fastp report
General
fastp version:0.23.1 (https://github.com/OpenGene/fastp)
sequencing:paired end (150 cycles + 150 cycles)
mean length before filtering:150bp, 150bp
mean length after filtering:143bp, 143bp
duplication rate:30.057449%
Insert size peak:261
Before filtering
total reads:42.098356 M
total bases:6.314753 G
Q20 bases:6.115893 G (96.850855%)
Q30 bases:5.825414 G (92.250858%)
GC content:50.833532%
After filtering
total reads:41.700296 M
total bases:5.983292 G
Q20 bases:5.837554 G (97.564245%)
Q30 bases:5.573864 G (93.157142%)
GC content:50.690148%
Filtering result
reads passed filters:41.700296 M (99.054452%)
reads with low quality:360.160000 K (0.855520%)
reads with too many N:11.202000 K (0.026609%)
reads too short:26.698000 K (0.063418%)
Adapter or bad ligation of read1
The input has little adapter percentage (~0.641631%), probably it's trimmed before.
SequenceOccurrences
A17651
AG18194
AGA19189
AGAT17896
AGATC16909
AGATCG17887
AGATCGG17039
AGATCGGA15192
AGATCGGAA14901
AGATCGGAAG15068
AGATCGGAAGA14378
AGATCGGAAGAG14656
AGATCGGAAGAGC14739
AGATCGGAAGAGCA15005
AGATCGGAAGAGCAC16444
AGATCGGAAGAGCACA16043
AGATCGGAAGAGCACAC13536
AGATCGGAAGAGCACACG12906
AGATCGGAAGAGCACACGT11506
AGATCGGAAGAGCACACGTC11537
AGATCGGAAGAGCACACGTCT11565
AGATCGGAAGAGCACACGTCTG12713
AGATCGGAAGAGCACACGTCTGA12295
AGATCGGAAGAGCACACGTCTGAA11985
AGATCGGAAGAGCACACGTCTGAAC12220
AGATCGGAAGAGCACACGTCTGAACT11766
AGATCGGAAGAGCACACGTCTGAACTC11308
AGATCGGAAGAGCACACGTCTGAACTCC10698
AGATCGGAAGAGCACACGTCTGAACTCCA9716
AGATCGGAAGAGCACACGTCTGAACTCCAG9479
AGATCGGAAGAGCACACGTCTGAACTCCAGT8695
AGATCGGAAGAGCACACGTCTGAACTCCAGTC9950
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA10312
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC10548
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACC9067
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCG8845
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGT8362
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTG8464
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGC8190
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGCA8615
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGCATA14601
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGCATAG8706
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGCATAGA9012
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGCATAGAA35266
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGCATAGAAT8822
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGCATAGAATCT12335
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGCATAGAATCGC7932
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGCATAGAATCTC35413
other adapter sequences104090
Adapter or bad ligation of read2
The input has little adapter percentage (~0.682683%), probably it's trimmed before.
SequenceOccurrences
A18674
AG18694
AGA18927
AGAT17843
AGATC18239
AGATCG23133
AGATCGG16299
AGATCGGA15195
AGATCGGAA12678
AGATCGGAAG13693
AGATCGGAAGA12478
AGATCGGAAGAG18096
AGATCGGAAGAGC14107
AGATCGGAAGAGCG14547
AGATCGGAAGAGCGT22136
AGATCGGAAGAGCGTC12746
AGATCGGAAGAGCGTCG19143
AGATCGGAAGAGCGTCGT13245
AGATCGGAAGAGCGTCGTG10252
AGATCGGAAGAGCGTCGTGTA7668
AGATCGGAAGAGCGTCGTGTAG10409
AGATCGGAAGAGCGTCGTGTAGG17753
AGATCGGAAGAGCGTCGTGTAGGG12868
AGATCGGAAGAGCGTCGTGTAGGGA10976
AGATCGGAAGAGCGTCGTGTAGGGAAAGA7957
AGATCGGAAGAGCGTCGTGTAGGGAAAGAG8213
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGT8372
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG8238
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT9153
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTC9201
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCG11570
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCGA7693
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCGACTG7911
other adapter sequences313757
This estimation is based on paired-end overlap analysis, and there are 60.465120% reads found not overlapped.
The nonoverlapped read pairs may have insert size <30 or >270, or contain too much sequencing errors to be detected as overlapped.
