fastp report
General
fastp version:0.23.1 (https://github.com/OpenGene/fastp)
sequencing:paired end (150 cycles + 150 cycles)
mean length before filtering:150bp, 150bp
mean length after filtering:143bp, 142bp
duplication rate:18.433761%
Insert size peak:259
Before filtering
total reads:41.140080 M
total bases:6.171012 G
Q20 bases:5.986636 G (97.012231%)
Q30 bases:5.702804 G (92.412792%)
GC content:51.402583%
After filtering
total reads:40.806400 M
total bases:5.832230 G
Q20 bases:5.692378 G (97.602085%)
Q30 bases:5.434501 G (93.180500%)
GC content:51.233148%
Filtering result
reads passed filters:40.806400 M (99.188917%)
reads with low quality:304.590000 K (0.740373%)
reads with too many N:10.930000 K (0.026568%)
reads too short:18.160000 K (0.044142%)
Adapter or bad ligation of read1
SequenceOccurrences
A24222
AG25914
AGA27596
AGAT25895
AGATC25558
AGATCG26763
AGATCGG24478
AGATCGGA22308
AGATCGGAA21449
AGATCGGAAG21987
AGATCGGAAGA20696
AGATCGGAAGAG22018
AGATCGGAAGAGC22830
AGATCGGAAGAGCA23647
AGATCGGAAGAGCAC26157
AGATCGGAAGAGCACA25241
AGATCGGAAGAGCACAC21919
AGATCGGAAGAGCACACG20187
AGATCGGAAGAGCACACGT18805
AGATCGGAAGAGCACACGTC17802
AGATCGGAAGAGCACACGTCT19263
AGATCGGAAGAGCACACGTCTG20295
AGATCGGAAGAGCACACGTCTGA21199
AGATCGGAAGAGCACACGTCTGAA20528
AGATCGGAAGAGCACACGTCTGAAC21618
AGATCGGAAGAGCACACGTCTGAACT20729
AGATCGGAAGAGCACACGTCTGAACTC20137
AGATCGGAAGAGCACACGTCTGAACTCC18521
AGATCGGAAGAGCACACGTCTGAACTCCA16294
AGATCGGAAGAGCACACGTCTGAACTCCAG15606
AGATCGGAAGAGCACACGTCTGAACTCCAGT15406
AGATCGGAAGAGCACACGTCTGAACTCCAGTC16123
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA17145
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC18477
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACA20698
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAA18595
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAC17545
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACT15126
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTG14321
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTGC13459
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTGCA16322
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTGCAG41880
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTGCAGC22219
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTGCAGCA15640
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTGCAGCAA69254
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTGCAGCAAT13597
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTGCAGCAATCT37617
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTGCAGCAATCTC23993
other adapter sequences172929
Adapter or bad ligation of read2
SequenceOccurrences
A25611
AG26718
AGA27617
AGAT25947
AGATC26291
AGATCG32120
AGATCGG23975
AGATCGGA22541
AGATCGGAA19403
AGATCGGAAG21072
AGATCGGAAGA18811
AGATCGGAAGAG26816
AGATCGGAAGAGC22319
AGATCGGAAGAGCG22926
AGATCGGAAGAGCGT34089
AGATCGGAAGAGCGTC20772
AGATCGGAAGAGCGTCG29421
AGATCGGAAGAGCGTCGT21573
AGATCGGAAGAGCGTCGTG17261
AGATCGGAAGAGCGTCGTGT13197
AGATCGGAAGAGCGTCGTGTA12852
AGATCGGAAGAGCGTCGTGTAG19823
AGATCGGAAGAGCGTCGTGTAGG29112
AGATCGGAAGAGCGTCGTGTAGGG23310
AGATCGGAAGAGCGTCGTGTAGGGA18805
AGATCGGAAGAGCGTCGTGTAGGGAA14172
AGATCGGAAGAGCGTCGTGTAGGGAAAG14760
AGATCGGAAGAGCGTCGTGTAGGGAAAGA13018
AGATCGGAAGAGCGTCGTGTAGGGAAAGAG17417
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGT13337
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG20301
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT22809
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTG20723
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGC16249
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCTATGTCTGGTG14660
other adapter sequences503573
This estimation is based on paired-end overlap analysis, and there are 57.077244% reads found not overlapped.
The nonoverlapped read pairs may have insert size <30 or >270, or contain too much sequencing errors to be detected as overlapped.
Value of each position will be shown on mouse over.
Value of each position will be shown on mouse over.
Darker background means larger counts. The count will be shown on mouse over.
AAATACAGTATTTCTGCACTCCCGGAGTGCGG
AAAAAAAAAAAATAAAACAAAAGAAATAAAATTAAATCAAATGAAACAAAACTAAACCAAACGAAAGAAAAGTAAAGCAAAGG
AATAATAAAATATAATACAATAGAATTAAATTTAATTCAATTGAATCAAATCTAATCCAATCGAATGAAATGTAATGCAATGG
AACAACAAAACATAACACAACAGAACTAAACTTAACTCAACTGAACCAAACCTAACCCAACCGAACGAAACGTAACGCAACGG
AAGAAGAAAAGATAAGACAAGAGAAGTAAAGTTAAGTCAAGTGAAGCAAAGCTAAGCCAAGCGAAGGAAAGGTAAGGCAAGGG
ATAATAAAATAATATAACATAAGATATAATATTATATCATATGATACAATACTATACCATACGATAGAATAGTATAGCATAGG
ATTATTAAATTATATTACATTAGATTTAATTTTATTTCATTTGATTCAATTCTATTCCATTCGATTGAATTGTATTGCATTGG
ATCATCAAATCATATCACATCAGATCTAATCTTATCTCATCTGATCCAATCCTATCCCATCCGATCGAATCGTATCGCATCGG
ATGATGAAATGATATGACATGAGATGTAATGTTATGTCATGTGATGCAATGCTATGCCATGCGATGGAATGGTATGGCATGGG
ACAACAAAACAATACAACACAAGACATAACATTACATCACATGACACAACACTACACCACACGACAGAACAGTACAGCACAGG
ACTACTAAACTATACTACACTAGACTTAACTTTACTTCACTTGACTCAACTCTACTCCACTCGACTGAACTGTACTGCACTGG
ACCACCAAACCATACCACACCAGACCTAACCTTACCTCACCTGACCCAACCCTACCCCACCCGACCGAACCGTACCGCACCGG
ACGACGAAACGATACGACACGAGACGTAACGTTACGTCACGTGACGCAACGCTACGCCACGCGACGGAACGGTACGGCACGGG
AGAAGAAAAGAATAGAACAGAAGAGATAAGATTAGATCAGATGAGACAAGACTAGACCAGACGAGAGAAGAGTAGAGCAGAGG
AGTAGTAAAGTATAGTACAGTAGAGTTAAGTTTAGTTCAGTTGAGTCAAGTCTAGTCCAGTCGAGTGAAGTGTAGTGCAGTGG
AGCAGCAAAGCATAGCACAGCAGAGCTAAGCTTAGCTCAGCTGAGCCAAGCCTAGCCCAGCCGAGCGAAGCGTAGCGCAGCGG
AGGAGGAAAGGATAGGACAGGAGAGGTAAGGTTAGGTCAGGTGAGGCAAGGCTAGGCCAGGCGAGGGAAGGGTAGGGCAGGGG
TAATAAAATAAATTAAACTAAAGTAATATAATTTAATCTAATGTAACATAACTTAACCTAACGTAAGATAAGTTAAGCTAAGG
TATTATAATATATTATACTATAGTATTATATTTTATTCTATTGTATCATATCTTATCCTATCGTATGATATGTTATGCTATGG
TACTACAATACATTACACTACAGTACTATACTTTACTCTACTGTACCATACCTTACCCTACCGTACGATACGTTACGCTACGG
TAGTAGAATAGATTAGACTAGAGTAGTATAGTTTAGTCTAGTGTAGCATAGCTTAGCCTAGCGTAGGATAGGTTAGGCTAGGG
TTATTAAATTAATTTAACTTAAGTTATATTATTTTATCTTATGTTACATTACTTTACCTTACGTTAGATTAGTTTAGCTTAGG
TTTTTTAATTTATTTTACTTTAGTTTTATTTTTTTTTCTTTTGTTTCATTTCTTTTCCTTTCGTTTGATTTGTTTTGCTTTGG
TTCTTCAATTCATTTCACTTCAGTTCTATTCTTTTCTCTTCTGTTCCATTCCTTTCCCTTCCGTTCGATTCGTTTCGCTTCGG
TTGTTGAATTGATTTGACTTGAGTTGTATTGTTTTGTCTTGTGTTGCATTGCTTTGCCTTGCGTTGGATTGGTTTGGCTTGGG
TCATCAAATCAATTCAACTCAAGTCATATCATTTCATCTCATGTCACATCACTTCACCTCACGTCAGATCAGTTCAGCTCAGG
TCTTCTAATCTATTCTACTCTAGTCTTATCTTTTCTTCTCTTGTCTCATCTCTTCTCCTCTCGTCTGATCTGTTCTGCTCTGG
TCCTCCAATCCATTCCACTCCAGTCCTATCCTTTCCTCTCCTGTCCCATCCCTTCCCCTCCCGTCCGATCCGTTCCGCTCCGG
TCGTCGAATCGATTCGACTCGAGTCGTATCGTTTCGTCTCGTGTCGCATCGCTTCGCCTCGCGTCGGATCGGTTCGGCTCGGG
TGATGAAATGAATTGAACTGAAGTGATATGATTTGATCTGATGTGACATGACTTGACCTGACGTGAGATGAGTTGAGCTGAGG
TGTTGTAATGTATTGTACTGTAGTGTTATGTTTTGTTCTGTTGTGTCATGTCTTGTCCTGTCGTGTGATGTGTTGTGCTGTGG
TGCTGCAATGCATTGCACTGCAGTGCTATGCTTTGCTCTGCTGTGCCATGCCTTGCCCTGCCGTGCGATGCGTTGCGCTGCGG
TGGTGGAATGGATTGGACTGGAGTGGTATGGTTTGGTCTGGTGTGGCATGGCTTGGCCTGGCGTGGGATGGGTTGGGCTGGGG
CAACAAAACAAATCAAACCAAAGCAATACAATTCAATCCAATGCAACACAACTCAACCCAACGCAAGACAAGTCAAGCCAAGG
CATCATAACATATCATACCATAGCATTACATTTCATTCCATTGCATCACATCTCATCCCATCGCATGACATGTCATGCCATGG
CACCACAACACATCACACCACAGCACTACACTTCACTCCACTGCACCACACCTCACCCCACCGCACGACACGTCACGCCACGG
CAGCAGAACAGATCAGACCAGAGCAGTACAGTTCAGTCCAGTGCAGCACAGCTCAGCCCAGCGCAGGACAGGTCAGGCCAGGG
CTACTAAACTAATCTAACCTAAGCTATACTATTCTATCCTATGCTACACTACTCTACCCTACGCTAGACTAGTCTAGCCTAGG
CTTCTTAACTTATCTTACCTTAGCTTTACTTTTCTTTCCTTTGCTTCACTTCTCTTCCCTTCGCTTGACTTGTCTTGCCTTGG
CTCCTCAACTCATCTCACCTCAGCTCTACTCTTCTCTCCTCTGCTCCACTCCTCTCCCCTCCGCTCGACTCGTCTCGCCTCGG
CTGCTGAACTGATCTGACCTGAGCTGTACTGTTCTGTCCTGTGCTGCACTGCTCTGCCCTGCGCTGGACTGGTCTGGCCTGGG
CCACCAAACCAATCCAACCCAAGCCATACCATTCCATCCCATGCCACACCACTCCACCCCACGCCAGACCAGTCCAGCCCAGG
CCTCCTAACCTATCCTACCCTAGCCTTACCTTTCCTTCCCTTGCCTCACCTCTCCTCCCCTCGCCTGACCTGTCCTGCCCTGG
CCCCCCAACCCATCCCACCCCAGCCCTACCCTTCCCTCCCCTGCCCCACCCCTCCCCCCCCCGCCCGACCCGTCCCGCCCCGG
CCGCCGAACCGATCCGACCCGAGCCGTACCGTTCCGTCCCGTGCCGCACCGCTCCGCCCCGCGCCGGACCGGTCCGGCCCGGG
CGACGAAACGAATCGAACCGAAGCGATACGATTCGATCCGATGCGACACGACTCGACCCGACGCGAGACGAGTCGAGCCGAGG
CGTCGTAACGTATCGTACCGTAGCGTTACGTTTCGTTCCGTTGCGTCACGTCTCGTCCCGTCGCGTGACGTGTCGTGCCGTGG
CGCCGCAACGCATCGCACCGCAGCGCTACGCTTCGCTCCGCTGCGCCACGCCTCGCCCCGCCGCGCGACGCGTCGCGCCGCGG
CGGCGGAACGGATCGGACCGGAGCGGTACGGTTCGGTCCGGTGCGGCACGGCTCGGCCCGGCGCGGGACGGGTCGGGCCGGGG
GAAGAAAAGAAATGAAACGAAAGGAATAGAATTGAATCGAATGGAACAGAACTGAACCGAACGGAAGAGAAGTGAAGCGAAGG
GATGATAAGATATGATACGATAGGATTAGATTTGATTCGATTGGATCAGATCTGATCCGATCGGATGAGATGTGATGCGATGG
GACGACAAGACATGACACGACAGGACTAGACTTGACTCGACTGGACCAGACCTGACCCGACCGGACGAGACGTGACGCGACGG
GAGGAGAAGAGATGAGACGAGAGGAGTAGAGTTGAGTCGAGTGGAGCAGAGCTGAGCCGAGCGGAGGAGAGGTGAGGCGAGGG
GTAGTAAAGTAATGTAACGTAAGGTATAGTATTGTATCGTATGGTACAGTACTGTACCGTACGGTAGAGTAGTGTAGCGTAGG
GTTGTTAAGTTATGTTACGTTAGGTTTAGTTTTGTTTCGTTTGGTTCAGTTCTGTTCCGTTCGGTTGAGTTGTGTTGCGTTGG
GTCGTCAAGTCATGTCACGTCAGGTCTAGTCTTGTCTCGTCTGGTCCAGTCCTGTCCCGTCCGGTCGAGTCGTGTCGCGTCGG
GTGGTGAAGTGATGTGACGTGAGGTGTAGTGTTGTGTCGTGTGGTGCAGTGCTGTGCCGTGCGGTGGAGTGGTGTGGCGTGGG
GCAGCAAAGCAATGCAACGCAAGGCATAGCATTGCATCGCATGGCACAGCACTGCACCGCACGGCAGAGCAGTGCAGCGCAGG
GCTGCTAAGCTATGCTACGCTAGGCTTAGCTTTGCTTCGCTTGGCTCAGCTCTGCTCCGCTCGGCTGAGCTGTGCTGCGCTGG
GCCGCCAAGCCATGCCACGCCAGGCCTAGCCTTGCCTCGCCTGGCCCAGCCCTGCCCCGCCCGGCCGAGCCGTGCCGCGCCGG
GCGGCGAAGCGATGCGACGCGAGGCGTAGCGTTGCGTCGCGTGGCGCAGCGCTGCGCCGCGCGGCGGAGCGGTGCGGCGCGGG
GGAGGAAAGGAATGGAACGGAAGGGATAGGATTGGATCGGATGGGACAGGACTGGACCGGACGGGAGAGGAGTGGAGCGGAGG
GGTGGTAAGGTATGGTACGGTAGGGTTAGGTTTGGTTCGGTTGGGTCAGGTCTGGTCCGGTCGGGTGAGGTGTGGTGCGGTGG
GGCGGCAAGGCATGGCACGGCAGGGCTAGGCTTGGCTCGGCTGGGCCAGGCCTGGCCCGGCCGGGCGAGGCGTGGCGCGGCGG
GGGGGGAAGGGATGGGACGGGAGGGGTAGGGTTGGGTCGGGTGGGGCAGGGCTGGGCCGGGCGGGGGAGGGGTGGGGCGGGGG
Sampling rate: 1 / 20
overrepresented sequencecount (% of bases)distribution: cycle 1 ~ cycle 150
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA162 (0.004200%)
AAAAAACAGGACTTCTCCCCGGAGGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTG7 (0.000454%)
AAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGA18 (0.001167%)
AAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAA5 (0.000324%)
AAAACTGTGAAACTGTGTGTAGCAGTGGGATTTGGAGACTCTTACATTCAGAAGGTGCAGAAAGAAATCAAGTTAGACTTTTAAATTCCTGGTGCTTGTG3 (0.000194%)
AAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAAT7 (0.000454%)
AAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGG26 (0.001685%)
AAAAGTGCCTGTCTTTAAAAAACAGGACTTCTCCCCGGAGGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAG9 (0.000583%)
AAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGC24 (0.001556%)
AAAATGGTGAAGGTCGGTGTGAACGGATTTGGCCGTATTGGGCGCCTGGTCACCAGGGCTGCCATTTGCAGTGGCAAAGTGGAGATTGTTGCCATCAACG4 (0.000259%)
AAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAAC16 (0.001037%)
AAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACG11 (0.000713%)
AAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCAC34 (0.002204%)
AAAGAACGGCCAGTGTTCAATAGAAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTAT5 (0.000324%)
AAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGG6 (0.000389%)
AAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTATGAACTCCCTGCTTTGATGAGAAA4 (0.000259%)
AAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGG42 (0.002722%)
AAAGTGCCTGTCTTTAAAAAACAGGACTTCTCCCCGGAGGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGA3 (0.000194%)
AAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCA8 (0.000519%)
AAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCA21 (0.001361%)
AAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCG4 (0.000259%)
AACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTG5 (0.000324%)
AACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGT4 (0.000259%)
AACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACT7 (0.000454%)
AACGGCCAGTGTTCAATAGAAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTATGAAC7 (0.000454%)
AACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCG17 (0.001102%)
AAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACA16 (0.001037%)
AAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCA7 (0.000454%)
AAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGA3 (0.000194%)
AAGACGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACAC3 (0.000194%)
AAGAGCACACGTCTGAACTCCAGTCACAACTGCAGCAATC9 (0.000233%)
AAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAAC23 (0.001491%)
AAGATATCGGAACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGC7 (0.000454%)
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTG2513 (0.065156%)
AAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACA4 (0.000259%)
AAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCAC10 (0.000648%)
AAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAA3 (0.000194%)
AAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGC10 (0.000648%)
AAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTG5 (0.000324%)
AAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCCGGATC4 (0.000259%)
AAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTA3 (0.000194%)
AAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAG131 (0.008491%)
AATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCAC4 (0.000259%)
AATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAG3 (0.000194%)
AATCTCCACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCA56 (0.003630%)
AATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAG7 (0.000454%)
AATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCC12 (0.000778%)
AATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGT3 (0.000194%)
AATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTG3 (0.000194%)
AATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTC16 (0.001037%)
AATGGCATCAGCCTCTTCAACAACCCTGTGCCCTACTGGGAAGTGCAGCCTGCCACCTTCCGCTGCGTTACTGACCGCCTGGCCATCCAATTTGGAAATT16 (0.001037%)
ACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGC3 (0.000194%)
ACACACACACACACACACAC748 (0.009697%)
ACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTC9 (0.000583%)
ACAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACT1435 (0.037206%)
ACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGT7 (0.000454%)
ACCACAACGAGACCGCTGTGACCTTACGTAAAACTGTGAAACTGTGTGTAGCAGTGGGATTTGGAGACTCTTACATTCAGAAGGTGCAGAAAGAAATCAA59 (0.003824%)
ACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCT5 (0.000324%)
ACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTG14 (0.000907%)
ACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGC3 (0.000194%)
ACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCT5 (0.000324%)
ACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACT3 (0.000194%)
ACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCA3 (0.000194%)
ACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATC11 (0.000713%)
ACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTAC11 (0.000713%)
ACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCA20 (0.001296%)
ACCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGG20 (0.001296%)
ACCTTCTCCTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTC9 (0.000583%)
ACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAG3 (0.000194%)
ACGGCCAGTGTTCAATAGAAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTATGAACT3 (0.000194%)
ACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGA4 (0.000259%)
ACTCACCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAG67 (0.004343%)
ACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTAT3 (0.000194%)
ACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCAT6 (0.000389%)
ACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTG3 (0.000194%)
ACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCT5 (0.000324%)
AGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTC4 (0.000259%)
AGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCA10 (0.000648%)
AGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAA29 (0.001880%)
AGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAAT12 (0.000778%)
AGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCT10 (0.000648%)
AGAACGGCCAGTGTTCAATAGAAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTATGA4 (0.000259%)
AGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCG6 (0.000389%)
AGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATG11 (0.000713%)
AGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGG6 (0.000389%)
AGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAA3 (0.000194%)
AGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAG6 (0.000389%)
AGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACT2255 (0.058467%)
AGAGCACACGTCTGAACTCCAGTCACAACTGCAGCAATCT6 (0.000156%)
AGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCC3 (0.000194%)
AGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGT3 (0.000194%)
AGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGG3 (0.000194%)
AGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAG6 (0.000389%)
AGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGG5 (0.000324%)
AGCACACGTCTGAACTCCAGTCACAACTGCAGCAATCTCG10 (0.000259%)
AGCACCATGATCCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCACAGGGGCGCCTATCGCCAATGAGCTGC3 (0.000194%)
AGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTC4 (0.000259%)
AGCACTCCAGACTCCAGCCACACTCCAACACAGCACCATGATCCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTG177 (0.011473%)
AGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGT5 (0.000324%)
AGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCAT5 (0.000324%)
AGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATT4 (0.000259%)
AGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCT3 (0.000194%)
AGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAA3 (0.000194%)
AGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAA10 (0.000648%)
AGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCC12 (0.000778%)
AGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACC9 (0.000583%)
AGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAA4 (0.000259%)
AGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATG3 (0.000194%)
AGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGC5 (0.000324%)
AGGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCA3 (0.000194%)
AGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAA7 (0.000454%)
AGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTA3 (0.000194%)
AGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGA9 (0.000583%)
AGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTA41 (0.002658%)
AGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTT3 (0.000194%)
AGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGC5 (0.000324%)
AGTACCTTCTCCTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAG14 (0.000907%)
AGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCAT21 (0.001361%)
AGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCAC6 (0.000389%)
AGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATG3 (0.000194%)
AGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGC7 (0.000454%)
AGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGA6 (0.000389%)
AGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGT3 (0.000194%)
AGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAG9 (0.000583%)
ATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGC7 (0.000454%)
ATACAGTCAGAAGAGATACGAGGAAATCGTTAAGGAAGTCAGCACCTACATTAAGAAAATTGGCTACAACCCTGACACAGTAGCATTTGTGCCAATTTCT51 (0.003306%)
ATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGT3 (0.000194%)
ATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCC9 (0.000583%)
ATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACT3 (0.000194%)
ATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGG3 (0.000194%)
ATATGTATATGTATATGTATATGTATATGTATATGTATAT504 (0.013068%)
ATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCT16 (0.001037%)
ATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGAT10 (0.000648%)
ATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATC5 (0.000324%)
ATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACA14 (0.000907%)
ATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGG9 (0.000583%)
ATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACT5 (0.000324%)
ATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATG13 (0.000843%)
ATCGATCTTCTTCACGGTTGCAGGGAGACCCAGGGTGTGAATGCTTTTAGGATAACCTGCTAGCTCCTCGTGCCCTCGTATAGCCCAGAACTGATTTCCTTTAAAAATGAAAACAGTGTCTCTGTTAGTAACCTCATATGCAGCATCC22 (0.002111%)
ATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTA11 (0.000713%)
ATCGGAACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTT10 (0.000648%)
ATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTGCAG13 (0.000337%)
ATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCA4 (0.000259%)
ATCTCCACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAG13 (0.000843%)
ATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAG8 (0.000519%)
ATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAA3 (0.000194%)
ATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGT3 (0.000194%)
ATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGC3 (0.000194%)
ATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAG12 (0.000778%)
ATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACG5 (0.000324%)
ATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAA5 (0.000324%)
ATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCT4 (0.000259%)
ATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAAC6 (0.000389%)
ATGATCCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCACAGGGGCGCCTATCGCCAATGAGCTGCGCTGTC6 (0.000389%)
ATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGAT15 (0.000972%)
ATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTG9 (0.000583%)
ATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGA9 (0.000583%)
ATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTG7 (0.000454%)
ATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAA3 (0.000194%)
ATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACG6 (0.000389%)
ATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCT4 (0.000259%)
ATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCA11 (0.000713%)
ATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGG3 (0.000194%)
ATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAG7 (0.000454%)
ATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTG8 (0.000519%)
ATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAG10 (0.000648%)
ATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTT57 (0.003695%)
CAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACG23 (0.001491%)
CAAAAGTGCCTGTCTTTAAAAAACAGGACTTCTCCCCGGAGGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCA155 (0.010047%)
CAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCG11 (0.000713%)
CAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCAC13 (0.000843%)
CAAAGATATCGGAACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGT18 (0.001167%)
CAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGC34 (0.002204%)
CAACACAGCACCATGATCCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCACAGGGGCGCCTATCGCCAATG5 (0.000324%)
CAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAG11 (0.000713%)
CAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCG11 (0.000713%)
CAACGAGACCGCTGTGACCTTACGTAAAACTGTGAAACTGTGTGTAGCAGTGGGATTTGGAGACTCTTACATTCAGAAGGTGCAGAAAGAAATCAAGTTA3 (0.000194%)
CAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACC25 (0.001620%)
CAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCA17 (0.001102%)
CAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGC41 (0.002658%)
CAAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACT1638 (0.042470%)
CAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTG6 (0.000389%)
CAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCCGGAT5 (0.000324%)
CAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTT3 (0.000194%)
CAATCTCCACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCC23 (0.001491%)
CAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTC9 (0.000583%)
CAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTT6 (0.000389%)
CACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACC71 (0.004602%)
CACAAAGATATCGGAACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAG149 (0.009658%)
CACAACGAGACCGCTGTGACCTTACGTAAAACTGTGAAACTGTGTGTAGCAGTGGGATTTGGAGACTCTTACATTCAGAAGGTGCAGAAAGAAATCAAGT3 (0.000194%)
CACACACACACACACACACA690 (0.008945%)
CACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTT62 (0.004019%)
CACACTCCAACACAGCACCATGATCCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCACAGGGGCGCCTATC4 (0.000259%)
CACAGCACCATGATCCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCACAGGGGCGCCTATCGCCAATGAGC4 (0.000259%)
CACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTG4 (0.000259%)
CACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGG10 (0.000648%)
CACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATG7 (0.000454%)
CACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAG6 (0.000389%)
CACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGG678 (0.043947%)
CACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATC4 (0.000259%)
CACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTAT6 (0.000389%)
CACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTT8 (0.000519%)
CACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCC5 (0.000324%)
CACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATC4 (0.000259%)
CACCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATG43 (0.002787%)
CACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACA18 (0.001167%)
CACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAA11 (0.000713%)
CACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCT14 (0.000907%)
CACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTG23 (0.001491%)
CACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAA15 (0.000972%)
CACTCACCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAA185 (0.011992%)
CACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTC5 (0.000324%)
CACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACC3 (0.000194%)
CACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTA9 (0.000583%)
CACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCA14 (0.000907%)
CACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGC6 (0.000389%)
CACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCG3 (0.000194%)
CAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACT13 (0.000843%)
CAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACC4 (0.000259%)
CAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCAT9 (0.000583%)
CAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTG34 (0.002204%)
CAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGC19 (0.001232%)
CAGACTCCAGCCACACTCCAACACAGCACCATGATCCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCACAG5 (0.000324%)
CAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCAC14 (0.000907%)
CAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCG7 (0.000454%)
CAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAG5 (0.000324%)
CAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCG5 (0.000324%)
CAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTG4247 (0.110115%)
CAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAG9 (0.000583%)
CAGCACCATGATCCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCACAGGGGCGCCTATCGCCAATGAGCTG4 (0.000259%)
CAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGT10 (0.000648%)
CAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCA15 (0.000972%)
CAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCAT3 (0.000194%)
CAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCACAGGGGCGCCTATCGCCAATGAGCTGCGCTGTCAGTGCCT8 (0.000519%)
CAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGA7 (0.000454%)
CAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAA4 (0.000259%)
CAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAAC5 (0.000324%)
CAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTG7 (0.000454%)
CAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAA170 (0.011019%)
CAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTC9 (0.000583%)
CAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGG10 (0.000648%)
CAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGG12 (0.000778%)
CAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCT9 (0.000583%)
CAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAAC7 (0.000454%)
CAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACG4 (0.000259%)
CAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCA4 (0.000259%)
CAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCAT272 (0.017631%)
CAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCCGGATCAGCCATGAC8 (0.000519%)
CAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCT5 (0.000324%)
CAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCG11 (0.000713%)
CAGTTCAAGACATTTTGAAAGGTTAACAACCAATGATTCTTGACTTACACACTAAAGTATCACAATTTCCGATAGTGTGACAGATAGGAAAGAATAGGAA295 (0.019122%)
CAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCC9 (0.000583%)
CAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATA6 (0.000389%)
CATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCA3 (0.000194%)
CATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGA5 (0.000324%)
CATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTC11 (0.000713%)
CATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTC11 (0.000713%)
CATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGA3 (0.000194%)
CATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTG4 (0.000259%)
CATCGATCTTCTTCACGGTTGCAGGGAGACCCAGGGTGTGAATGCTTTTAGGATAACCTGCTAGCTCCTCGTGCCCTCGTATAGCCCAGAACTGATTTCC167 (0.010825%)
CATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTT7 (0.000454%)
CATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTAC7 (0.000454%)
CATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGG5 (0.000324%)
CATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATA5 (0.000324%)
CATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGAC4 (0.000259%)
CCAATCTCCACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCC218 (0.014131%)
CCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCAC19 (0.001232%)
CCACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGT17 (0.001102%)
CCACACTCCAACACAGCACCATGATCCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCACAGGGGCGCCTAT12 (0.000778%)
CCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTG5 (0.000324%)
CCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTA3 (0.000194%)
CCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACAT9 (0.000583%)
CCACTCACCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAA40 (0.002593%)
CCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGA4 (0.000259%)
CCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGT3 (0.000194%)
CCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGAC6 (0.000389%)
CCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCA16 (0.001037%)
CCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGG11 (0.000713%)
CCAGACTCCAGCCACACTCCAACACAGCACCATGATCCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCACA15 (0.000972%)
CCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCA3 (0.000194%)
CCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCA13 (0.000843%)
CCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCC17 (0.001102%)
CCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAA6 (0.000389%)
CCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTG5 (0.000324%)
CCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAG10 (0.000648%)
CCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCCGGATCAGCCATGA8 (0.000519%)
CCAGTGTTCAATAGAAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTATGAACTCCCT9 (0.000583%)
CCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTC7 (0.000454%)
CCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTA4 (0.000259%)
CCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCT8 (0.000519%)
CCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTC31 (0.002009%)
CCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCACAGGGGCGCCTATCGCCAATGAGCTGCGCTGTCAGTGC3 (0.000194%)
CCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTA7 (0.000454%)
CCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGG48 (0.004605%)
CCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTT17 (0.001102%)
CCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCG12 (0.000778%)
CCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATT62 (0.004019%)
CCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCT13 (0.000843%)
CCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGT12 (0.000778%)
CCCGGAGGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATC13 (0.000843%)
CCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGT4 (0.000259%)
CCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGA12 (0.000778%)
CCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGG5 (0.000324%)
CCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAAT42 (0.002722%)
CCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGC14 (0.000907%)
CCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGG61 (0.003954%)
CCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTC9 (0.000583%)
CCGATCTCTCGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAA466 (0.030206%)
CCGATTATTAGTGGGACAAGTCAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCATGGGCAGTTACGATAACAT19 (0.001232%)
CCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTA4 (0.000259%)
CCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGC12 (0.000778%)
CCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTT10 (0.000648%)
CCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCT4 (0.000259%)
CCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTA20 (0.001296%)
CCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAA19 (0.001232%)
CCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCT21 (0.001361%)
CCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCC9 (0.000583%)
CCGGAGGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCA18 (0.001167%)
CCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTA66 (0.004278%)
CCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCT33 (0.002139%)
CCGTAGACAAAATGGTGAAGGTCGGTGTGAACGGATTTGGCCGTATTGGGCGCCTGGTCACCAGGGCTGCCATTTGCAGTGGCAAAGTGGAGATTGTTGC191 (0.012380%)
CCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACT10 (0.000648%)
CCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAA18 (0.001167%)
CCTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCC5 (0.000324%)
CCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCA4 (0.000259%)
CCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATA5 (0.000324%)
CCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTC9 (0.000583%)
CCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCAT6 (0.000389%)
CCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGG12 (0.000778%)
CCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTA10 (0.000648%)
CCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCAT11 (0.000713%)
CCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGAT9 (0.000583%)
CCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAG18 (0.001167%)
CCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTT8 (0.000519%)
CCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCAC7 (0.000454%)
CCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAAC4 (0.000259%)
CCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGG15 (0.000972%)
CCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGC3 (0.000194%)
CCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGT3 (0.000194%)
CCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACT14 (0.000907%)
CCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGT3 (0.000194%)
CCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGC5 (0.000324%)
CGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATC10 (0.000648%)
CGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCA47 (0.003047%)
CGAGACCGCTGTGACCTTACGTAAAACTGTGAAACTGTGTGTAGCAGTGGGATTTGGAGACTCTTACATTCAGAAGGTGCAGAAAGAAATCAAGTTAGAC8 (0.000519%)
CGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGG6 (0.000389%)
CGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGA17 (0.001102%)
CGAGGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCC3 (0.000194%)
CGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGA5 (0.000324%)
CGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCCCGATGCCGACGCTCATCAGACCCCAG8 (0.000519%)
CGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCC6 (0.000389%)
CGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCT6 (0.000389%)
CGATCTCTCGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAAT33 (0.002139%)
CGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGC3 (0.000194%)
CGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCC272 (0.017631%)
CGATTATTAGTGGGACAAGTCAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCATGGGCAGTTACGATAACATT6 (0.000389%)
CGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTG37 (0.002398%)
CGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCT17 (0.001102%)
CGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTG58 (0.003760%)
CGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAA34 (0.002204%)
CGCAGTGGAAAGAACGGCCAGTGTTCAATAGAAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATT5 (0.000324%)
CGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCC4 (0.000259%)
CGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAG20 (0.001296%)
CGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGC3 (0.000194%)
CGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGT12 (0.000778%)
CGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGT10 (0.000648%)
CGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTAT4 (0.000259%)
CGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTC4 (0.000259%)
CGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTG22 (0.001426%)
CGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTG7 (0.000454%)
CGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCT11 (0.000713%)
CGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTA4 (0.000259%)
CGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAG28 (0.001815%)
CGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAAC17 (0.001102%)
CGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGA22 (0.001426%)
CGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTG37 (0.002398%)
CGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGG5 (0.000324%)
CGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTG50 (0.003241%)
CGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGA4 (0.000259%)
CGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGC28 (0.001815%)
CGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCC3 (0.000194%)
CGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGG3 (0.000194%)
CGGAACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTA8 (0.000519%)
CGGAAGAGCACACGTCTGAACTCCAGTCACAACTGCAGCA8 (0.000207%)
CGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAAT3 (0.000194%)
CGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAA10 (0.000648%)
CGGAGGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAG13 (0.000843%)
CGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATA37 (0.002398%)
CGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCA35 (0.002269%)
CGGCCAGTGTTCAATAGAAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTATGAACTC5 (0.000324%)
CGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAA5 (0.000324%)
CGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTG6 (0.000389%)
CGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCAC13 (0.000843%)
CGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCC24 (0.001556%)
CGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCT7 (0.000454%)
CGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGC4 (0.000259%)
CGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAA27 (0.001750%)
CGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGC4 (0.000259%)
CGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGC15 (0.000972%)
CGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTC27 (0.001750%)
CGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTG6 (0.000389%)
CGTGGGAATGCTATATCTGGGGCTCCGATTATTAGTGGGACAAGTCAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAA114 (0.007389%)
CGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAAT26 (0.001685%)
CTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCATCTAC4 (0.000259%)
CTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGAT10 (0.000648%)
CTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAA3 (0.000194%)
CTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGT4 (0.000259%)
CTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTC231 (0.014973%)
CTCAATATGAACTCTTTGCAACCAGCACAGAATTGGCTATCAAATCCAAACCACATCAAAGTTTGGCTGATAGAAGCCAGGAGTCAATAATGTGAGGGTG4 (0.000259%)
CTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACAC4 (0.000259%)
CTCACCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGA304 (0.019705%)
CTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCT37 (0.002398%)
CTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCA12 (0.000778%)
CTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGC7 (0.000454%)
CTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAG3 (0.000194%)
CTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGT41 (0.002658%)
CTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATAC8 (0.000519%)
CTCCAACACAGCACCATGATCCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCACAGGGGCGCCTATCGCCA8 (0.000519%)
CTCCACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCG78 (0.005056%)
CTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAA7 (0.000454%)
CTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCG34 (0.002204%)
CTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATC9 (0.000583%)
CTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCA4 (0.000259%)
CTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTG3 (0.000194%)
CTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCCGGATCAGCCAT7 (0.000454%)
CTCCCCGGAGGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGAC6 (0.000389%)
CTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTAT5 (0.000324%)
CTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAG34 (0.002204%)
CTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCT4 (0.000259%)
CTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGG6 (0.000389%)
CTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAAC4 (0.000259%)
CTCCTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCG10 (0.000648%)
CTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCA54 (0.003500%)
CTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATC19 (0.001232%)
CTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCC114 (0.007389%)
CTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATA343 (0.022233%)
CTCGAGGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAG10 (0.000648%)
CTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCT22 (0.001426%)
CTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGC37 (0.002398%)
CTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAA6 (0.000389%)
CTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGA10 (0.000648%)
CTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAG12 (0.000778%)
CTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATC26 (0.001685%)
CTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGC26 (0.001685%)
CTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGA128 (0.008297%)
CTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGG9 (0.000583%)
CTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTT86 (0.005574%)
CTCGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAAC12 (0.000778%)
CTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCA47 (0.003047%)
CTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCCGGATCAGCC6 (0.000389%)
CTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGG17 (0.001102%)
CTCTCGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAA16 (0.001037%)
CTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTT11 (0.000713%)
CTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTT59 (0.003824%)
CTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACT30 (0.001945%)
CTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTC10 (0.000648%)
CTGAAACTCGAGGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAA182 (0.011797%)
CTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTAT15 (0.000972%)
CTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTT6 (0.000389%)
CTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGA26 (0.001685%)
CTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAGGGGATGCTG20 (0.001296%)
CTGAGTACCTTCTCCTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCAC206 (0.013353%)
CTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTT10 (0.000648%)
CTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATT5 (0.000324%)
CTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATT20 (0.001296%)
CTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGC3 (0.000194%)
CTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTAC9 (0.000583%)
CTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTT36 (0.002333%)
CTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATG8 (0.000519%)
CTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGT59 (0.003824%)
CTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAAC38 (0.002463%)
CTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCC82 (0.005315%)
CTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCA15 (0.000972%)
CTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCCC5 (0.000324%)
CTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGA10 (0.000648%)
CTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAAC26 (0.001685%)
CTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAAT30 (0.001945%)
CTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGT77 (0.004991%)
CTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCT16 (0.001037%)
CTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGC17 (0.001102%)
CTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTT15 (0.000972%)
CTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAG80 (0.005186%)
CTGTGACCTTACGTAAAACTGTGAAACTGTGTGTAGCAGTGGGATTTGGAGACTCTTACATTCAGAAGGTGCAGAAAGAAATCAAGTTAGACTTTTAAAT6 (0.000389%)
CTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAA3 (0.000194%)
CTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTC24 (0.001556%)
CTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTG31 (0.002009%)
CTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCA62 (0.004019%)
CTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAAT18 (0.001167%)
CTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTC13 (0.000843%)
CTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCC7 (0.000454%)
CTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAA4 (0.000259%)
CTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTT7 (0.000454%)
CTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTG30 (0.001945%)
CTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCA25 (0.001620%)
CTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGA15 (0.000972%)
CTTCTCCTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCT67 (0.004343%)
CTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCC8 (0.000519%)
CTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACA5 (0.000324%)
CTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACC44 (0.002852%)
CTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAA5 (0.000324%)
CTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTG8 (0.000519%)
CTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCA5 (0.000324%)
CTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCA142 (0.009204%)
CTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTG16 (0.001037%)
CTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCAT32 (0.002074%)
CTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTAT15 (0.000972%)
CTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACA10 (0.000648%)
CTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTC32 (0.002074%)
CTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGC5 (0.000324%)
GAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAG53 (0.003435%)
GAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAA13 (0.000843%)
GAAACTGTGTGTAGCAGTGGGATTTGGAGACTCTTACATTCAGAAGGTGCAGAAAGAAATCAAGTTAGACTTTTAAATTCCTGGTGCTTGTGCCGAAGTC3 (0.000194%)
GAAAGAACGGCCAGTGTTCAATAGAAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTA16 (0.001037%)
GAAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTATGAACTCCCTGCTTTGATGAGAA3 (0.000194%)
GAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTG25 (0.001620%)
GAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGT5 (0.000324%)
GAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTC934 (0.060541%)
GAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTG25 (0.001620%)
GAACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGG7 (0.000454%)
GAACGGCCAGTGTTCAATAGAAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTATGAA8 (0.000519%)
GAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGA5 (0.000324%)
GAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGG3 (0.000194%)
GAACTGTATAGGAAGACGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGC11 (0.000713%)
GAAGACGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACA4 (0.000259%)
GAAGAGCACACGTCTGAACTCCAGTCACAACTGCAGCAAT24 (0.000622%)
GAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTC55 (0.003565%)
GAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGAC17 (0.001102%)
GAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCA5 (0.000324%)
GAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGA18 (0.001167%)
GAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATT7 (0.000454%)
GAATACGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATT7 (0.000454%)
GAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAA12 (0.000778%)
GAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCA24 (0.001556%)
GAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAG21 (0.001361%)
GAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGT4 (0.000259%)
GAATGCTATATCTGGGGCTCCGATTATTAGTGGGACAAGTCAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCA3 (0.000194%)
GACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTAC5 (0.000324%)
GACAAGTCAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCATGGGCAGTTACGATAACATTGTAAATTTGGTCA3 (0.000194%)
GACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACG12 (0.000778%)
GACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGG4 (0.000259%)
GACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGA4 (0.000259%)
GACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTC6 (0.000389%)
GACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTA5 (0.000324%)
GACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTC5 (0.000324%)
GACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGG4 (0.000259%)
GACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGA6 (0.000389%)
GACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAGGGGATGCTGTG7 (0.000454%)
GACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAA3 (0.000194%)
GACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGA5 (0.000324%)
GACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTC7 (0.000454%)
GAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGT4 (0.000259%)
GAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAA61 (0.003954%)
GAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATC10 (0.000648%)
GAGACCGCTGTGACCTTACGTAAAACTGTGAAACTGTGTGTAGCAGTGGGATTTGGAGACTCTTACATTCAGAAGGTGCAGAAAGAAATCAAGTTAGACT4 (0.000259%)
GAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGA4 (0.000259%)
GAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATC4 (0.000259%)
GAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTT3 (0.000194%)
GAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTG3663 (0.094973%)
GAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGC362 (0.023465%)
GAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTC3 (0.000194%)
GAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCC9 (0.000583%)
GAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGA25 (0.001620%)
GAGGAAGCTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTG130 (0.008426%)
GAGGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCC3 (0.000194%)
GAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGG10 (0.000648%)
GAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGA3 (0.000194%)
GAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAG3 (0.000194%)
GAGTACCTTCTCCTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCA12 (0.000778%)
GATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTG5 (0.000324%)
GATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGT12 (0.000778%)
GATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAAC3 (0.000194%)
GATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAG3 (0.000194%)
GATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTGCA60 (0.001556%)
GATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCT3 (0.000194%)
GATCTCTCGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATG17 (0.001102%)
GATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGA8 (0.000519%)
GATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGT5 (0.000324%)
GATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACA5 (0.000324%)
GATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTC22 (0.001426%)
GATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCA3 (0.000194%)
GATGTTGGACATGAAGGGGGCAACCACACGGGCCATGTCCACCTCCGGGATCTTGTTGGACTCAAGCTGTTTCTGGTTTTGCTCGGCCAAGTACTCCTGA41 (0.002658%)
GATTATTAGTGGGACAAGTCAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCATGGGCAGTTACGATAACATTG3 (0.000194%)
GATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGC6 (0.000389%)
GATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGA19 (0.001232%)
GATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCA6 (0.000389%)
GATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGAT49 (0.003176%)
GATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTATGAACTCCCTGCTTTGATGAGAAAAGG3 (0.000194%)
GATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGC5 (0.000324%)
GCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGT13 (0.001247%)
GCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGG45 (0.002917%)
GCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCAC434 (0.028132%)
GCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACC32 (0.002074%)
GCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACT15 (0.000972%)
GCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGAC10 (0.000648%)
GCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCA20 (0.001296%)
GCACTCCAGACTCCAGCCACACTCCAACACAGCACCATGATCCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGG8 (0.000519%)
GCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGT5 (0.000324%)
GCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCC16 (0.001037%)
GCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTC13 (0.000843%)
GCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTAT8 (0.000519%)
GCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCAC38 (0.002463%)
GCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGG12 (0.000778%)
GCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCA11 (0.000713%)
GCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAG5 (0.000324%)
GCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTC5 (0.000324%)
GCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTG54 (0.003500%)
GCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTC33 (0.002139%)
GCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAAC10 (0.000648%)
GCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATT5 (0.000324%)
GCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGT7 (0.000454%)
GCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTG14 (0.000907%)
GCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTC13 (0.000843%)
GCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGA9 (0.000583%)
GCCACACTCCAACACAGCACCATGATCCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCACAGGGGCGCCTA6 (0.000389%)
GCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCT42 (0.002722%)
GCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCT12 (0.000778%)
GCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCACAGGGGCGCCTATCGCCAATGAGCTGCGCTGTCAGTGCCTGC5 (0.000324%)
GCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGA6 (0.000389%)
GCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACA15 (0.000972%)
GCCACTCACCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCA457 (0.029622%)
GCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCCCGATGCCGACGCTCATCAGACCCCAGAAAAGGTGTTGGTT4 (0.000259%)
GCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGA38 (0.002463%)
GCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACC10 (0.000648%)
GCCAGTGTTCAATAGAAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTATGAACTCCC6 (0.000389%)
GCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCT3 (0.000194%)
GCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGT3 (0.000194%)
GCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGC12 (0.000778%)
GCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTG6 (0.000389%)
GCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAA84 (0.005445%)
GCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATG10 (0.000648%)
GCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATG8 (0.000519%)
GCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCC16 (0.001037%)
GCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCC8 (0.000519%)
GCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGC8 (0.000519%)
GCCGTATTGGGCGCCTGGTCACCAGGGCTGCCATTTGCAGTGGCAAAGTGGAGATTGTTGCCATCAACGACCCCTTCATTGACCTCAACTACATGGTCTA39 (0.002528%)
GCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCC17 (0.001102%)
GCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTG3 (0.000194%)
GCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGT8 (0.000519%)
GCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAA22 (0.001426%)
GCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATG19 (0.001232%)
GCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCG5 (0.000324%)
GCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAG40 (0.002593%)
GCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCCCGATGCCGACGCTCATCAGACCCCA3 (0.000194%)
GCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGC5 (0.000324%)
GCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTT3 (0.000194%)
GCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGG28 (0.001815%)
GCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACC11 (0.000713%)
GCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGA85 (0.005510%)
GCGGCTGGTACGACGCCGACCTGAGCCCGGCGGGCCACGAGGAGGCGAAGCGCGGCGGGCAGGCGTTGCGAGATGCTGGCTATGAATTTGACATCTGCTT12 (0.000778%)
GCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCA50 (0.003241%)
GCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGGG7 (0.000454%)
GCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACG181 (0.011732%)
GCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCG5 (0.000324%)
GCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGT18 (0.001167%)
GCTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCATCTA5 (0.000324%)
GCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCAC7 (0.000454%)
GCTATATCTGGGGCTCCGATTATTAGTGGGACAAGTCAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCATGGG4 (0.000259%)
GCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAG137 (0.008880%)
GCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTA59 (0.003824%)
GCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGTCC6 (0.000389%)
GCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAG48 (0.003111%)
GCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGG3 (0.000194%)
GCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCC18 (0.001167%)
GCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTA118 (0.007649%)
GCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAGGGGATGCT45 (0.002917%)
GCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCT8 (0.000519%)
GCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTG6 (0.000389%)
GCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACT7 (0.000454%)
GCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCC7 (0.000454%)
GCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGG20 (0.001296%)
GCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGAC14 (0.000907%)
GCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGT6 (0.000389%)
GCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCC1314 (0.085172%)
GCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCT14 (0.000907%)
GCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACA20 (0.001296%)
GCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCAC4 (0.000259%)
GGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGT15 (0.000972%)
GGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGG28 (0.001815%)
GGAACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAG11 (0.000713%)
GGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTG4 (0.000259%)
GGAACTGTATAGGAAGACGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCG10 (0.000648%)
GGAAGACGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGAC21 (0.001361%)
GGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTT3 (0.000194%)
GGAAGAGCACACGTCTGAACTCCAGTCACAACTGCAGCAA34 (0.000882%)
GGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTT92 (0.005963%)
GGAAGCTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCA8 (0.000519%)
GGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGT7 (0.000454%)
GGACAAGTCAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCATGGGCAGTTACGATAACATTGTAAATTTGGTC7 (0.000454%)
GGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGC4 (0.000259%)
GGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCT15 (0.000972%)
GGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGAT32 (0.002074%)
GGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGG3 (0.000194%)
GGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAG3 (0.000194%)
GGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGAT13 (0.000843%)
GGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAG40 (0.002593%)
GGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAG13 (0.000843%)
GGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAG10 (0.000648%)
GGAGGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAGG6 (0.000389%)
GGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATT23 (0.001491%)
GGATAACCTGCTAGCTCCTCGTGCCCTCGTATAGCCCAGAACTGATTTCCTTTAAAAATGAAAACAGTGTCTCTGTTAGTAACCTCATATGCAGCATCCA176 (0.011408%)
GGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTT10 (0.000648%)
GGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAG10 (0.000648%)
GGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTG3 (0.000194%)
GGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTG79 (0.007579%)
GGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATG43 (0.002787%)
GGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTC15 (0.000972%)
GGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGT17 (0.001102%)
GGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAG19 (0.001232%)
GGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAG7 (0.000454%)
GGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCAC14 (0.000907%)
GGCCAGTGTTCAATAGAAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTATGAACTCC11 (0.000713%)
GGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAG8 (0.000519%)
GGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGA6 (0.000389%)
GGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGG36 (0.002333%)
GGCGCCTGGTCACCAGGGCTGCCATTTGCAGTGGCAAAGTGGAGATTGTTGCCATCAACGACCCCTTCATTGACCTCAACTACATGGTCTACATGTTCCA3 (0.000194%)
GGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACC4 (0.000259%)
GGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAG5 (0.000324%)
GGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTT3 (0.000194%)
GGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAAC9 (0.000583%)
GGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTG18 (0.001167%)
GGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGG38 (0.002463%)
GGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACAT7 (0.000454%)
GGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCG3 (0.000194%)
GGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGA69 (0.004473%)
GGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTT16 (0.001037%)
GGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGT4 (0.000259%)
GGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCT14 (0.000907%)
GGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACT4 (0.000259%)
GGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACT13 (0.000843%)
GGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTG99 (0.006417%)
GGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCT14 (0.000907%)
GGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTC659 (0.042716%)
GGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCAC3 (0.000194%)
GGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCA10 (0.000648%)
GGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCC8 (0.000519%)
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG367 (0.009515%)
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG16 (0.001037%)
GGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCC12 (0.000778%)
GGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCA10 (0.000648%)
GGGTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAGGGGA3 (0.000194%)
GGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGG3 (0.000194%)
GGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAA4 (0.000259%)
GGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTG10 (0.000648%)
GGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTG14 (0.000907%)
GGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCC4 (0.000259%)
GGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAG5 (0.000324%)
GGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTG3 (0.000194%)
GGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTT10 (0.000648%)
GGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTG4 (0.000259%)
GGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGC5 (0.000324%)
GGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGG6 (0.000389%)
GGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAA10 (0.000648%)
GTACCTTCTCCTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGC23 (0.001491%)
GTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTT8 (0.000519%)
GTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCA6 (0.000389%)
GTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAG178 (0.011538%)
GTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAG14 (0.000907%)
GTATAGGAAGACGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTG4 (0.000259%)
GTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGG36 (0.002333%)
GTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGG33 (0.002139%)
GTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGC9 (0.000583%)
GTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCA12 (0.000778%)
GTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATT19 (0.001232%)
GTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACG26 (0.001685%)
GTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCA8 (0.000519%)
GTCAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCATGGGCAGTTACGATAACATTGTAAATTTGGTCATCTCC3 (0.000194%)
GTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGA15 (0.000972%)
GTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGGGTCGGAG11 (0.000713%)
GTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTC6 (0.000389%)
GTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGT16 (0.001037%)
GTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGA21 (0.001361%)
GTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACAT41 (0.002658%)
GTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAA5 (0.000324%)
GTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAAT32 (0.002074%)
GTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCCGGATCAGCCATGACCT11 (0.000713%)
GTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCC46 (0.002982%)
GTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCG19 (0.001232%)
GTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCAC25 (0.001620%)
GTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCT9 (0.000583%)
GTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCCGGATCAG3 (0.000194%)
GTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGG14 (0.000907%)
GTGAAACTGTGTGTAGCAGTGGGATTTGGAGACTCTTACATTCAGAAGGTGCAGAAAGAAATCAAGTTAGACTTTTAAATTCCTGGTGCTTGTGCCGAAG4 (0.000259%)
GTGAATACGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTA101 (0.006547%)
GTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGA11 (0.000713%)
GTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTC4 (0.000259%)
GTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGA6 (0.000389%)
GTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGAC33 (0.002139%)
GTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTT7 (0.000454%)
GTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATT6 (0.000389%)
GTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCC7 (0.000454%)
GTGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAGGGGATG4 (0.000259%)
GTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTC5 (0.000324%)
GTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCC4 (0.000259%)
GTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTG8 (0.000519%)
GTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGT7 (0.000454%)
GTGGGAATGCTATATCTGGGGCTCCGATTATTAGTGGGACAAGTCAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAA7 (0.000454%)
GTGGGACAAGTCAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCATGGGCAGTTACGATAACATTGTAAATTTG5 (0.000324%)
GTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCG16 (0.001037%)
GTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCA6 (0.000389%)
GTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTG106 (0.006871%)
GTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATG10 (0.000648%)
GTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGT11 (0.000713%)
GTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAG15 (0.000972%)
GTGTTCAATAGAAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTATGAACTCCCTGCT3 (0.000194%)
GTTCAAGACATTTTGAAAGGTTAACAACCAATGATTCTTGACTTACACACTAAAGTATCACAATTTCCGATAGTGTGACAGATAGGAAAGAATAGGAAAT12 (0.000778%)
GTTCAATAGAAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTATGAACTCCCTGCTTT12 (0.000778%)
GTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTT46 (0.002982%)
GTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTG10 (0.000648%)
GTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAG5 (0.000324%)
GTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGC31 (0.002009%)
GTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCC16 (0.001037%)
GTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAG7 (0.000454%)
GTTGGACATGAAGGGGGCAACCACACGGGCCATGTCCACCTCCGGGATCTTGTTGGACTCAAGCTGTTTCTGGTTTTGCTCGGCCAAGTACTCCTGAAGG3 (0.000194%)
GTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTA12 (0.000778%)
GTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGC8 (0.000519%)
GTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGA10 (0.000648%)
GTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAA77 (0.004991%)
TAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCA3 (0.000194%)
TAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTT4 (0.000259%)
TAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTT129 (0.008362%)
TACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATG5 (0.000324%)
TACCTTCTCCTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCT3 (0.000194%)
TACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTG4 (0.000259%)
TACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAAC3 (0.000194%)
TAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCC6 (0.000389%)
TAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGA5 (0.000324%)
TAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGG6 (0.000389%)
TAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTG2006 (0.052011%)
TAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTC4 (0.000259%)
TAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACAT3 (0.000194%)
TAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCAC5 (0.000324%)
TAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGT12 (0.000778%)
TAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTT51 (0.003306%)
TAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGG25 (0.001620%)
TAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGG3 (0.000194%)
TATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTG16 (0.001037%)
TATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTC11 (0.000713%)
TATAGGAAGACGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGC8 (0.000519%)
TATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTA5 (0.000324%)
TATCGGAACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTT3 (0.000194%)
TATGTATATGTATATGTATATGTATATGTATATGTATATG7 (0.000181%)
TATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGAC3 (0.000194%)
TATTAGTGGGACAAGTCAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAAGCATGGGCAGTTACGATAACATTGTAA4 (0.000259%)
TATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGT14 (0.000907%)
TCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGAC3 (0.000194%)
TCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGC3 (0.000194%)
TCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGT4 (0.000259%)
TCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCA4 (0.000259%)
TCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTT9 (0.000583%)
TCACCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGAT7 (0.000454%)
TCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCAC5 (0.000324%)
TCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATT8 (0.000519%)
TCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTG3 (0.000194%)
TCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCT3 (0.000194%)
TCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGC3 (0.000194%)
TCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCAC8 (0.000519%)
TCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCC8 (0.000519%)
TCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACAT5 (0.000324%)
TCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTT12 (0.000778%)
TCCACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGG72 (0.004667%)
TCCAGACTCCAGCCACACTCCAACACAGCACCATGATCCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCAC5 (0.000324%)
TCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGC4 (0.000259%)
TCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCA6 (0.000389%)
TCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGC4 (0.000259%)
TCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCCGGATCAGCCATG3 (0.000194%)
TCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACC15 (0.000972%)
TCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGAT5 (0.000324%)
TCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGC3 (0.000194%)
TCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAAT232 (0.015038%)
TCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATG8 (0.000519%)
TCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGG32 (0.002074%)
TCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATT6 (0.000389%)
TCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGC3 (0.000194%)
TCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGT3 (0.000194%)
TCCTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGC12 (0.000778%)
TCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCAT9 (0.000583%)
TCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCT5 (0.000324%)
TCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCA9 (0.000583%)
TCGAGGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGC4 (0.000259%)
TCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGC162 (0.010501%)
TCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATG8 (0.000519%)
TCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTT10 (0.000648%)
TCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCT6 (0.000389%)
TCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCCGGATCAGCCATGACCTC3 (0.000194%)
TCGCAGTGGAAAGAACGGCCAGTGTTCAATAGAAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGAT162 (0.010501%)
TCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCA10 (0.000648%)
TCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAG6 (0.000389%)
TCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGG22 (0.001426%)
TCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAG26 (0.001685%)
TCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCG4 (0.000259%)
TCGGAACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTT24 (0.001556%)
TCGGAAGAGCACACGTCTGAACTCCAGTCACAACTGCAGC8 (0.000207%)
TCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAG33 (0.002139%)
TCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGAT28 (0.001815%)
TCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCC20 (0.001296%)
TCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCC47 (0.003047%)
TCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTC6 (0.000389%)
TCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACA21 (0.001361%)
TCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAG21 (0.001361%)
TCTCCACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGC11 (0.000713%)
TCTCCTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGC5 (0.000324%)
TCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAG46 (0.002982%)
TCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGT45 (0.002917%)
TCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTT7 (0.000454%)
TCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTC16 (0.001037%)
TCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTC5 (0.000324%)
TCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGA16 (0.001037%)
TCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTC9 (0.000583%)
TCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAA13 (0.000843%)
TCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTA8 (0.000519%)
TGAAACTCGAGGAGACGCTCCGCGCCCTCGCGCTTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAA19 (0.001232%)
TGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGA11 (0.000713%)
TGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGC115 (0.007454%)
TGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCAT8 (0.000519%)
TGAATACGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTAT15 (0.000972%)
TGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAA4 (0.000259%)
TGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATG9 (0.000583%)
TGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTA15 (0.000972%)
TGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAG4 (0.000259%)
TGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGT20 (0.001296%)
TGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCA3 (0.000194%)
TGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAGGGGATGCTGT3 (0.000194%)
TGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCA5 (0.000324%)
TGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAG3 (0.000194%)
TGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTT11 (0.000713%)
TGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACT16 (0.001037%)
TGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTGTTCACGCTGCC8 (0.000519%)
TGAGTACCTTCTCCTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACC36 (0.002333%)
TGATCCCAGCCACCCGCTCGCTTCTCTGTGCAGCGCTGCTGCTGCTGGCCACCAGCCGCCTGGCCACAGGGGCGCCTATCGCCAATGAGCTGCGCTGTCA4 (0.000259%)
TGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGC4 (0.000259%)
TGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGAC10 (0.000648%)
TGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTT8 (0.000519%)
TGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCAC15 (0.000972%)
TGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACG3 (0.000194%)
TGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTA17 (0.001102%)
TGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCA18 (0.001167%)
TGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACT4 (0.000259%)
TGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTA20 (0.001296%)
TGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGA5 (0.000324%)
TGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATT9 (0.000583%)
TGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAAC3 (0.000194%)
TGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTT4 (0.000259%)
TGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAAT7 (0.000454%)
TGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGC3 (0.000194%)
TGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGT13 (0.000843%)
TGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGTC6 (0.000389%)
TGCTGACTGCATCAAAGAACAAAGTAGAGCTGCACATTGGTGATGTCTCAGGTTCCAGAGAGTTAGACTTGGTGGGTACCACGAGGACATCAGGGGATGC4 (0.000259%)
TGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACT18 (0.001167%)
TGGAACTGTATAGGAAGACGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGC370 (0.023983%)
TGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCCCGATGCCGACGCTCATCAG18 (0.001167%)
TGGACATGAAGGGGGCAACCACACGGGCCATGTCCACCTCCGGGATCTTGTTGGACTCAAGCTGTTTCTGGTTTTGCTCGGCCAAGTACTCCTGAAGGGA5 (0.000324%)
TGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTG4 (0.000259%)
TGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGA8 (0.000519%)
TGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCAT4 (0.000259%)
TGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGAT44 (0.002852%)
TGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCA17 (0.001102%)
TGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAG17 (0.001102%)
TGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGAC7 (0.000454%)
TGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACT16 (0.001037%)
TGGGAATGCTATATCTGGGGCTCCGATTATTAGTGGGACAAGTCAGTTTCCAAAGCCTCCAATTATTATTGGTATTACTATGAAGAAAATTATAACAAAA19 (0.001232%)
TGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATG16 (0.001037%)
TGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTT21 (0.001361%)
TGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGC16 (0.001037%)
TGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTC13 (0.000843%)
TGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGT33 (0.002139%)
TGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGC9 (0.000583%)
TGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCG5 (0.000324%)
TGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGT39 (0.002528%)
TGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTG5 (0.000324%)
TGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGA11 (0.000713%)
TGTATAGGAAGACGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTT3 (0.000194%)
TGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATC9 (0.000583%)
TGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTG23 (0.001491%)
TGTGACCTTACGTAAAACTGTGAAACTGTGTGTAGCAGTGGGATTTGGAGACTCTTACATTCAGAAGGTGCAGAAAGAAATCAAGTTAGACTTTTAAATT3 (0.000194%)
TGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGA5 (0.000324%)
TGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCT9 (0.000583%)
TTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCCG4 (0.000259%)
TTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAG6 (0.000389%)
TTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGT3 (0.000194%)
TTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCA4 (0.000259%)
TTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCT6 (0.000389%)
TTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGT11 (0.000713%)
TTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAG15 (0.000972%)
TTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATG5 (0.000324%)
TTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCA11 (0.000713%)
TTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTT4 (0.000259%)
TTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGC7 (0.000454%)
TTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCG9 (0.000583%)
TTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCAT186 (0.012056%)
TTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGG13 (0.000843%)
TTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCAC5 (0.000324%)
TTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGG3 (0.000194%)
TTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCAC9 (0.000583%)
TTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGC8 (0.000519%)
TTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGAC14 (0.000907%)
TTCTCCTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTG6 (0.000389%)
TTCTCCTCGGCCAATTCGCGGAAGAAGTGGCCTACGCCCTCCAGAGCCACGTCATCCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCC3 (0.000194%)
TTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACA12 (0.000778%)
TTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCG10 (0.000648%)
TTCTGGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCT11 (0.000713%)
TTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCA23 (0.001491%)
TTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATG5 (0.000324%)
TTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGC8 (0.000519%)
TTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAG4 (0.000259%)
TTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGA11 (0.000713%)
TTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGA18 (0.001167%)
TTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCAC13 (0.000843%)
TTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGT16 (0.001037%)
TTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAG6 (0.000389%)
TTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCA3 (0.000194%)
TTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGG14 (0.000907%)
TTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCAT12 (0.000778%)
TTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGCGGTTAGCTCCTACTCC5 (0.000324%)
TTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATG3 (0.000194%)
TTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATC392 (0.025409%)
TTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATT28 (0.001815%)
TTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGAC5 (0.000324%)
TTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACCCACGGATTTTCTTTATGAACTCCCTGCTTTGATGAGAAAAGGGA7 (0.000454%)
TTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAG18 (0.001167%)
TTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACC376 (0.024372%)
TTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACAT48 (0.003111%)
TTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTG7 (0.000454%)
TTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAG138 (0.008945%)
TTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTC99 (0.006417%)
TTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCC23 (0.001491%)
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT299 (0.007752%)