fastp report
General
fastp version:0.23.1 (https://github.com/OpenGene/fastp)
sequencing:paired end (150 cycles + 150 cycles)
mean length before filtering:150bp, 150bp
mean length after filtering:142bp, 141bp
duplication rate:18.625053%
Insert size peak:260
Before filtering
total reads:48.224196 M
total bases:7.233629 G
Q20 bases:7.004083 G (96.826678%)
Q30 bases:6.664693 G (92.134840%)
GC content:51.434756%
After filtering
total reads:47.746016 M
total bases:6.789282 G
Q20 bases:6.621511 G (97.528883%)
Q30 bases:6.316892 G (93.042110%)
GC content:51.205375%
Filtering result
reads passed filters:47.746016 M (99.008423%)
reads with low quality:430.388000 K (0.892473%)
reads with too many N:11.932000 K (0.024743%)
reads too short:35.860000 K (0.074361%)
Adapter or bad ligation of read1
SequenceOccurrences
A29938
AG33062
AGA35652
AGAT33685
AGATC33132
AGATCG34647
AGATCGG31412
AGATCGGA28415
AGATCGGAA27960
AGATCGGAAG28067
AGATCGGAAGA27154
AGATCGGAAGAG29351
AGATCGGAAGAGC30649
AGATCGGAAGAGCA32650
AGATCGGAAGAGCAC36220
AGATCGGAAGAGCACA35064
AGATCGGAAGAGCACAC29542
AGATCGGAAGAGCACACG27186
AGATCGGAAGAGCACACGT25512
AGATCGGAAGAGCACACGTC24482
AGATCGGAAGAGCACACGTCT26167
AGATCGGAAGAGCACACGTCTG28556
AGATCGGAAGAGCACACGTCTGA29418
AGATCGGAAGAGCACACGTCTGAA29257
AGATCGGAAGAGCACACGTCTGAAC30837
AGATCGGAAGAGCACACGTCTGAACT30245
AGATCGGAAGAGCACACGTCTGAACTC29135
AGATCGGAAGAGCACACGTCTGAACTCC26800
AGATCGGAAGAGCACACGTCTGAACTCCA23781
AGATCGGAAGAGCACACGTCTGAACTCCAG22087
AGATCGGAAGAGCACACGTCTGAACTCCAGT21724
AGATCGGAAGAGCACACGTCTGAACTCCAGTC25379
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA25319
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC28563
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACT28663
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTC26825
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCG26822
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGT24114
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTC47260
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTCG39352
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTCGC28645
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTCGCT26696
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTCGCTA60765
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTCGCTAA71902
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTCGCTAAA146722
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTCGCTAAAT27101
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTCGCTAAATCTC20769
other adapter sequences267353
Adapter or bad ligation of read2
SequenceOccurrences
A32519
AG33706
AGA35036
AGAT33260
AGATC34192
AGATCG40504
AGATCGG30832
AGATCGGA28998
AGATCGGAA25631
AGATCGGAAG27284
AGATCGGAAGA25219
AGATCGGAAGAG37176
AGATCGGAAGAGC30964
AGATCGGAAGAGCG31896
AGATCGGAAGAGCGT49638
AGATCGGAAGAGCGTC29360
AGATCGGAAGAGCGTCG42406
AGATCGGAAGAGCGTCGT28858
AGATCGGAAGAGCGTCGTG22156
AGATCGGAAGAGCGTCGTGTAG26263
AGATCGGAAGAGCGTCGTGTAGG40532
AGATCGGAAGAGCGTCGTGTAGGG31688
AGATCGGAAGAGCGTCGTGTAGGGA26541
AGATCGGAAGAGCGTCGTGTAGGGAA19433
AGATCGGAAGAGCGTCGTGTAGGGAAAGA19701
AGATCGGAAGAGCGTCGTGTAGGGAAAGAG19676
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGT20638
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG21472
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT22840
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTC24878
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCA30852
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCAC23088
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCACG25878
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCACGT23295
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCACGTG20010
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCACGTGTAACGT19362
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCACGTGTAACGTG22483
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCACGTGTAACGTGT20311
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCACGTGTAACGTGTA19367
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCACGTGTAACGTGTAGATCTCGGT19719
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCACGTGTAACGTGTAGATCTCGGTGGTCGC21748
other adapter sequences714094
This estimation is based on paired-end overlap analysis, and there are 61.940994% reads found not overlapped.
The nonoverlapped read pairs may have insert size <30 or >270, or contain too much sequencing errors to be detected as overlapped.
Value of each position will be shown on mouse over.
Value of each position will be shown on mouse over.
Darker background means larger counts. The count will be shown on mouse over.
AAATACAGTATTTCTGCACTCCCGGAGTGCGG
AAAAAAAAAAAATAAAACAAAAGAAATAAAATTAAATCAAATGAAACAAAACTAAACCAAACGAAAGAAAAGTAAAGCAAAGG
AATAATAAAATATAATACAATAGAATTAAATTTAATTCAATTGAATCAAATCTAATCCAATCGAATGAAATGTAATGCAATGG
AACAACAAAACATAACACAACAGAACTAAACTTAACTCAACTGAACCAAACCTAACCCAACCGAACGAAACGTAACGCAACGG
AAGAAGAAAAGATAAGACAAGAGAAGTAAAGTTAAGTCAAGTGAAGCAAAGCTAAGCCAAGCGAAGGAAAGGTAAGGCAAGGG
ATAATAAAATAATATAACATAAGATATAATATTATATCATATGATACAATACTATACCATACGATAGAATAGTATAGCATAGG
ATTATTAAATTATATTACATTAGATTTAATTTTATTTCATTTGATTCAATTCTATTCCATTCGATTGAATTGTATTGCATTGG
ATCATCAAATCATATCACATCAGATCTAATCTTATCTCATCTGATCCAATCCTATCCCATCCGATCGAATCGTATCGCATCGG
ATGATGAAATGATATGACATGAGATGTAATGTTATGTCATGTGATGCAATGCTATGCCATGCGATGGAATGGTATGGCATGGG
ACAACAAAACAATACAACACAAGACATAACATTACATCACATGACACAACACTACACCACACGACAGAACAGTACAGCACAGG
ACTACTAAACTATACTACACTAGACTTAACTTTACTTCACTTGACTCAACTCTACTCCACTCGACTGAACTGTACTGCACTGG
ACCACCAAACCATACCACACCAGACCTAACCTTACCTCACCTGACCCAACCCTACCCCACCCGACCGAACCGTACCGCACCGG
ACGACGAAACGATACGACACGAGACGTAACGTTACGTCACGTGACGCAACGCTACGCCACGCGACGGAACGGTACGGCACGGG
AGAAGAAAAGAATAGAACAGAAGAGATAAGATTAGATCAGATGAGACAAGACTAGACCAGACGAGAGAAGAGTAGAGCAGAGG
AGTAGTAAAGTATAGTACAGTAGAGTTAAGTTTAGTTCAGTTGAGTCAAGTCTAGTCCAGTCGAGTGAAGTGTAGTGCAGTGG
AGCAGCAAAGCATAGCACAGCAGAGCTAAGCTTAGCTCAGCTGAGCCAAGCCTAGCCCAGCCGAGCGAAGCGTAGCGCAGCGG
AGGAGGAAAGGATAGGACAGGAGAGGTAAGGTTAGGTCAGGTGAGGCAAGGCTAGGCCAGGCGAGGGAAGGGTAGGGCAGGGG
TAATAAAATAAATTAAACTAAAGTAATATAATTTAATCTAATGTAACATAACTTAACCTAACGTAAGATAAGTTAAGCTAAGG
TATTATAATATATTATACTATAGTATTATATTTTATTCTATTGTATCATATCTTATCCTATCGTATGATATGTTATGCTATGG
TACTACAATACATTACACTACAGTACTATACTTTACTCTACTGTACCATACCTTACCCTACCGTACGATACGTTACGCTACGG
TAGTAGAATAGATTAGACTAGAGTAGTATAGTTTAGTCTAGTGTAGCATAGCTTAGCCTAGCGTAGGATAGGTTAGGCTAGGG
TTATTAAATTAATTTAACTTAAGTTATATTATTTTATCTTATGTTACATTACTTTACCTTACGTTAGATTAGTTTAGCTTAGG
TTTTTTAATTTATTTTACTTTAGTTTTATTTTTTTTTCTTTTGTTTCATTTCTTTTCCTTTCGTTTGATTTGTTTTGCTTTGG
TTCTTCAATTCATTTCACTTCAGTTCTATTCTTTTCTCTTCTGTTCCATTCCTTTCCCTTCCGTTCGATTCGTTTCGCTTCGG
TTGTTGAATTGATTTGACTTGAGTTGTATTGTTTTGTCTTGTGTTGCATTGCTTTGCCTTGCGTTGGATTGGTTTGGCTTGGG
TCATCAAATCAATTCAACTCAAGTCATATCATTTCATCTCATGTCACATCACTTCACCTCACGTCAGATCAGTTCAGCTCAGG
TCTTCTAATCTATTCTACTCTAGTCTTATCTTTTCTTCTCTTGTCTCATCTCTTCTCCTCTCGTCTGATCTGTTCTGCTCTGG
TCCTCCAATCCATTCCACTCCAGTCCTATCCTTTCCTCTCCTGTCCCATCCCTTCCCCTCCCGTCCGATCCGTTCCGCTCCGG
TCGTCGAATCGATTCGACTCGAGTCGTATCGTTTCGTCTCGTGTCGCATCGCTTCGCCTCGCGTCGGATCGGTTCGGCTCGGG
TGATGAAATGAATTGAACTGAAGTGATATGATTTGATCTGATGTGACATGACTTGACCTGACGTGAGATGAGTTGAGCTGAGG
TGTTGTAATGTATTGTACTGTAGTGTTATGTTTTGTTCTGTTGTGTCATGTCTTGTCCTGTCGTGTGATGTGTTGTGCTGTGG
TGCTGCAATGCATTGCACTGCAGTGCTATGCTTTGCTCTGCTGTGCCATGCCTTGCCCTGCCGTGCGATGCGTTGCGCTGCGG
TGGTGGAATGGATTGGACTGGAGTGGTATGGTTTGGTCTGGTGTGGCATGGCTTGGCCTGGCGTGGGATGGGTTGGGCTGGGG
CAACAAAACAAATCAAACCAAAGCAATACAATTCAATCCAATGCAACACAACTCAACCCAACGCAAGACAAGTCAAGCCAAGG
CATCATAACATATCATACCATAGCATTACATTTCATTCCATTGCATCACATCTCATCCCATCGCATGACATGTCATGCCATGG
CACCACAACACATCACACCACAGCACTACACTTCACTCCACTGCACCACACCTCACCCCACCGCACGACACGTCACGCCACGG
CAGCAGAACAGATCAGACCAGAGCAGTACAGTTCAGTCCAGTGCAGCACAGCTCAGCCCAGCGCAGGACAGGTCAGGCCAGGG
CTACTAAACTAATCTAACCTAAGCTATACTATTCTATCCTATGCTACACTACTCTACCCTACGCTAGACTAGTCTAGCCTAGG
CTTCTTAACTTATCTTACCTTAGCTTTACTTTTCTTTCCTTTGCTTCACTTCTCTTCCCTTCGCTTGACTTGTCTTGCCTTGG
CTCCTCAACTCATCTCACCTCAGCTCTACTCTTCTCTCCTCTGCTCCACTCCTCTCCCCTCCGCTCGACTCGTCTCGCCTCGG
CTGCTGAACTGATCTGACCTGAGCTGTACTGTTCTGTCCTGTGCTGCACTGCTCTGCCCTGCGCTGGACTGGTCTGGCCTGGG
CCACCAAACCAATCCAACCCAAGCCATACCATTCCATCCCATGCCACACCACTCCACCCCACGCCAGACCAGTCCAGCCCAGG
CCTCCTAACCTATCCTACCCTAGCCTTACCTTTCCTTCCCTTGCCTCACCTCTCCTCCCCTCGCCTGACCTGTCCTGCCCTGG
CCCCCCAACCCATCCCACCCCAGCCCTACCCTTCCCTCCCCTGCCCCACCCCTCCCCCCCCCGCCCGACCCGTCCCGCCCCGG
CCGCCGAACCGATCCGACCCGAGCCGTACCGTTCCGTCCCGTGCCGCACCGCTCCGCCCCGCGCCGGACCGGTCCGGCCCGGG
CGACGAAACGAATCGAACCGAAGCGATACGATTCGATCCGATGCGACACGACTCGACCCGACGCGAGACGAGTCGAGCCGAGG
CGTCGTAACGTATCGTACCGTAGCGTTACGTTTCGTTCCGTTGCGTCACGTCTCGTCCCGTCGCGTGACGTGTCGTGCCGTGG
CGCCGCAACGCATCGCACCGCAGCGCTACGCTTCGCTCCGCTGCGCCACGCCTCGCCCCGCCGCGCGACGCGTCGCGCCGCGG
CGGCGGAACGGATCGGACCGGAGCGGTACGGTTCGGTCCGGTGCGGCACGGCTCGGCCCGGCGCGGGACGGGTCGGGCCGGGG
GAAGAAAAGAAATGAAACGAAAGGAATAGAATTGAATCGAATGGAACAGAACTGAACCGAACGGAAGAGAAGTGAAGCGAAGG
GATGATAAGATATGATACGATAGGATTAGATTTGATTCGATTGGATCAGATCTGATCCGATCGGATGAGATGTGATGCGATGG
GACGACAAGACATGACACGACAGGACTAGACTTGACTCGACTGGACCAGACCTGACCCGACCGGACGAGACGTGACGCGACGG
GAGGAGAAGAGATGAGACGAGAGGAGTAGAGTTGAGTCGAGTGGAGCAGAGCTGAGCCGAGCGGAGGAGAGGTGAGGCGAGGG
GTAGTAAAGTAATGTAACGTAAGGTATAGTATTGTATCGTATGGTACAGTACTGTACCGTACGGTAGAGTAGTGTAGCGTAGG
GTTGTTAAGTTATGTTACGTTAGGTTTAGTTTTGTTTCGTTTGGTTCAGTTCTGTTCCGTTCGGTTGAGTTGTGTTGCGTTGG
GTCGTCAAGTCATGTCACGTCAGGTCTAGTCTTGTCTCGTCTGGTCCAGTCCTGTCCCGTCCGGTCGAGTCGTGTCGCGTCGG
GTGGTGAAGTGATGTGACGTGAGGTGTAGTGTTGTGTCGTGTGGTGCAGTGCTGTGCCGTGCGGTGGAGTGGTGTGGCGTGGG
GCAGCAAAGCAATGCAACGCAAGGCATAGCATTGCATCGCATGGCACAGCACTGCACCGCACGGCAGAGCAGTGCAGCGCAGG
GCTGCTAAGCTATGCTACGCTAGGCTTAGCTTTGCTTCGCTTGGCTCAGCTCTGCTCCGCTCGGCTGAGCTGTGCTGCGCTGG
GCCGCCAAGCCATGCCACGCCAGGCCTAGCCTTGCCTCGCCTGGCCCAGCCCTGCCCCGCCCGGCCGAGCCGTGCCGCGCCGG
GCGGCGAAGCGATGCGACGCGAGGCGTAGCGTTGCGTCGCGTGGCGCAGCGCTGCGCCGCGCGGCGGAGCGGTGCGGCGCGGG
GGAGGAAAGGAATGGAACGGAAGGGATAGGATTGGATCGGATGGGACAGGACTGGACCGGACGGGAGAGGAGTGGAGCGGAGG
GGTGGTAAGGTATGGTACGGTAGGGTTAGGTTTGGTTCGGTTGGGTCAGGTCTGGTCCGGTCGGGTGAGGTGTGGTGCGGTGG
GGCGGCAAGGCATGGCACGGCAGGGCTAGGCTTGGCTCGGCTGGGCCAGGCCTGGCCCGGCCGGGCGAGGCGTGGCGCGGCGG
GGGGGGAAGGGATGGGACGGGAGGGGTAGGGTTGGGTCGGGTGGGGCAGGGCTGGGCCGGGCGGGGGAGGGGTGGGGCGGGGG
Sampling rate: 1 / 20
overrepresented sequencecount (% of bases)distribution: cycle 1 ~ cycle 150
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA238 (0.005264%)
AAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAG7 (0.000387%)
AAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTG6 (0.000332%)
AAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGA5 (0.000276%)
AAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGA14 (0.000774%)
AAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGG17 (0.000940%)
AAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGA360 (0.019907%)
AAAAGTGCCTGTCTTTAAAAAACAGGACTTCTCCCCGGAGGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAG14 (0.000774%)
AAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGC39 (0.002157%)
AAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGT4 (0.000221%)
AAACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGC82 (0.004534%)
AAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACG13 (0.000719%)
AAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAA4 (0.000221%)
AAAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGT1738 (0.038443%)
AAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGG4 (0.000221%)
AAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAA7 (0.000387%)
AAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGAT3 (0.000166%)
AAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGG37 (0.002046%)
AAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCA12 (0.000664%)
AAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCA26 (0.001438%)
AAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGA9 (0.000498%)
AAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCG18 (0.000995%)
AACAATTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCA3 (0.000166%)
AACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTA14 (0.000774%)
AACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAAT3 (0.000166%)
AACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGC3 (0.000166%)
AACTGCTTAGCCCCCCTGGCCAAGGTCATCCATGACAACTTTGGCATTGTGGAAGGGCTCATGACCACAGTCCATGCCATCACTGCCACCCAGAAGACTG3 (0.000166%)
AACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATG3 (0.000166%)
AACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCG13 (0.000719%)
AACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGT7 (0.000387%)
AAGAAAGACAGGTCACGGGTTCCCTGATAAGTTTCTGAGTTCAGACAATCTCAGTTCTCATCCACTGAGACTCCTGTGCCCTCAGAAACCTTCCCGGCCC146 (0.008073%)
AAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCA22 (0.001217%)
AAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGG7 (0.000387%)
AAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTCACTTTTTTG3 (0.000166%)
AAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCA7 (0.000387%)
AAGACAGGTCACGGGTTCCCTGATAAGTTTCTGAGTTCAGACAATCTCAGTTCTCATCCACTGAGACTCCTGTGCCCTCAGAAACCTTCCCGGCCCACCA3 (0.000166%)
AAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGA5 (0.000276%)
AAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGAT4 (0.000221%)
AAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAAC7 (0.000387%)
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTC2145 (0.047445%)
AAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCAC7 (0.000387%)
AAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTA5 (0.000276%)
AAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGC3 (0.000166%)
AAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGC8 (0.000442%)
AAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCA5 (0.000276%)
AATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAA8 (0.000442%)
AATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAG3 (0.000166%)
AATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTG4 (0.000221%)
AATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTC25 (0.001382%)
AATTAATCCCAAATTGATCGCTAATTTGGAGGTGATCCCTGCAGGTCCACAGTGCCCTACGGTGGAAGTCATAGCTAAACTGAAAAACCAGAAGGAGGTC3 (0.000166%)
ACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACG3 (0.000166%)
ACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGC7 (0.000387%)
ACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTC3 (0.000166%)
ACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAG4 (0.000221%)
ACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGG3 (0.000166%)
ACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGT12 (0.000664%)
ACCAACTGCTTAGCCCCCCTGGCCAAGGTCATCCATGACAACTTTGGCATTGTGGAAGGGCTCATGACCACAGTCCATGCCATCACTGCCACCCAGAAGA3 (0.000166%)
ACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTAC9 (0.000498%)
ACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCA15 (0.000829%)
ACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCA3 (0.000166%)
ACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGT3 (0.000166%)
ACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCT5 (0.000276%)
ACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCC4 (0.000221%)
ACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGG5 (0.000276%)
ACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTC6 (0.000332%)
ACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGC3 (0.000166%)
ACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGAT3 (0.000166%)
ACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCAT7 (0.000387%)
ACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTG4 (0.000221%)
ACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCC9 (0.000498%)
ACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTA4 (0.000221%)
ACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCA4 (0.000221%)
AGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCA12 (0.000664%)
AGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAG5 (0.000276%)
AGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCAT4 (0.000221%)
AGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCT10 (0.000553%)
AGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTT6 (0.000332%)
AGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGA7 (0.000387%)
AGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAAC166 (0.009179%)
AGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGG5 (0.000276%)
AGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGAC3 (0.000166%)
AGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCT5 (0.000276%)
AGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGT3740 (0.082725%)
AGAGCACACGTCTGAACTCCAGTCACTCGTCGCTAAATCG6 (0.000133%)
AGAGCACACGTCTGAACTCCAGTCACTCGTCGCTAAATCT17 (0.000376%)
AGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCC6 (0.000332%)
AGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAAT6 (0.000332%)
AGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTG4 (0.000221%)
AGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGG8 (0.000442%)
AGCACACGTCTGAACTCCAGTCACTCGTCGCTAAATCTCG11 (0.000243%)
AGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAAC3 (0.000166%)
AGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCA3 (0.000166%)
AGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCAT9 (0.000498%)
AGCCAAGGCTGAAGCTCTGATGTACCCAGTCTACAAGTCCTCCACAGACTTGTCCCGTTTCCATCTCTCTCAAGATGATGTAGATGGTATTCAGTCCCTC4 (0.000221%)
AGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCT40 (0.002212%)
AGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAG3 (0.000166%)
AGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCC3 (0.000166%)
AGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAG6 (0.000332%)
AGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAA3 (0.000166%)
AGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCC6 (0.000332%)
AGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGC3 (0.000166%)
AGCTATCTTCCTGGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTA250 (0.013824%)
AGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGG7 (0.000387%)
AGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACT6 (0.000332%)
AGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTAT13 (0.000719%)
AGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCT4 (0.000221%)
AGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGA16 (0.000885%)
AGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCC3 (0.000166%)
AGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCC4 (0.000221%)
AGGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAGGGG5 (0.000276%)
AGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCA13 (0.000719%)
AGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGT6 (0.000332%)
AGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCAT37 (0.002046%)
AGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATG7 (0.000387%)
AGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGA3 (0.000166%)
AGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAG4 (0.000221%)
AGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAG8 (0.000442%)
AGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTT10 (0.000553%)
ATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGC7 (0.000387%)
ATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACT7 (0.000387%)
ATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCC5 (0.000276%)
ATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTG3 (0.000166%)
ATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTA9 (0.000498%)
ATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACT5 (0.000276%)
ATATGTATATGTATATGTATATGTATATGTATATGTATAT281 (0.006215%)
ATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATAC3 (0.000166%)
ATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCC5 (0.000276%)
ATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGCAG10 (0.000553%)
ATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGAT12 (0.000664%)
ATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATC9 (0.000498%)
ATCAGTCTCAGTGGGGGTGAATTCAGTGTGAGCCAGGATATAGAAAGACCAGTCCTTGCTGAAGGACATATCTGACATCTCTACTTTAGGAATTTTTTTC3 (0.000166%)
ATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACA24 (0.001327%)
ATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGG7 (0.000387%)
ATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGG8 (0.000442%)
ATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATG7 (0.000387%)
ATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTA9 (0.000498%)
ATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTCGCT28 (0.000619%)
ATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAG21 (0.001161%)
ATCTGTGTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTC9 (0.000498%)
ATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGT3 (0.000166%)
ATGACCTCCAGATCTCTCGGAATATCAGAAACTGTGGCTTGCTGGCCAATCAGTGGCGGGCTCTCCTCTCTGCCATTAACAGCAATGATGCTGACAACGT3 (0.000166%)
ATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCT7 (0.000387%)
ATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAAC24 (0.001327%)
ATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCA3 (0.000166%)
ATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGAT19 (0.001051%)
ATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTG12 (0.000664%)
ATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGA18 (0.000995%)
ATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTG14 (0.000774%)
ATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGA3 (0.000166%)
ATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACG7 (0.000387%)
ATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATA3 (0.000166%)
ATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCA6 (0.000332%)
ATGGCCTCCTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGATCGTTCTGAAACTCGAGGAGACGCT3 (0.000166%)
ATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAA4 (0.000221%)
ATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACA4 (0.000221%)
ATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGAC6 (0.000332%)
ATTAATCCCAAATTGATCGCTAATTTGGAGGTGATCCCTGCAGGTCCACAGTGCCCTACGGTGGAAGTCATAGCTAAACTGAAAAACCAGAAGGAGGTCT6 (0.000332%)
ATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTG8 (0.000442%)
ATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGG5 (0.000276%)
ATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAG6 (0.000332%)
ATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGT4 (0.000221%)
ATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAG49 (0.002710%)
ATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGG6 (0.000332%)
ATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAG4 (0.000221%)
ATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACA9 (0.000498%)
ATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTT50 (0.002765%)
CAAAAATTAATCCCAAATTGATCGCTAATTTGGAGGTGATCCCTGCAGGTCCACAGTGCCCTACGGTGGAAGTCATAGCTAAACTGAAAAACCAGAAGGA8 (0.000442%)
CAAAAGTGCCTGTCTTTAAAAAACAGGACTTCTCCCCGGAGGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCA230 (0.012718%)
CAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCG17 (0.000940%)
CAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCAC8 (0.000442%)
CAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGT3 (0.000166%)
CAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAG18 (0.000995%)
CAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACA238 (0.013161%)
CAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGC26 (0.001438%)
CAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAG31 (0.001714%)
CAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGCAGCTTCAGCT3 (0.000166%)
CAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTC8 (0.000442%)
CAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAA24 (0.001327%)
CAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGG3 (0.000166%)
CAACTGCTTAGCCCCCCTGGCCAAGGTCATCCATGACAACTTTGGCATTGTGGAAGGGCTCATGACCACAGTCCATGCCATCACTGCCACCCAGAAGACT3 (0.000166%)
CAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACC25 (0.001382%)
CAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGC31 (0.001714%)
CAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCG4 (0.000221%)
CAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAGTTTTCTCTTC12 (0.000664%)
CAAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGT2807 (0.062088%)
CAAGGCTGAAGCTCTGATGTACCCAGTCTACAAGTCCTCCACAGACTTGTCCCGTTTCCATCTCTCTCAAGATGATGTAGATGGTATTCAGTCCCTCTAT8 (0.000442%)
CAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTG18 (0.000995%)
CAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCC13 (0.000719%)
CAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTT12 (0.000664%)
CACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACC73 (0.004037%)
CACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTT55 (0.003041%)
CACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCA19 (0.001051%)
CACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGG12 (0.000664%)
CACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAA6 (0.000332%)
CACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGG15 (0.000829%)
CACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCC5 (0.000276%)
CACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATC6 (0.000332%)
CACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCT3 (0.000166%)
CACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTG16 (0.000885%)
CACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAA12 (0.000664%)
CACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAGGC8 (0.000442%)
CACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACC4 (0.000221%)
CACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTC4 (0.000221%)
CACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTA4 (0.000221%)
CACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCA26 (0.001438%)
CACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCC8 (0.000442%)
CACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGC3 (0.000166%)
CACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATC6 (0.000332%)
CAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACT10 (0.000553%)
CAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTG44 (0.002433%)
CAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGT16 (0.000885%)
CAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGG14 (0.000774%)
CAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGC33 (0.001825%)
CAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCG9 (0.000498%)
CAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAGT7 (0.000387%)
CAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCG5 (0.000276%)
CAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTC3598 (0.079584%)
CAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTCACT3 (0.000166%)
CAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACG5 (0.000276%)
CAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAG719 (0.039759%)
CAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGC8 (0.000442%)
CAGCAATGCATCCTGCACCACCAACTGCTTAGCCCCCCTGGCCAAGGTCATCCATGACAACTTTGGCATTGTGGAAGGGCTCATGACCACAGTCCATGCC10 (0.000553%)
CAGCAGCCTCCTAGATCATGTGTTGGTACGAGGCTAGAATGATAGAACGCTCAGAAGAATCCTGCAAAGAAAAATACTTCCGAGACGATGAATAGAATTA131 (0.007244%)
CAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCA11 (0.000608%)
CAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAA6 (0.000332%)
CAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGA3 (0.000166%)
CAGCTCCATAGTGTTGGAGTCCAGCTTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTACTGTCCTTTTTC6 (0.000332%)
CAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCG631 (0.034893%)
CAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTC16 (0.000885%)
CAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAA7 (0.000387%)
CAGCTTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTACTGTCCTTTTTCTTAATAAATTGCTTCACATCT3 (0.000166%)
CAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTC27 (0.001493%)
CAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGG29 (0.001604%)
CAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAGGCCCTCTTGG5 (0.000276%)
CAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGG5 (0.000276%)
CAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGG22 (0.001217%)
CAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTC17 (0.000940%)
CAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCA5 (0.000276%)
CAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCAT13 (0.000719%)
CAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCT4 (0.000221%)
CAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCT3 (0.000166%)
CAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATA4 (0.000221%)
CAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAGTTTTCTCTTCCTGTTGTTCCC5 (0.000276%)
CAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGT3 (0.000166%)
CATAAAGAAAATCCGTGGGTGGAGAGAATCAGCCCTTTCTTCTTATCTTCACTGGGGTCAGAGTCCTCAGAAATCTTTCTATTGAACACTGGCCGTTCTT170 (0.009401%)
CATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGA5 (0.000276%)
CATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTC10 (0.000553%)
CATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCC5 (0.000276%)
CATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTG7 (0.000387%)
CATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTT9 (0.000498%)
CATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAG710 (0.039261%)
CATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAA4 (0.000221%)
CATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCT9 (0.000498%)
CATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATA4 (0.000221%)
CATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATG4 (0.000221%)
CATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGAC4 (0.000221%)
CATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCG3 (0.000166%)
CATTTTTCTGCCAGGCAGCATTGAGCAGCCAGAAGAAACTCTTGTACTCTACTCGTGCTTAAACACATGATGTGGTGTGATTCCAGATAAGCCTTTCCTA3 (0.000166%)
CCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGCAGCTTCAGC3 (0.000166%)
CCAAATTGATCGCTAATTTGGAGGTGATCCCTGCAGGTCCACAGTGCCCTACGGTGGAAGTCATAGCTAAACTGAAAAACCAGAAGGAGGTCTGTCTGGA4 (0.000221%)
CCAAGGCTGAAGCTCTGATGTACCCAGTCTACAAGTCCTCCACAGACTTGTCCCGTTTCCATCTCTCTCAAGATGATGTAGATGGTATTCAGTCCCTCTA3 (0.000166%)
CCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTT4 (0.000221%)
CCACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGT21 (0.001161%)
CCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTG8 (0.000442%)
CCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACAT9 (0.000498%)
CCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCC5 (0.000276%)
CCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGG156 (0.008626%)
CCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTT6 (0.000332%)
CCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGT3241 (0.071687%)
CCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCC29 (0.001604%)
CCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAA12 (0.000664%)
CCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACG3 (0.000166%)
CCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGT33 (0.001825%)
CCAGCTTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTACTGTCCTTTTTCTTAATAAATTGCTTCACATC3 (0.000166%)
CCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAGGCCCTCTTG15 (0.000829%)
CCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAG11 (0.000608%)
CCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTT122 (0.006746%)
CCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTG7 (0.000387%)
CCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCA572 (0.031630%)
CCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGG23 (0.001272%)
CCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAAT10 (0.000553%)
CCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCC4 (0.000221%)
CCCAAATTGATCGCTAATTTGGAGGTGATCCCTGCAGGTCCACAGTGCCCTACGGTGGAAGTCATAGCTAAACTGAAAAACCAGAAGGAGGTCTGTCTGG8 (0.000442%)
CCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGC13 (0.000719%)
CCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTA5 (0.000276%)
CCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATT916 (0.050652%)
CCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTG24 (0.001327%)
CCCCCCCCCCCCCCCCCCCC793 (0.008770%)
CCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCC5 (0.000276%)
CCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAG3 (0.000166%)
CCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCG9 (0.000498%)
CCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGC201 (0.011115%)
CCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCA19 (0.001051%)
CCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCC17 (0.000940%)
CCCGTATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAA137 (0.007576%)
CCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCAT10 (0.000553%)
CCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGT5 (0.000276%)
CCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGA23 (0.001272%)
CCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAA4 (0.000221%)
CCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGG3 (0.000166%)
CCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAAT53 (0.002931%)
CCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGG56 (0.003097%)
CCGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTCT5 (0.000276%)
CCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATAC9 (0.000498%)
CCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCT19 (0.001051%)
CCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCT36 (0.001991%)
CCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAG24 (0.001327%)
CCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCC14 (0.000774%)
CCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGC6 (0.000332%)
CCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATG23 (0.001272%)
CCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACT4 (0.000221%)
CCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTG12 (0.000664%)
CCTAGATCATGTGTTGGTACGAGGCTAGAATGATAGAACGCTCAGAAGAATCCTGCAAAGAAAAATACTTCCGAGACGATGAATAGAATTATACCATATC7 (0.000387%)
CCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCA7 (0.000387%)
CCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATA5 (0.000276%)
CCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTC8 (0.000442%)
CCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCA3 (0.000166%)
CCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCAT7 (0.000387%)
CCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCAT11 (0.000608%)
CCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAG18 (0.000995%)
CCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTT6 (0.000332%)
CCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATA13 (0.000719%)
CCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTG30 (0.001659%)
CCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAG5 (0.000276%)
CCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAA23 (0.001272%)
CCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGG7 (0.000387%)
CCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGC25 (0.001382%)
CCTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGATCGTTCTGAAACTCGAGGAGACGCTCCGCGCC3 (0.000166%)
CCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTC20 (0.001106%)
CCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTC3 (0.000166%)
CGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATC27 (0.001493%)
CGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCAC9 (0.000498%)
CGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGT1842 (0.040743%)
CGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAG16 (0.000885%)
CGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGA14 (0.000774%)
CGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTCTG4 (0.000221%)
CGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGA5 (0.000276%)
CGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTG60 (0.003318%)
CGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACT15 (0.000829%)
CGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGC33 (0.001825%)
CGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTC39 (0.002157%)
CGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCT32 (0.001770%)
CGGAAGAGCACACGTCTGAACTCCAGTCACTCGTCGCTAA15 (0.000332%)
CGGAATATCAGAAACTGTGGCTTGCTGGCCAATCAGTGGCGGGCTCTCCTCTCTGCCATTAACAGCAATGATGCTGACAACGTACTCGGTGCCCGGATTA3 (0.000166%)
CGGAGGGGCAGGTTCTGGTATTGGATGGCCGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGT67 (0.003705%)
CGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTG23 (0.001272%)
CGGAGGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAG134 (0.007410%)
CGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATA49 (0.002710%)
CGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCA49 (0.002710%)
CGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAA12 (0.000664%)
CGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCAC18 (0.000995%)
CGGGGAGCAGCTGCAGGCGTCGGCCGGGCGCAGCAGCGTGGCTAGCAGCAGGAGGCCGAGCGCCAGCCGGAGGCTGCGGGCCGCGGCGCCCATGGCGGGC3 (0.000166%)
CGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGT48 (0.002654%)
CGGGTGCACCGGGGAGCAGCTGCAGGCGTCGGCCGGGCGCAGCAGCGTGGCTAGCAGCAGGAGGCCGAGCGCCAGCCGGAGGCTGCGGGCCGCGGCGCCC4 (0.000221%)
CGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCT5 (0.000276%)
CGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCG61 (0.003373%)
CGTAACTCCAAAAATTAATCCCAAATTGATCGCTAATTTGGAGGTGATCCCTGCAGGTCCACAGTGCCCTACGGTGGAAGTCATAGCTAAACTGAAAAAC133 (0.007355%)
CGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCAT4 (0.000221%)
CGTATGTATCAGTCTCAGTGGGGGTGAATTCAGTGTGAGCCAGGATATAGAAAGACCAGTCCTTGCTGAAGGACATATCTGACATCTCTACTTTAGGAAT5 (0.000276%)
CGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTC574 (0.031741%)
CGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGG42 (0.002322%)
CGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTG3 (0.000166%)
CGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATC7 (0.000387%)
CTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGA7 (0.000387%)
CTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGAT18 (0.000995%)
CTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGG11 (0.000608%)
CTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAA12 (0.000664%)
CTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAG3 (0.000166%)
CTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAG19 (0.001051%)
CTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGC9 (0.000498%)
CTATCTTCCTGGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTATT5 (0.000276%)
CTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAGTTTTCTCT15 (0.000829%)
CTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCT9 (0.000498%)
CTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTCA14 (0.000774%)
CTCAGCCAAGGCTGAAGCTCTGATGTACCCAGTCTACAAGTCCTCCACAGACTTGTCCCGTTTCCATCTCTCTCAAGATGATGTAGATGGTATTCAGTCC344 (0.019022%)
CTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAG12 (0.000664%)
CTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATAC7 (0.000387%)
CTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGCAGCTTCA3 (0.000166%)
CTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCG29 (0.001604%)
CTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCA4 (0.000221%)
CTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGA7 (0.000387%)
CTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCC25 (0.001382%)
CTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCG4 (0.000221%)
CTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTAT11 (0.000608%)
CTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAG30 (0.001659%)
CTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCT9 (0.000498%)
CTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAG5 (0.000276%)
CTCCTAGATCATGTGTTGGTACGAGGCTAGAATGATAGAACGCTCAGAAGAATCCTGCAAAGAAAAATACTTCCGAGACGATGAATAGAATTATACCATA6 (0.000332%)
CTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCA58 (0.003207%)
CTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATC25 (0.001382%)
CTCCTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGATCGTTCTGAAACTCGAGGAGACGCTCCGCG3 (0.000166%)
CTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCT206 (0.011391%)
CTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCC36 (0.001991%)
CTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCT34 (0.001880%)
CTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATC27 (0.001493%)
CTCGGAATATCAGAAACTGTGGCTTGCTGGCCAATCAGTGGCGGGCTCTCCTCTCTGCCATTAACAGCAATGATGCTGACAACGTACTCGGTGCCCGGAT4 (0.000221%)
CTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGA123 (0.006802%)
CTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTT101 (0.005585%)
CTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGG12 (0.000664%)
CTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTT25 (0.001382%)
CTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCT10 (0.000553%)
CTCTGATGTACCCAGTCTACAAGTCCTCCACAGACTTGTCCCGTTTCCATCTCTCTCAAGATGATGTAGATGGTATTCAGTCCCTCTATGGAACTCCCAC23 (0.001272%)
CTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAG151 (0.008350%)
CTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTT52 (0.002875%)
CTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCATGAGCCAAGACTGTTCCAGGCCCATCAAAAGGG137 (0.007576%)
CTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAGGCCC7 (0.000387%)
CTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGC38 (0.002101%)
CTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTC12 (0.000664%)
CTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAAC3 (0.000166%)
CTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTG6 (0.000332%)
CTGAAGCTCTGATGTACCCAGTCTACAAGTCCTCCACAGACTTGTCCCGTTTCCATCTCTCTCAAGATGATGTAGATGGTATTCAGTCCCTCTATGGAAC11 (0.000608%)
CTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGA16 (0.000885%)
CTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTAT21 (0.001161%)
CTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTT6 (0.000332%)
CTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGC20 (0.001106%)
CTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGA43 (0.002378%)
CTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAGTTTTCTCTTCCTGTTG3 (0.000166%)
CTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTT13 (0.000719%)
CTGATGTACCCAGTCTACAAGTCCTCCACAGACTTGTCCCGTTTCCATCTCTCTCAAGATGATGTAGATGGTATTCAGTCCCTCTATGGAACTCCCACAG3 (0.000166%)
CTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATT20 (0.001106%)
CTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAA9 (0.000498%)
CTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATT14 (0.000774%)
CTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGC3 (0.000166%)
CTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAA21 (0.001161%)
CTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAG24 (0.001327%)
CTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTAC17 (0.000940%)
CTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGA3 (0.000166%)
CTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCT27 (0.001493%)
CTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTT267 (0.014764%)
CTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTC18 (0.000995%)
CTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATG13 (0.000719%)
CTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTT32 (0.001770%)
CTGCTTAGCCCCCCTGGCCAAGGTCATCCATGACAACTTTGGCATTGTGGAAGGGCTCATGACCACAGTCCATGCCATCACTGCCACCCAGAAGACTGTG3 (0.000166%)
CTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAAC34 (0.001880%)
CTGGACCATTTTTCTGCCAGGCAGCATTGAGCAGCCAGAAGAAACTCTTGTACTCTACTCGTGCTTAAACACATGATGTGGTGTGATTCCAGATAAGCCT26 (0.001438%)
CTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAAT16 (0.000885%)
CTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCC70 (0.003871%)
CTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGA14 (0.000774%)
CTGGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTATTAGAAATGG4 (0.000221%)
CTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAAT31 (0.001714%)
CTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGATCGTTCTGAAACTCGAGGAGACGCTCCGCGCCC18 (0.000995%)
CTGGTATTGGATGGCCGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAG21 (0.001161%)
CTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGA6 (0.000332%)
CTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCA3 (0.000166%)
CTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGC8 (0.000442%)
CTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGG8 (0.000442%)
CTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAG97 (0.005364%)
CTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATG9 (0.000498%)
CTGTGTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCG24 (0.001327%)
CTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCC11 (0.000608%)
CTTAGCCCCCCTGGCCAAGGTCATCCATGACAACTTTGGCATTGTGGAAGGGCTCATGACCACAGTCCATGCCATCACTGCCACCCAGAAGACTGTGGAT4 (0.000221%)
CTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTG17 (0.000940%)
CTTATGCATCAGCTCCATAGTGTTGGAGTCCAGCTTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTACTG20 (0.001106%)
CTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCT9 (0.000498%)
CTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTC29 (0.001604%)
CTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGA10 (0.000553%)
CTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCC15 (0.000829%)
CTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACA14 (0.000774%)
CTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAA17 (0.000940%)
CTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGC4 (0.000221%)
CTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAGGCCCTC3 (0.000166%)
CTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTC30 (0.001659%)
CTTCCATGGCCTCCTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGATCGTTCTGAAACTCGAGGAG7 (0.000387%)
CTTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTACTGTCCTTTTTCTTAATAAATTGCTTCACATCTTTT30 (0.001659%)
CTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCA41 (0.002267%)
CTTCCTGGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTATTAGAA8 (0.000442%)
CTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTC26 (0.001438%)
CTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGG26 (0.001438%)
CTTCTCCATGGCCAAGGCAGCTTCCATGGCCTCCTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGA16 (0.000885%)
CTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTAT50 (0.002765%)
CTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACC58 (0.003207%)
CTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAG67 (0.003705%)
CTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAA11 (0.000608%)
CTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCA27 (0.001493%)
CTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTG11 (0.000608%)
CTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAG31 (0.001714%)
CTTGGCCATGGAGAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCAC253 (0.013990%)
CTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCA24 (0.001327%)
CTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCA27 (0.001493%)
CTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCAT24 (0.001327%)
CTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTAT15 (0.000829%)
CTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCA15 (0.000829%)
CTTTGCAGTTGGAGAACATGGAGACTTTGTCCCTTTTGATGGGCCTGGAACAGTCTTGGCTCATGCCTATGCACCTGGACCAGGGATTAATGGAGATGCT9 (0.000498%)
CTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGC3 (0.000166%)
GAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGA40 (0.002212%)
GAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTG14 (0.000774%)
GAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAG50 (0.002765%)
GAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGG6 (0.000332%)
GAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATC8 (0.000442%)
GAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTG35 (0.001935%)
GAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTATTAGAAATGGCAGC3 (0.000166%)
GAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCA6 (0.000332%)
GAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCT3 (0.000166%)
GAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTC3 (0.000166%)
GAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTG22 (0.001217%)
GAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCG5 (0.000276%)
GAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCG7 (0.000387%)
GAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGA103 (0.005696%)
GAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAG91 (0.005032%)
GAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAG12 (0.000664%)
GAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTCACTTTTTT9 (0.000498%)
GAAGAGCACACGTCTGAACTCCAGTCACTCGTCGCTAAAT94 (0.002079%)
GAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTC58 (0.003207%)
GAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGA108 (0.005972%)
GAAGCTCTGATGTACCCAGTCTACAAGTCCTCCACAGACTTGTCCCGTTTCCATCTCTCTCAAGATGATGTAGATGGTATTCAGTCCCTCTATGGAACTC9 (0.000498%)
GAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCA9 (0.000498%)
GAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAA17 (0.000940%)
GAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCA27 (0.001493%)
GAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAG13 (0.000719%)
GACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTC8 (0.000442%)
GACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTAC5 (0.000276%)
GACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACG13 (0.000719%)
GACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGG3 (0.000166%)
GACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTA3 (0.000166%)
GACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGA4 (0.000221%)
GACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAGTTTTCTCTTCCTGTTGTT3 (0.000166%)
GACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTC5 (0.000276%)
GACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGA4 (0.000221%)
GACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGA10 (0.000553%)
GACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTC3 (0.000166%)
GAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATC16 (0.000885%)
GAGAGAATCAGCCCTTTCTTCTTATCTTCACTGGGGTCAGAGTCCTCAGAAATCTTTCTATTGAACACTGGCCGTTCTTTCCACTGCGAGTGCATTCCGC10 (0.000553%)
GAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATC8 (0.000442%)
GAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAA14 (0.000774%)
GAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTC2063 (0.045631%)
GAGCACACGTCTGAACTCCAGTCACTCGTCGCTAAATCGC7 (0.000155%)
GAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTC5 (0.000276%)
GAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGC7 (0.000387%)
GAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCC6 (0.000332%)
GAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAA32 (0.002619%)
GAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAGTTTTCTCTTCCTG5 (0.000276%)
GAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGAT5 (0.000276%)
GAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAGTTT20 (0.001106%)
GAGGCAATGACCTCCAGATCTCTCGGAATATCAGAAACTGTGGCTTGCTGGCCAATCAGTGGCGGGCTCTCCTCTCTGCCATTAACAGCAATGATGCTGA3 (0.000166%)
GAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGG3 (0.000166%)
GAGGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAGGG3 (0.000166%)
GAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAG7 (0.000387%)
GAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTC6 (0.000332%)
GATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGT4 (0.000221%)
GATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAAC5 (0.000276%)
GATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTC7 (0.000387%)
GATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGG5 (0.000276%)
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTCGC101 (0.002234%)
GATCTGTGTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCT14 (0.000774%)
GATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGT4 (0.000221%)
GATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACA11 (0.000608%)
GATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTC12 (0.000664%)
GATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACA3 (0.000166%)
GATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGA22 (0.001217%)
GATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCA6 (0.000332%)
GATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGC11 (0.000608%)
GCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGG36 (0.001991%)
GCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCAC640 (0.035390%)
GCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACT27 (0.001493%)
GCACCGGGGAGCAGCTGCAGGCGTCGGCCGGGCGCAGCAGCGTGGCTAGCAGCAGGAGGCCGAGCGCCAGCCGGAGGCTGCGGGCCGCGGCGCCCATGGC3 (0.000166%)
GCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAGG5 (0.000276%)
GCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGT10 (0.000553%)
GCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCC19 (0.001051%)
GCACTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCT23 (0.001272%)
GCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCAC46 (0.002544%)
GCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAG4 (0.000221%)
GCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGT3194 (0.070648%)
GCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGG4 (0.000221%)
GCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTC5 (0.000276%)
GCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATA11 (0.000608%)
GCAGCTTCCATGGCCTCCTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGATCGTTCTGAAACTCGA16 (0.000885%)
GCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTG82 (0.004534%)
GCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAG43 (0.002378%)
GCAGGTTCTGGTATTGGATGGCCGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGC18 (0.000995%)
GCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAG4 (0.000221%)
GCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTAT5 (0.000276%)
GCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATT3 (0.000166%)
GCATCAGCTCCATAGTGTTGGAGTCCAGCTTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTACTGTCCTT4 (0.000221%)
GCATCCTGCACCACCAACTGCTTAGCCCCCCTGGCCAAGGTCATCCATGACAACTTTGGCATTGTGGAAGGGCTCATGACCACAGTCCATGCCATCACTG4 (0.000221%)
GCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGT3 (0.000166%)
GCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTC15 (0.000829%)
GCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGA10 (0.000553%)
GCCAAGGCAGCTTCCATGGCCTCCTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGATCGTTCTGAA5 (0.000276%)
GCCAAGGCTGAAGCTCTGATGTACCCAGTCTACAAGTCCTCCACAGACTTGTCCCGTTTCCATCTCTCTCAAGATGATGTAGATGGTATTCAGTCCCTCT8 (0.000442%)
GCCAAGTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGT377 (0.020847%)
GCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCT87 (0.004811%)
GCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACA22 (0.001217%)
GCCACTCACCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACAT362 (0.029626%)
GCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTT73 (0.004037%)
GCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAG136 (0.007520%)
GCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTG89 (0.004921%)
GCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTT5 (0.000276%)
GCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTG7 (0.000387%)
GCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAA14 (0.000774%)
GCCATGGAGAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATC6 (0.000332%)
GCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGT11 (0.000608%)
GCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAA128 (0.007078%)
GCCGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTC14 (0.000774%)
GCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAA18 (0.000995%)
GCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCT21 (0.001161%)
GCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCC11 (0.000608%)
GCCTCCTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGATCGTTCTGAAACTCGAGGAGACGCTCCG6 (0.000332%)
GCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGT7 (0.000387%)
GCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAA38 (0.002101%)
GCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGA11 (0.000608%)
GCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAG50 (0.002765%)
GCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCA83 (0.004590%)
GCGGGTGCACCGGGGAGCAGCTGCAGGCGTCGGCCGGGCGCAGCAGCGTGGCTAGCAGCAGGAGGCCGAGCGCCAGCCGGAGGCTGCGGGCCGCGGCGCC5 (0.000276%)
GCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCG32 (0.001770%)
GCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCA5 (0.000276%)
GCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAG6 (0.000332%)
GCTATCTTCCTGGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTAT4 (0.000221%)
GCTCCATAGTGTTGGAGTCCAGCTTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTACTGTCCTTTTTCTT4 (0.000221%)
GCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCC61 (0.003373%)
GCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTA70 (0.003871%)
GCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGC20 (0.001106%)
GCTCTGATGTACCCAGTCTACAAGTCCTCCACAGACTTGTCCCGTTTCCATCTCTCTCAAGATGATGTAGATGGTATTCAGTCCCTCTATGGAACTCCCA3 (0.000166%)
GCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGG14 (0.000774%)
GCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAA16 (0.000885%)
GCTGAAGCTCTGATGTACCCAGTCTACAAGTCCTCCACAGACTTGTCCCGTTTCCATCTCTCTCAAGATGATGTAGATGGTATTCAGTCCCTCTATGGAA10 (0.000553%)
GCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTA132 (0.007299%)
GCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAGGGGATGCT59 (0.003263%)
GCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCT11 (0.000608%)
GCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTG5 (0.000276%)
GCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATG17 (0.000940%)
GCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGG13 (0.000719%)
GCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCG44 (0.002433%)
GCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGAC359 (0.019852%)
GCTTAGCCCCCCTGGCCAAGGTCATCCATGACAACTTTGGCATTGTGGAAGGGCTCATGACCACAGTCCATGCCATCACTGCCACCCAGAAGACTGTGGA4 (0.000221%)
GCTTATGCATCAGCTCCATAGTGTTGGAGTCCAGCTTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTACT7 (0.000387%)
GCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCT9 (0.000498%)
GCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCAC11 (0.000608%)
GCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACA46 (0.002544%)
GCTTCCATGGCCTCCTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGATCGTTCTGAAACTCGAGGA4 (0.000221%)
GCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTG5 (0.000276%)
GCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCAC8 (0.000442%)
GCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTC45 (0.002488%)
GGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAG25 (0.001382%)
GGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGT21 (0.001161%)
GGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTATTAGAAATGGCAG5 (0.000276%)
GGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCC19 (0.001051%)
GGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTC35 (0.001935%)
GGAAGAGCACACGTCTGAACTCCAGTCACTCGTCGCTAAA42 (0.000929%)
GGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTT51 (0.002820%)
GGAATATCAGAAACTGTGGCTTGCTGGCCAATCAGTGGCGGGCTCTCCTCTCTGCCATTAACAGCAATGATGCTGACAACGTACTCGGTGCCCGGATTAA6 (0.000332%)
GGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAGTTTTC13 (0.000719%)
GGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGAT43 (0.002378%)
GGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGAT18 (0.000995%)
GGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGT2499 (0.055275%)
GGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACT3 (0.000166%)
GGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGA67 (0.005483%)
GGAGGGGCAGGTTCTGGTATTGGATGGCCGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTC6 (0.000332%)
GGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGA9 (0.000498%)
GGAGGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAGG13 (0.000719%)
GGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATT48 (0.002654%)
GGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCT9 (0.000498%)
GGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAA4 (0.000221%)
GGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGC4 (0.000221%)
GGATCTGTGTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCC20 (0.001106%)
GGATGGCCGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAAC7 (0.000387%)
GGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTG3 (0.000166%)
GGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATG52 (0.002875%)
GGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGG8 (0.000442%)
GGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGT18 (0.000995%)
GGCAGCTTCCATGGCCTCCTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGATCGTTCTGAAACTCG4 (0.000221%)
GGCAGGTTCTGGTATTGGATGGCCGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACG8 (0.000442%)
GGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAG12 (0.000664%)
GGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAG12 (0.000664%)
GGCCAAGGCAGCTTCCATGGCCTCCTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGATCGTTCTGA3 (0.000166%)
GGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCAC25 (0.001382%)
GGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTCTGGAA3 (0.000166%)
GGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGA9 (0.000498%)
GGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGA3 (0.000166%)
GGCCTCCTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGATCGTTCTGAAACTCGAGGAGACGCTCC4 (0.000221%)
GGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGG44 (0.002433%)
GGCGTATGTATCAGTCTCAGTGGGGGTGAATTCAGTGTGAGCCAGGATATAGAAAGACCAGTCCTTGCTGAAGGACATATCTGACATCTCTACTTTAGGA88 (0.004866%)
GGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCA3 (0.000166%)
GGCTGAAGCTCTGATGTACCCAGTCTACAAGTCCTCCACAGACTTGTCCCGTTTCCATCTCTCTCAAGATGATGTAGATGGTATTCAGTCCCTCTATGGA4 (0.000221%)
GGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTT5 (0.000276%)
GGCTTATGCATCAGCTCCATAGTGTTGGAGTCCAGCTTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTAC18 (0.000995%)
GGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCT11 (0.000608%)
GGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTATTAGAAATGGCA27 (0.001493%)
GGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAA33 (0.001825%)
GGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCA6 (0.000332%)
GGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGA70 (0.003871%)
GGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGG9 (0.000498%)
GGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCT26 (0.001438%)
GGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTG11 (0.000608%)
GGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTG10 (0.000553%)
GGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACT25 (0.001382%)
GGGCTTATGCATCAGCTCCATAGTGTTGGAGTCCAGCTTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTA7 (0.000387%)
GGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGC5 (0.000276%)
GGGGAGCAGCTGCAGGCGTCGGCCGGGCGCAGCAGCGTGGCTAGCAGCAGGAGGCCGAGCGCCAGCCGGAGGCTGCGGGCCGCGGCGCCCATGGCGGGCG3 (0.000166%)
GGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTC40 (0.002212%)
GGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGT39 (0.002157%)
GGGGCAGGTTCTGGTATTGGATGGCCGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTA4 (0.000221%)
GGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCT4 (0.000221%)
GGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACC230 (0.012718%)
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG621 (0.013736%)
GGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCA12 (0.000664%)
GGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAGGGGA6 (0.000332%)
GGGTGGAGAGAATCAGCCCTTTCTTCTTATCTTCACTGGGGTCAGAGTCCTCAGAAATCTTTCTATTGAACACTGGCCGTTCTTTCCACTGCGAGTGCAT3 (0.000166%)
GGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCAC35 (0.001935%)
GGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTG11 (0.000608%)
GGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCG3 (0.000166%)
GGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTC3 (0.000166%)
GGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTG4 (0.000221%)
GGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGC4 (0.000221%)
GGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTT19 (0.001051%)
GGTGGAGGCAATGACCTCCAGATCTCTCGGAATATCAGAAACTGTGGCTTGCTGGCCAATCAGTGGCGGGCTCTCCTCTCTGCCATTAACAGCAATGATG41 (0.002267%)
GGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACC8 (0.000442%)
GGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAGCTA5 (0.000276%)
GGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTC12 (0.000664%)
GGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAA19 (0.001051%)
GTAACTCCAAAAATTAATCCCAAATTGATCGCTAATTTGGAGGTGATCCCTGCAGGTCCACAGTGCCCTACGGTGGAAGTCATAGCTAAACTGAAAAACC4 (0.000221%)
GTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATG15 (0.000829%)
GTAGGGCACTGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTG346 (0.019133%)
GTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGG34 (0.001880%)
GTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGG31 (0.001714%)
GTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTC39 (0.002157%)
GTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGC30 (0.001659%)
GTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATT16 (0.000885%)
GTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGA27 (0.001493%)
GTCCAGCTTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTACTGTCCTTTTTCTTAATAAATTGCTTCACA4 (0.000221%)
GTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGC6 (0.000332%)
GTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTT5 (0.000276%)
GTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCA38 (0.002101%)
GTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGG6 (0.000332%)
GTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCG5 (0.000276%)
GTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCT13 (0.000719%)
GTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGG12 (0.000664%)
GTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGAC21 (0.001161%)
GTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGA129 (0.007133%)
GTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGA15 (0.000829%)
GTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTC9 (0.000498%)
GTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAA5 (0.000276%)
GTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGC8 (0.000442%)
GTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGA16 (0.000885%)
GTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCA22 (0.001217%)
GTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGAC36 (0.001991%)
GTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTT21 (0.001161%)
GTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCC31 (0.001714%)
GTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAGGGGATG7 (0.000387%)
GTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCC157 (0.008682%)
GTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGT13 (0.000719%)
GTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGAC5 (0.000276%)
GTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTG9 (0.000498%)
GTGGAGGCAATGACCTCCAGATCTCTCGGAATATCAGAAACTGTGGCTTGCTGGCCAATCAGTGGCGGGCTCTCCTCTCTGCCATTAACAGCAATGATGC4 (0.000221%)
GTGGATCTGTGTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAG515 (0.028478%)
GTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGT7 (0.000387%)
GTGTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGG12 (0.000664%)
GTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGT13 (0.000719%)
GTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAG15 (0.000829%)
GTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCT17 (0.000940%)
GTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAAC9 (0.000498%)
GTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTG25 (0.001382%)
GTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCC122 (0.006746%)
GTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTG6 (0.000332%)
GTTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGG16 (0.000885%)
GTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATC11 (0.000608%)
GTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCA10 (0.000553%)
GTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATC12 (0.000664%)
GTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCC16 (0.000885%)
GTTGGAGTCCAGCTTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTACTGTCCTTTTTCTTAATAAATTGC4 (0.000221%)
GTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGA7 (0.000387%)
GTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAA73 (0.004037%)
GTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCT23 (0.001272%)
GTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTT76 (0.004203%)
GTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTT13 (0.000719%)
TAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCT9 (0.000498%)
TAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCA7 (0.000387%)
TAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTT5 (0.000276%)
TAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGAT3 (0.000166%)
TAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTT128 (0.007078%)
TACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGG6 (0.000332%)
TACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCC3 (0.000166%)
TACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGC5 (0.000276%)
TACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATG9 (0.000498%)
TACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAAC5 (0.000276%)
TACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGA4 (0.000221%)
TACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGT3 (0.000166%)
TAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCC7 (0.000387%)
TAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGG21 (0.001161%)
TAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGG21 (0.001161%)
TAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTC3021 (0.066821%)
TAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTC6 (0.000332%)
TAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGG4 (0.000221%)
TAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCC5 (0.000276%)
TAGGGAAGGAGCACAAGTAAGGAACAGTCTGCATGATCCTTCTAGACTCAGCCCTTAGGCATTTTTGCAGCTGAATTTTGTCAGGGAGTGTGTGCCTTTC44 (0.002433%)
TATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTG27 (0.001493%)
TATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTCACTTTTTTGGCATTT3 (0.000166%)
TATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTC14 (0.000774%)
TATATGTATATGTATATGTATATGTATATGTATATGTATA141 (0.003119%)
TATCAGTCTCAGTGGGGGTGAATTCAGTGTGAGCCAGGATATAGAAAGACCAGTCCTTGCTGAAGGACATATCTGACATCTCTACTTTAGGAATTTTTTT6 (0.000332%)
TATGCATCAGCTCCATAGTGTTGGAGTCCAGCTTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTACTGTC5 (0.000276%)
TATGTATATGTATATGTATATGTATATGTATATGTATATG7 (0.000155%)
TATGTATCAGTCTCAGTGGGGGTGAATTCAGTGTGAGCCAGGATATAGAAAGACCAGTCCTTGCTGAAGGACATATCTGACATCTCTACTTTAGGAATTT7 (0.000387%)
TATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGA4 (0.000221%)
TATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGAC7 (0.000387%)
TATTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGA3 (0.000166%)
TATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACG3 (0.000166%)
TATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCAC6 (0.000332%)
TATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGT17 (0.000940%)
TATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGG3 (0.000166%)
TCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGC6 (0.000332%)
TCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCT3 (0.000166%)
TCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCA4 (0.000221%)
TCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAGTTTTCTCTT3 (0.000166%)
TCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCT4 (0.000221%)
TCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATT6 (0.000332%)
TCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCT4 (0.000221%)
TCAGCAATGCATCCTGCACCACCAACTGCTTAGCCCCCCTGGCCAAGGTCATCCATGACAACTTTGGCATTGTGGAAGGGCTCATGACCACAGTCCATGC62 (0.003428%)
TCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATA8 (0.000442%)
TCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCC8 (0.000442%)
TCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACAT7 (0.000387%)
TCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACA5 (0.000276%)
TCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTG3 (0.000166%)
TCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCC457 (0.025271%)
TCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGGGGCAGCTTCAG11 (0.000608%)
TCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGT3 (0.000166%)
TCCACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGG465 (0.025713%)
TCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGC5 (0.000276%)
TCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCAC13 (0.000719%)
TCCAGCTTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTACTGTCCTTTTTCTTAATAAATTGCTTCACAT5 (0.000276%)
TCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAGGCCCTCTT4 (0.000221%)
TCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCT3 (0.000166%)
TCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCC14 (0.000774%)
TCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACC19 (0.001051%)
TCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGT6 (0.000332%)
TCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGC6 (0.000332%)
TCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCA3 (0.000166%)
TCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATG5 (0.000276%)
TCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGG26 (0.001438%)
TCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTACTGTCCTTTTTCTTAATAAATTGCTTCACATCTTTTGC10 (0.000553%)
TCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCAG11 (0.000608%)
TCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCAT16 (0.000885%)
TCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCAT6 (0.000332%)
TCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAA6 (0.000332%)
TCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACT4 (0.000221%)
TCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCG1507 (0.083333%)
TCCTGGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTATTAGAAAT3 (0.000166%)
TCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTT18 (0.000995%)
TCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTT7 (0.000387%)
TCCTTTGCAGTTGGAGAACATGGAGACTTTGTCCCTTTTGATGGGCCTGGAACAGTCTTGGCTCATGCCTATGCACCTGGACCAGGGATTAATGGAGATG245 (0.013548%)
TCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCA15 (0.000829%)
TCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTT7 (0.000387%)
TCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAG21 (0.001161%)
TCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCT4 (0.000221%)
TCGGAAGAGCACACGTCTGAACTCCAGTCACTCGTCGCTA13 (0.000288%)
TCGGAATATCAGAAACTGTGGCTTGCTGGCCAATCAGTGGCGGGCTCTCCTCTCTGCCATTAACAGCAATGATGCTGACAACGTACTCGGTGCCCGGATT11 (0.000608%)
TCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGAT36 (0.001991%)
TCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCC23 (0.001272%)
TCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTC3 (0.000166%)
TCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGA3 (0.000166%)
TCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGA4 (0.000221%)
TCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGC4 (0.000221%)
TCTCCATGGCCAAGGCAGCTTCCATGGCCTCCTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGATC3 (0.000166%)
TCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGC8 (0.000442%)
TCTCGGAATATCAGAAACTGTGGCTTGCTGGCCAATCAGTGGCGGGCTCTCCTCTCTGCCATTAACAGCAATGATGCTGACAACGTACTCGGTGCCCGGA3 (0.000166%)
TCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAG39 (0.002157%)
TCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGT50 (0.002765%)
TCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTT4 (0.000221%)
TCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTT20 (0.001106%)
TCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTG10 (0.000553%)
TCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAA6 (0.000332%)
TCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTC13 (0.000719%)
TCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCT10 (0.000553%)
TCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGT5 (0.000276%)
TCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTC25 (0.001382%)
TCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGA17 (0.000940%)
TCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCATAGGCATGAGCCAAGACTGTTCCAGGCCCATCAAAAGGGA17 (0.000940%)
TCTGTGTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCC36 (0.001991%)
TCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTC9 (0.000498%)
TCTTCTCCATGGCCAAGGCAGCTTCCATGGCCTCCTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCG3 (0.000166%)
TCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCA17 (0.000940%)
TCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAA11 (0.000608%)
TCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACC25 (0.001382%)
TCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTC9 (0.000498%)
TCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTA10 (0.000553%)
TGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGT7 (0.000387%)
TGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGC3 (0.000166%)
TGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAA31 (0.001714%)
TGAAGCTCTGATGTACCCAGTCTACAAGTCCTCCACAGACTTGTCCCGTTTCCATCTCTCTCAAGATGATGTAGATGGTATTCAGTCCCTCTATGGAACT14 (0.000774%)
TGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGC607 (0.033565%)
TGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATG17 (0.000940%)
TGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTA20 (0.001106%)
TGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCT4 (0.000221%)
TGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAG7 (0.000387%)
TGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAG14 (0.000774%)
TGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCT4 (0.000221%)
TGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTT9 (0.000498%)
TGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACT17 (0.000940%)
TGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGTGCAT8 (0.000442%)
TGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCA6 (0.000332%)
TGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATG4 (0.000221%)
TGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGC6 (0.000332%)
TGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGC8 (0.000442%)
TGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGAC23 (0.001272%)
TGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTT7 (0.000387%)
TGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGAC3 (0.000166%)
TGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAG7 (0.000387%)
TGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGC10 (0.000553%)
TGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTA17 (0.000940%)
TGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCA36 (0.001991%)
TGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAAT23 (0.001272%)
TGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGT5 (0.000276%)
TGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACT5 (0.000276%)
TGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAA10 (0.000553%)
TGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTA18 (0.000995%)
TGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATT8 (0.000442%)
TGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAA9 (0.000498%)
TGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTT3 (0.000166%)
TGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTT9 (0.000498%)
TGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCA12 (0.000664%)
TGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGC6 (0.000332%)
TGCGGGTGCACCGGGGAGCAGCTGCAGGCGTCGGCCGGGCGCAGCAGCGTGGCTAGCAGCAGGAGGCCGAGCGCCAGCCGGAGGCTGCGGGCCGCGGCGC3 (0.000166%)
TGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTC6 (0.000332%)
TGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGT17 (0.000940%)
TGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCG6 (0.000332%)
TGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAGGGGATGC6 (0.000332%)
TGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATC5 (0.000276%)
TGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTT14 (0.000774%)
TGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCA7 (0.000387%)
TGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAG5 (0.000276%)
TGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACT23 (0.001272%)
TGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACT8 (0.000442%)
TGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGA12 (0.000664%)
TGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCAT8 (0.000442%)
TGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATC20 (0.001106%)
TGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGAT3 (0.000166%)
TGGATCTGTGTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGC41 (0.002267%)
TGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGAT48 (0.002654%)
TGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCA12 (0.000664%)
TGGCCTCCTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGATCGTTCTGAAACTCGAGGAGACGCTC7 (0.000387%)
TGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGG114 (0.006304%)
TGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGAC14 (0.000774%)
TGGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTATTAGAAATGGC3 (0.000166%)
TGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATG15 (0.000829%)
TGGGCTTATGCATCAGCTCCATAGTGTTGGAGTCCAGCTTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACT287 (0.015870%)
TGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGCGATCGTTCTGAAACTCGAGGAGACGCTCCGCGCCCT4 (0.000221%)
TGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCAT3 (0.000166%)
TGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCG7 (0.000387%)
TGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGT49 (0.002710%)
TGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGT17 (0.000940%)
TGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGA11 (0.000608%)
TGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACT18 (0.000995%)
TGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAG7 (0.000387%)
TGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTG39 (0.002157%)
TGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAG7 (0.000387%)
TGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGA14 (0.000774%)
TGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTG8 (0.000442%)
TGTGGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGA9 (0.000498%)
TGTGTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGG12 (0.000664%)
TGTTGCGGGTGCACCGGGGAGCAGCTGCAGGCGTCGGCCGGGCGCAGCAGCGTGGCTAGCAGCAGGAGGCCGAGCGCCAGCCGGAGGCTGCGGGCCGCGG63 (0.003484%)
TGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCT4 (0.000221%)
TTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACC3 (0.000166%)
TTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACAT4 (0.000221%)
TTAACCGTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACC6 (0.000332%)
TTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGT15 (0.000829%)
TTATGCATCAGCTCCATAGTGTTGGAGTCCAGCTTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTACTGT7 (0.000387%)
TTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTG3 (0.000166%)
TTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGG8 (0.000442%)
TTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAAT3 (0.000166%)
TTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGC5 (0.000276%)
TTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCG11 (0.000608%)
TTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACAT10 (0.000553%)
TTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAG5 (0.000276%)
TTCATGAGCAGCAACCAGGAATAGGTTGGTACCAGTGACATCCTCTGTCCATCGTTCATCATCGTCAAAGTGAGCATCTCCATTAATCCCTGGTCCAGGT10 (0.000553%)
TTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCA3 (0.000166%)
TTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAGGCCCTCT8 (0.000442%)
TTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCC4 (0.000221%)
TTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCA6 (0.000332%)
TTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCAC7 (0.000387%)
TTCCCTGTCATCTCCAACCCGAGGAACTTCTGCATTTCTTGAATTTTTTTGACAATAAGACTACTGTCCTTTTTCTTAATAAATTGCTTCACATCTTTTG5 (0.000276%)
TTCCGGTTAGACCACCAACTGTAAATAAGAAAATAAAGCCTAAGGCTCATAGTATAGCTGGAGATCATTTAATATTACCTCCGTGTAGGGTTGCAAGTCA15 (0.000829%)
TTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCAC16 (0.000885%)
TTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCT10 (0.000553%)
TTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGC12 (0.000664%)
TTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGG6 (0.000332%)
TTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACA12 (0.000664%)
TTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATT52 (0.002875%)
TTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCT13 (0.000719%)
TTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTC9 (0.000498%)
TTCTTCTCCATGGCCAAGGCAGCTTCCATGGCCTCCTGGGTTTTACCCCATTCATCTTGAGATGGCTTCTGCACATCCTGGAAGAGTGCACGGCCCCCGC306 (0.016921%)
TTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGT13 (0.000719%)
TTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGT3 (0.000166%)
TTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGC11 (0.000608%)
TTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGC11 (0.000608%)
TTGATCGCTAATTTGGAGGTGATCCCTGCAGGTCCACAGTGCCCTACGGTGGAAGTCATAGCTAAACTGAAAAACCAGAAGGAGGTCTGTCTGGATCCAG11 (0.000608%)
TTGCAGTTGGAGAACATGGAGACTTTGTCCCTTTTGATGGGCCTGGAACAGTCTTGGCTCATGCCTATGCACCTGGACCAGGGATTAATGGAGATGCTCA6 (0.000332%)
TTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCAT3 (0.000166%)
TTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGA13 (0.000719%)
TTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGA27 (0.001493%)
TTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGG17 (0.000940%)
TTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGG5 (0.000276%)
TTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCAC18 (0.000995%)
TTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAG6 (0.000332%)
TTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATT21 (0.001161%)
TTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAA3 (0.000166%)
TTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCT4 (0.000221%)
TTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGAC8 (0.000442%)
TTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAG13 (0.000719%)
TTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTT6 (0.000332%)
TTTGCAGTTGGAGAACATGGAGACTTTGTCCCTTTTGATGGGCCTGGAACAGTCTTGGCTCATGCCTATGCACCTGGACCAGGGATTAATGGAGATGCTC6 (0.000332%)
TTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTG7 (0.000387%)
TTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTG22 (0.001217%)
TTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCC3 (0.000166%)
TTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCT3 (0.000166%)
TTTTTTTTTTTTTTTTTTTT1345 (0.014875%)