATGAAATGTAATGCAATGG
AACAACAAAACATAACACAACAGAACTAAACTTAACTCAACTGAACCAAACCTAACCCAACCGAACGAAACGTAACGCAACGG
AAGAAGAAAAGATAAGACAAGAGAAGTAAAGTTAAGTCAAGTGAAGCAAAGCTAAGCCAAGCGAAGGAAAGGTAAGGCAAGGG
ATAATAAAATAATATAACATAAGATATAATATTATATCATATGATACAATACTATACCATACGATAGAATAGTATAGCATAGG
ATTATTAAATTATATTACATTAGATTTAATTTTATTTCATTTGATTCAATTCTATTCCATTCGATTGAATTGTATTGCATTGG
ATCATCAAATCATATCACATCAGATCTAATCTTATCTCATCTGATCCAATCCTATCCCATCCGATCGAATCGTATCGCATCGG
ATGATGAAATGATATGACATGAGATGTAATGTTATGTCATGTGATGCAATGCTATGCCATGCGATGGAATGGTATGGCATGGG
ACAACAAAACAATACAACACAAGACATAACATTACATCACATGACACAACACTACACCACACGACAGAACAGTACAGCACAGG
ACTACTAAACTATACTACACTAGACTTAACTTTACTTCACTTGACTCAACTCTACTCCACTCGACTGAACTGTACTGCACTGG
ACCACCAAACCATACCACACCAGACCTAACCTTACCTCACCTGACCCAACCCTACCCCACCCGACCGAACCGTACCGCACCGG
ACGACGAAACGATACGACACGAGACGTAACGTTACGTCACGTGACGCAACGCTACGCCACGCGACGGAACGGTACGGCACGGG
AGAAGAAAAGAATAGAACAGAAGAGATAAGATTAGATCAGATGAGACAAGACTAGACCAGACGAGAGAAGAGTAGAGCAGAGG
AGTAGTAAAGTATAGTACAGTAGAGTTAAGTTTAGTTCAGTTGAGTCAAGTCTAGTCCAGTCGAGTGAAGTGTAGTGCAGTGG
AGCAGCAAAGCATAGCACAGCAGAGCTAAGCTTAGCTCAGCTGAGCCAAGCCTAGCCCAGCCGAGCGAAGCGTAGCGCAGCGG
AGGAGGAAAGGATAGGACAGGAGAGGTAAGGTTAGGTCAGGTGAGGCAAGGCTAGGCCAGGCGAGGGAAGGGTAGGGCAGGGG
TAATAAAATAAATTAAACTAAAGTAATATAATTTAATCTAATGTAACATAACTTAACCTAACGTAAGATAAGTTAAGCTAAGG
TATTATAATATATTATACTATAGTATTATATTTTATTCTATTGTATCATATCTTATCCTATCGTATGATATGTTATGCTATGG
TACTACAATACATTACACTACAGTACTATACTTTACTCTACTGTACCATACCTTACCCTACCGTACGATACGTTACGCTACGG
TAGTAGAATAGATTAGACTAGAGTAGTATAGTTTAGTCTAGTGTAGCATAGCTTAGCCTAGCGTAGGATAGGTTAGGCTAGGG
TTATTAAATTAATTTAACTTAAGTTATATTATTTTATCTTATGTTACATTACTTTACCTTACGTTAGATTAGTTTAGCTTAGG
TTTTTTAATTTATTTTACTTTAGTTTTATTTTTTTTTCTTTTGTTTCATTTCTTTTCCTTTCGTTTGATTTGTTTTGCTTTGG
TTCTTCAATTCATTTCACTTCAGTTCTATTCTTTTCTCTTCTGTTCCATTCCTTTCCCTTCCGTTCGATTCGTTTCGCTTCGG
TTGTTGAATTGATTTGACTTGAGTTGTATTGTTTTGTCTTGTGTTGCATTGCTTTGCCTTGCGTTGGATTGGTTTGGCTTGGG
TCATCAAATCAATTCAACTCAAGTCATATCATTTCATCTCATGTCACATCACTTCACCTCACGTCAGATCAGTTCAGCTCAGG
TCTTCTAATCTATTCTACTCTAGTCTTATCTTTTCTTCTCTTGTCTCATCTCTTCTCCTCTCGTCTGATCTGTTCTGCTCTGG
TCCTCCAATCCATTCCACTCCAGTCCTATCCTTTCCTCTCCTGTCCCATCCCTTCCCCTCCCGTCCGATCCGTTCCGCTCCGG
TCGTCGAATCGATTCGACTCGAGTCGTATCGTTTCGTCTCGTGTCGCATCGCTTCGCCTCGCGTCGGATCGGTTCGGCTCGGG
TGATGAAATGAATTGAACTGAAGTGATATGATTTGATCTGATGTGACATGACTTGACCTGACGTGAGATGAGTTGAGCTGAGG