Value of each position will be shown on mouse over.
Value of each position will be shown on mouse over.
Darker background means larger counts. The count will be shown on mouse over.
AAATACAGTATTTCTGCACTCCCGGAGTGCGG
AAAAAAAAAAAATAAAACAAAAGAAATAAAATTAAATCAAATGAAACAAAACTAAACCAAACGAAAGAAAAGTAAAGCAAAGG
AATAATAAAATATAATACAATAGAATTAAATTTAATTCAATTGAATCAAATCTAATCCAATCGAATGAAATGTAATGCAATGG
AACAACAAAACATAACACAACAGAACTAAACTTAACTCAACTGAACCAAACCTAACCCAACCGAACGAAACGTAACGCAACGG
AAGAAGAAAAGATAAGACAAGAGAAGTAAAGTTAAGTCAAGTGAAGCAAAGCTAAGCCAAGCGAAGGAAAGGTAAGGCAAGGG
ATAATAAAATAATATAACATAAGATATAATATTATATCATATGATACAATACTATACCATACGATAGAATAGTATAGCATAGG
ATTATTAAATTATATTACATTAGATTTAATTTTATTTCATTTGATTCAATTCTATTCCATTCGATTGAATTGTATTGCATTGG
ATCATCAAATCATATCACATCAGATCTAATCTTATCTCATCTGATCCAATCCTATCCCATCCGATCGAATCGTATCGCATCGG
ATGATGAAATGATATGACATGAGATGTAATGTTATGTCATGTGATGCAATGCTATGCCATGCGATGGAATGGTATGGCATGGG
ACAACAAAACAATACAACACAAGACATAACATTACATCACATGACACAACACTACACCACACGACAGAACAGTACAGCACAGG
ACTACTAAACTATACTACACTAGACTTAACTTTACTTCACTTGACTCAACTCTACTCCACTCGACTGAACTGTACTGCACTGG
ACCACCAAACCATACCACACCAGACCTAACCTTACCTCACCTGACCCAACCCTACCCCACCCGACCGAACCGTACCGCACCGG
ACGACGAAACGATACGACACGAGACGTAACGTTACGTCACGTGACGCAACGCTACGCCACGCGACGGAACGGTACGGCACGGG
AGAAGAAAAGAATAGAACAGAAGAGATAAGATTAGATCAGATGAGACAAGACTAGACCAGACGAGAGAAGAGTAGAGCAGAGG
AGTAGTAAAGTATAGTACAGTAGAGTTAAGTTTAGTTCAGTTGAGTCAAGTCTAGTCCAGTCGAGTGAAGTGTAGTGCAGTGG
AGCAGCAAAGCATAGCACAGCAGAGCTAAGCTTAGCTCAGCTGAGCCAAGCCTAGCCCAGCCGAGCGAAGCGTAGCGCAGCGG
AGGAGGAAAGGATAGGACAGGAGAGGTAAGGTTAGGTCAGGTGAGGCAAGGCTAGGCCAGGCGAGGGAAGGGTAGGGCAGGGG
TAATAAAATAAATTAAACTAAAGTAATATAATTTAATCTAATGTAACATAACTTAACCTAACGTAAGATAAGTTAAGCTAAGG
TATTATAATATATTATACTATAGTATTATATTTTATTCTATTGTATCATATCTTATCCTATCGTATGATATGTTATGCTATGG
TACTACAATACATTACACTACAGTACTATACTTTACTCTACTGTACCATACCTTACCCTACCGTACGATACGTTACGCTACGG
TAGTAGAATAGATTAGACTAGAGTAGTATAGTTTAGTCTAGTGTAGCATAGCTTAGCCTAGCGTAGGATAGGTTAGGCTAGGG
TTATTAAATTAATTTAACTTAAGTTATATTATTTTATCTTATGTTACATTACTTTACCTTACGTTAGATTAGTTTAGCTTAGG
TTTTTTAATTTATTTTACTTTAGTTTTATTTTTTTTTCTTTTGTTTCATTTCTTTTCCTTTCGTTTGATTTGTTTTGCTTTGG
TTCTTCAATTCATTTCACTTCAGTTCTATTCTTTTCTCTTCTGTTCCATTCCTTTCCCTTCCGTTCGATTCGTTTCGCTTCGG
TTGTTGAATTGATTTGACTTGAGTTGTATTGTTTTGTCTTGTGTTGCATTGCTTTGCCTTGCGTTGGATTGGTTTGGCTTGGG
TCATCAAATCAATTCAACTCAAGTCATATCATTTCATCTCATGTCACATCACTTCACCTCACGTCAGATCAGTTCAGCTCAGG
TCTTCTAATCTATTCTACTCTAGTCTTATCTTTTCTTCTCTTGTCTCATCTCTTCTCCTCTCGTCTGATCTGTTCTGCTCTGG
TCCTCCAATCCATTCCACTCCAGTCCTATCCTTTCCTCTCCTGTCCCATCCCTTCCCCTCCCGTCCGATCCGTTCCGCTCCGG
TCGTCGAATCGATTCGACTCGAGTCGTATCGTTTCGTCTCGTGTCGCATCGCTTCGCCTCGCGTCGGATCGGTTCGGCTCGGG
TGATGAAATGAATTGAACTGAAGTGATATGATTTGATCTGATGTGACATGACTTGACCTGACGTGAGATGAGTTGAGCTGAGG
TGTTGTAATGTATTGTACTGTAGTGTTATGTTTTGTTCTGTTGTGTCATGTCTTGTCCTGTCGTGTGATGTGTTGTGCTGTGG
TGCTGCAATGCATTGCACTGCAGTGCTATGCTTTGCTCTGCTGTGCCATGCCTTGCCCTGCCGTGCGATGCGTTGCGCTGCGG
TGGTGGAATGGATTGGACTGGAGTGGTATGGTTTGGTCTGGTGTGGCATGGCTTGGCCTGGCGTGGGATGGGTTGGGCTGGGG
CAACAAAACAAATCAAACCAAAGCAATACAATTCAATCCAATGCAACACAACTCAACCCAACGCAAGACAAGTCAAGCCAAGG
CATCATAACATATCATACCATAGCATTACATTTCATTCCATTGCATCACATCTCATCCCATCGCATGACATGTCATGCCATGG
CACCACAACACATCACACCACAGCACTACACTTCACTCCACTGCACCACACCTCACCCCACCGCACGACACGTCACGCCACGG
CAGCAGAACAGATCAGACCAGAGCAGTACAGTTCAGTCCAGTGCAGCACAGCTCAGCCCAGCGCAGGACAGGTCAGGCCAGGG
CTACTAAACTAATCTAACCTAAGCTATACTATTCTATCCTATGCTACACTACTCTACCCTACGCTAGACTAGTCTAGCCTAGG
CTTCTTAACTTATCTTACCTTAGCTTTACTTTTCTTTCCTTTGCTTCACTTCTCTTCCCTTCGCTTGACTTGTCTTGCCTTGG
CTCCTCAACTCATCTCACCTCAGCTCTACTCTTCTCTCCTCTGCTCCACTCCTCTCCCCTCCGCTCGACTCGTCTCGCCTCGG