TGTTGTAATGTATTGTACTGTAGTGTTATGTTTTGTTCTGTTGTGTCATGTCTTGTCCTGTCGTGTGATGTGTTGTGCTGTGG
TGCTGCAATGCATTGCACTGCAGTGCTATGCTTTGCTCTGCTGTGCCATGCCTTGCCCTGCCGTGCGATGCGTTGCGCTGCGG
TGGTGGAATGGATTGGACTGGAGTGGTATGGTTTGGTCTGGTGTGGCATGGCTTGGCCTGGCGTGGGATGGGTTGGGCTGGGG
CAACAAAACAAATCAAACCAAAGCAATACAATTCAATCCAATGCAACACAACTCAACCCAACGCAAGACAAGTCAAGCCAAGG
CATCATAACATATCATACCATAGCATTACATTTCATTCCATTGCATCACATCTCATCCCATCGCATGACATGTCATGCCATGG
CACCACAACACATCACACCACAGCACTACACTTCACTCCACTGCACCACACCTCACCCCACCGCACGACACGTCACGCCACGG
CAGCAGAACAGATCAGACCAGAGCAGTACAGTTCAGTCCAGTGCAGCACAGCTCAGCCCAGCGCAGGACAGGTCAGGCCAGGG
CTACTAAACTAATCTAACCTAAGCTATACTATTCTATCCTATGCTACACTACTCTACCCTACGCTAGACTAGTCTAGCCTAGG
CTTCTTAACTTATCTTACCTTAGCTTTACTTTTCTTTCCTTTGCTTCACTTCTCTTCCCTTCGCTTGACTTGTCTTGCCTTGG
CTCCTCAACTCATCTCACCTCAGCTCTACTCTTCTCTCCTCTGCTCCACTCCTCTCCCCTCCGCTCGACTCGTCTCGCCTCGG
CTGCTGAACTGATCTGACCTGAGCTGTACTGTTCTGTCCTGTGCTGCACTGCTCTGCCCTGCGCTGGACTGGTCTGGCCTGGG
CCACCAAACCAATCCAACCCAAGCCATACCATTCCATCCCATGCCACACCACTCCACCCCACGCCAGACCAGTCCAGCCCAGG
CCTCCTAACCTATCCTACCCTAGCCTTACCTTTCCTTCCCTTGCCTCACCTCTCCTCCCCTCGCCTGACCTGTCCTGCCCTGG
CCCCCCAACCCATCCCACCCCAGCCCTACCCTTCCCTCCCCTGCCCCACCCCTCCCCCCCCCGCCCGACCCGTCCCGCCCCGG
CCGCCGAACCGATCCGACCCGAGCCGTACCGTTCCGTCCCGTGCCGCACCGCTCCGCCCCGCGCCGGACCGGTCCGGCCCGGG
CGACGAAACGAATCGAACCGAAGCGATACGATTCGATCCGATGCGACACGACTCGACCCGACGCGAGACGAGTCGAGCCGAGG
CGTCGTAACGTATCGTACCGTAGCGTTACGTTTCGTTCCGTTGCGTCACGTCTCGTCCCGTCGCGTGACGTGTCGTGCCGTGG
CGCCGCAACGCATCGCACCGCAGCGCTACGCTTCGCTCCGCTGCGCCACGCCTCGCCCCGCCGCGCGACGCGTCGCGCCGCGG
CGGCGGAACGGATCGGACCGGAGCGGTACGGTTCGGTCCGGTGCGGCACGGCTCGGCCCGGCGCGGGACGGGTCGGGCCGGGG
GAAGAAAAGAAATGAAACGAAAGGAATAGAATTGAATCGAATGGAACAGAACTGAACCGAACGGAAGAGAAGTGAAGCGAAGG
GATGATAAGATATGATACGATAGGATTAGATTTGATTCGATTGGATCAGATCTGATCCGATCGGATGAGATGTGATGCGATGG
GACGACAAGACATGACACGACAGGACTAGACTTGACTCGACTGGACCAGACCTGACCCGACCGGACGAGACGTGACGCGACGG
GAGGAGAAGAGATGAGACGAGAGGAGTAGAGTTGAGTCGAGTGGAGCAGAGCTGAGCCGAGCGGAGGAGAGGTGAGGCGAGGG
GTAGTAAAGTAATGTAACGTAAGGTATAGTATTGTATCGTATGGTACAGTACTGTACCGTACGGTAGAGTAGTGTAGCGTAGG
GTTGTTAAGTTATGTTACGTTAGGTTTAGTTTTGTTTCGTTTGGTTCAGTTCTGTTCCGTTCGGTTGAGTTGTGTTGCGTTGG
GTCGTCAAGTCATGTCACGTCAGGTCTAGTCTTGTCTCGTCTGGTCCAGTCCTGTCCCGTCCGGTCGAGTCGTGTCGCGTCGG
GTGGTGAAGTGATGTGACGTGAGGTGTAGTGTTGTGTCGTGTGGTGCAGTGCTGTGCCGTGCGGTGGAGTGGTGTGGCGTGGG
GCAGCAAAGCAATGCAACGCAAGGCATAGCATTGCATCGCATGGCACAGCACTGCACCGCACGGCAGAGCAGTGCAGCGCAGG
GCTGCTAAGCTATGCTACGCTAGGCTTAGCTTTGCTTCGCTTGGCTCAGCTCTGCTCCGCTCGGCTGAGCTGTGCTGCGCTGG
GCCGCCAAGCCATGCCACGCCAGGCCTAGCCTTGCCTCGCCTGGCCCAGCCCTGCCCCGCCCGGCCGAGCCGTGCCGCGCCGG
GCGGCGAAGCGATGCGACGCGAGGCGTAGCGTTGCGTCGCGTGGCGCAGCGCTGCGCCGCGCGGCGGAGCGGTGCGGCGCGGG
GGAGGAAAGGAATGGAACGGAAGGGATAGGATTGGATCGGATGGGACAGGACTGGACCGGACGGGAGAGGAGTGGAGCGGAGG
GGTGGTAAGGTATGGTACGGTAGGGTTAGGTTTGGTTCGGTTGGGTCAGGTCTGGTCCGGTCGGGTGAGGTGTGGTGCGGTGG
GGCGGCAAGGCATGGCACGGCAGGGCTAGGCTTGGCTCGGCTGGGCCAGGCCTGGCCCGGCCGGGCGAGGCGTGGCGCGGCGG
GGGGGGAAGGGATGGGACGGGAGGGGTAGGGTTGGGTCGGGTGGGGCAGGGCTGGGCCGGGCGGGGGAGGGGTGGGGCGGGGG
Sampling rate: 1 / 20
overrepresented sequencecount (% of bases)distribution: cycle 1 ~ cycle 150
AAAAAATTCAAGAAATGCAGAAGTTCCTCGGGTTGGAGATGACAGGGAAGCTGGACTCCAACACTATGGAGCTGATGCATAAGCCCAGGTGTGGTGTTCC156 (0.009916%)
AAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAG11 (0.000699%)
AAAAATTCAAGAAATGCAGAAGTTCCTCGGGTTGGAGATGACAGGGAAGCTGGACTCCAACACTATGGAGCTGATGCATAAGCCCAGGTGTGGTGTTCCT9 (0.000572%)
AAAACCAGAAGGAGGTCTGTCTGGATCCAGAAGCTCCTGTGATAAAGAAAATCATTCAGAAAATATTGGGCAGTGACAAAAAGAAAGCTAAGCGGAATGC146 (0.009281%)
AAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGC27 (0.001716%)
AAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGT17 (0.001081%)
AAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAAC8 (0.000509%)
AAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCAC17 (0.001081%)
AAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGA8 (0.000509%)
AAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGG20 (0.001271%)
AAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACC4 (0.000254%)
AAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCA40 (0.002543%)
AAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCA19 (0.001208%)
AAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGA4 (0.000254%)
AAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTCGG9 (0.000572%)
AAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTC3 (0.000191%)
AACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTA5 (0.000318%)
AACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCG7 (0.000445%)
AACGGAACA