CTGCTGAACTGATCTGACCTGAGCTGTACTGTTCTGTCCTGTGCTGCACTGCTCTGCCCTGCGCTGGACTGGTCTGGCCTGGG
CCACCAAACCAATCCAACCCAAGCCATACCATTCCATCCCATGCCACACCACTCCACCCCACGCCAGACCAGTCCAGCCCAGG
CCTCCTAACCTATCCTACCCTAGCCTTACCTTTCCTTCCCTTGCCTCACCTCTCCTCCCCTCGCCTGACCTGTCCTGCCCTGG
CCCCCCAACCCATCCCACCCCAGCCCTACCCTTCCCTCCCCTGCCCCACCCCTCCCCCCCCCGCCCGACCCGTCCCGCCCCGG
CCGCCGAACCGATCCGACCCGAGCCGTACCGTTCCGTCCCGTGCCGCACCGCTCCGCCCCGCGCCGGACCGGTCCGGCCCGGG
CGACGAAACGAATCGAACCGAAGCGATACGATTCGATCCGATGCGACACGACTCGACCCGACGCGAGACGAGTCGAGCCGAGG
CGTCGTAACGTATCGTACCGTAGCGTTACGTTTCGTTCCGTTGCGTCACGTCTCGTCCCGTCGCGTGACGTGTCGTGCCGTGG
CGCCGCAACGCATCGCACCGCAGCGCTACGCTTCGCTCCGCTGCGCCACGCCTCGCCCCGCCGCGCGACGCGTCGCGCCGCGG
CGGCGGAACGGATCGGACCGGAGCGGTACGGTTCGGTCCGGTGCGGCACGGCTCGGCCCGGCGCGGGACGGGTCGGGCCGGGG
GAAGAAAAGAAATGAAACGAAAGGAATAGAATTGAATCGAATGGAACAGAACTGAACCGAACGGAAGAGAAGTGAAGCGAAGG
GATGATAAGATATGATACGATAGGATTAGATTTGATTCGATTGGATCAGATCTGATCCGATCGGATGAGATGTGATGCGATGG
GACGACAAGACATGACACGACAGGACTAGACTTGACTCGACTGGACCAGACCTGACCCGACCGGACGAGACGTGACGCGACGG
GAGGAGAAGAGATGAGACGAGAGGAGTAGAGTTGAGTCGAGTGGAGCAGAGCTGAGCCGAGCGGAGGAGAGGTGAGGCGAGGG
GTAGTAAAGTAATGTAACGTAAGGTATAGTATTGTATCGTATGGTACAGTACTGTACCGTACGGTAGAGTAGTGTAGCGTAGG
GTTGTTAAGTTATGTTACGTTAGGTTTAGTTTTGTTTCGTTTGGTTCAGTTCTGTTCCGTTCGGTTGAGTTGTGTTGCGTTGG
GTCGTCAAGTCATGTCACGTCAGGTCTAGTCTTGTCTCGTCTGGTCCAGTCCTGTCCCGTCCGGTCGAGTCGTGTCGCGTCGG
GTGGTGAAGTGATGTGACGTGAGGTGTAGTGTTGTGTCGTGTGGTGCAGTGCTGTGCCGTGCGGTGGAGTGGTGTGGCGTGGG
GCAGCAAAGCAATGCAACGCAAGGCATAGCATTGCATCGCATGGCACAGCACTGCACCGCACGGCAGAGCAGTGCAGCGCAGG
GCTGCTAAGCTATGCTACGCTAGGCTTAGCTTTGCTTCGCTTGGCTCAGCTCTGCTCCGCTCGGCTGAGCTGTGCTGCGCTGG
GCCGCCAAGCCATGCCACGCCAGGCCTAGCCTTGCCTCGCCTGGCCCAGCCCTGCCCCGCCCGGCCGAGCCGTGCCGCGCCGG
GCGGCGAAGCGATGCGACGCGAGGCGTAGCGTTGCGTCGCGTGGCGCAGCGCTGCGCCGCGCGGCGGAGCGGTGCGGCGCGGG
GGAGGAAAGGAATGGAACGGAAGGGATAGGATTGGATCGGATGGGACAGGACTGGACCGGACGGGAGAGGAGTGGAGCGGAGG
GGTGGTAAGGTATGGTACGGTAGGGTTAGGTTTGGTTCGGTTGGGTCAGGTCTGGTCCGGTCGGGTGAGGTGTGGTGCGGTGG
GGCGGCAAGGCATGGCACGGCAGGGCTAGGCTTGGCTCGGCTGGGCCAGGCCTGGCCCGGCCGGGCGAGGCGTGGCGCGGCGG
GGGGGGAAGGGATGGGACGGGAGGGGTAGGGTTGGGTCGGGTGGGGCAGGGCTGGGCCGGGCGGGGGAGGGGTGGGGCGGGGG
Sampling rate: 1 / 20
overrepresented sequencecount (% of bases)distribution: cycle 1 ~ cycle 150
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA2256 (0.057161%)
AAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCA136 (0.008615%)
AAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAG10 (0.000633%)
AAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAG49 (0.003104%)
AAAAAGGGCCGCGGCCATGTGCAGCCCATTCGCTGCACGAACTGCGCCCGGTGCGTGCCCAAGGATAAGGCCATCAAGAAGTTTGTCATTCGGAACATTG5 (0.000317%)
AAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGA6 (0.000380%)
AAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGA45 (0.002850%)
AAAAGCATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACA6 (0.000380%)
AAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGCCCCCTCGATGCTC12 (0.000760%)
AAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACT24 (0.001520%)
AAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGA14 (0.000887%)
AAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGC21 (0.001330%)
AAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGT3 (0.000190%)
AAAATTCTTTATTTGAAGAAATGGTACAAATTAAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACT23 (0.001457%)
AAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCT152 (0.009628%)
AAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACGAGAAGTAATA7 (0.000443%)
AAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTG32 (0.002027%)
AAACGCACCAAGAAGGTCGGCATCGTCGGCAAGTACGGGACCCGCTATGGTGCCTCCCTCCGGAAAATGGTGAAGAAAATTGAAATCAGCCAGCACGCCA5 (0.000317%)
AAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGG41 (0.002597%)
AAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGA8 (0.000507%)
AAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCG4 (0.000253%)
AAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCAC98 (0.006208%)
AAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAG115 (0.002914%)
AAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTG44 (0.002787%)
AAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTG68 (0.004307%)
AAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGA77 (0.004877%)
AAAGAAGTAGGTCTTCCTTTTCTCTTTATTAGAAATGGCAGCATCGATCTTCTTCACGGTTGCAGGGAGACCCAGGGTGTGAATGCTTTTAGGATAACCT140 (0.008868%)
AAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTG3 (0.000190%)
AAAGAGATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTG5 (0.000317%)
AAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAA36 (0.002280%)
AAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAA15 (0.000950%)
AAAGCATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAA37 (0.002344%)
AAAGCGAATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTG3 (0.000190%)
AAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCA7 (0.000443%)
AAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTT6 (0.000380%)
AAAGGCCCCTACTGGTTTAATAGCTGCTGAGATGGATTGTCTTGTCCTGCCGCCCTTTGCTGTGTGGGCAGTACTCTGAAGCAGGCAAATGGGTCTTAGG18 (0.001140%)
AAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGAT5 (0.000317%)
AAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGG117 (0.007411%)
AAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACC7 (0.000443%)
AAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTG10 (0.000633%)
AAAGTGACGGCTCTGGTAGTCCTCAGAGCCCACGAGGACCTGATCCGTCCACAAACAGTGAGTGTCACTCTCCAGTTTGCAAGGGATAGATAAACAGGGA4 (0.000253%)
AAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCA8 (0.000507%)
AAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTTGCCTCTCGG7 (0.000443%)
AAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCA24 (0.001520%)
AAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGA23 (0.001457%)
AAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAA3 (0.000190%)
AAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGTGCC9 (0.000570%)
AAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAA8 (0.000507%)
AAATTAAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGG29 (0.001837%)
AAATTCTTTATTTGAAGAAATGGTACAAATTAAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTG5 (0.000317%)
AACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTA6 (0.000380%)
AACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACGAGAAGTAATAT4 (0.000253%)
AACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTA17 (0.001077%)
AACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCA3 (0.000190%)
AACATTCTTTCCTTCTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGAC16 (0.001013%)
AACCAACCCGGTGAGCTCCCTCCCGGCTCCGGCCGGGGGTCGGGCGCCGGCGGCTTTGGTGACTCTAGATAACCTCGGGCCGATCGCACGCCCCCCGTGG5 (0.000317%)
AACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGG8 (0.000507%)
AACCATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCT3 (0.000190%)
AACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGC3 (0.000190%)
AACCGATCTCTCGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCA770 (0.048775%)
AACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAAT6 (0.000380%)
AACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAA3 (0.000190%)
AACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTT21 (0.001330%)
AACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCGCGGCGGCG4 (0.000253%)
AACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGG3 (0.000190%)
AACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGG29 (0.001837%)
AACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGC11 (0.000697%)
AACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAG3 (0.000190%)
AACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGA26 (0.001647%)
AACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGG3 (0.000190%)
AACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATG4 (0.000253%)
AACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGA3 (0.000190%)
AACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGAC3 (0.000190%)
AACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGC5 (0.000317%)
AAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTC24 (0.001520%)
AAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACA90 (0.005701%)
AAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGA79 (0.002002%)
AAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCA75 (0.004751%)
AAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGG16 (0.001013%)
AAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGTCCCGTGGGCTGCTCCAAATGTGCCCAGGGCTGTGTCTGCAAAGGCGCCGCGG6 (0.000380%)
AAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGA5 (0.000317%)
AAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGG16 (0.001013%)
AAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCC40 (0.002534%)
AAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAA19 (0.001204%)
AAGAAGTAGGTCTTCCTTTTCTCTTTATTAGAAATGGCAGCATCGATCTTCTTCACGGTTGCAGGGAGACCCAGGGTGTGAATGCTTTTAGGATAACCTG3 (0.000190%)
AAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGA5 (0.000317%)
AAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAG7 (0.000443%)
AAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGAGTCGTTCTGCCAATAGA3 (0.000190%)
AAGAGAATGCGCAGGCTGAAGCGCAAGAGAAGAAAGATGAGGCAGAGGTCCAAGTAAGCCAGCCCGTGCACCTACGACGCCTGCAGGAGCAGAAGTGAGG3 (0.000190%)
AAGAGATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTGA6 (0.000380%)
AAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAAC22 (0.001394%)
AAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCGCAGTTGGAAT8 (0.000507%)
AAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGC4 (0.000253%)
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGC2268 (0.057465%)
AAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCA8 (0.000507%)
AAGCAGTCATATATTAAATGTGTGTATCCCATGAGCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAACTTGAAGGCTA4 (0.000253%)
AAGCATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAA8 (0.000507%)
AAGCCACTCACCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGAC556 (0.052124%)
AAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGG4 (0.000253%)
AAGCGAATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGG5 (0.000317%)
AAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAG3 (0.000190%)
AAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCAC21 (0.001330%)
AAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGA12 (0.000760%)
AAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTA11 (0.000697%)
AAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTT5 (0.000317%)
AAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCGCCGGCAGTCGGAACG3 (0.000190%)
AAGGCTTCAGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACGGCTCTGGTAGTCCTCAGAGCCCA3 (0.000190%)
AAGGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGA8 (0.000507%)
AAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGC4 (0.000253%)
AAGTATTTATTCAGCACATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGA4 (0.000253%)
AAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGC46 (0.002914%)
AAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTG4 (0.000253%)
AAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCC5 (0.000317%)
AAGTCAGAATCCCGCCCAGGCGGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTC3 (0.000190%)
AAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGG15 (0.000950%)
AAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTC4 (0.000253%)
AAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAG7 (0.000443%)
AAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTTGCCTCTCGGC3 (0.000190%)
AAGTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTGGTAAGAAGCTGGAAGATGGCCCCAAGTTCCTGAAGTCTGGCGATGCTGCCATTGTTGATA3 (0.000190%)
AATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAG3 (0.000190%)
AATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAA27 (0.001710%)
AATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAA9 (0.000570%)
AATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCC3 (0.000190%)
AATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGAGT17 (0.001077%)
AATCACACCACATCATGTGTTTAAGCACGAGTAGAGTACAAGAGTTTCTTCTGGCTGCTCAATGCTGCCTGGCAGAAAAATGGTCCAGTGCTCACTTCTG4 (0.000253%)
AATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAAT9 (0.000570%)
AATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTT15 (0.000950%)
AATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGG11 (0.000697%)
AATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCGCCGGCAG3 (0.000190%)
AATCCTTATCCCGAAGTTACGGATCCGGCTTGCCGACTTCCCTTACCTACATTGTTCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATA3 (0.000190%)
AATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGA4 (0.000253%)
AATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAG11 (0.000697%)
AATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCC25 (0.001584%)
AATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGC9 (0.000570%)
AATGTGACCTCTCTCATATCTACTCCTACAGTGAGAAAGAGACCGAATGAGCTGCAGTAGAAGCACACCGCGGTCAGACTCCGCAGTTCCGAATATACTG3 (0.000190%)
AATTAAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGC18 (0.001140%)
AATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCG4 (0.000253%)
AATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGT3 (0.000190%)
ACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTG17 (0.001077%)
ACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGA8 (0.000750%)
ACAAATTAAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGT11 (0.000697%)
ACAACATTCTTTCCTTCTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAG12 (0.000760%)
ACAAGTATTTATTCAGCACATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGG4 (0.000253%)
ACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCC4 (0.000253%)
ACACAGCAAGCAGTCATATATTAAATGTGTGTATCCCATGAGCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAACTTG4 (0.000253%)
ACACAGCCCACATAGCATGCAAGTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTGGTAAGAAGCTGGAAGATGGCCCCAAGTTCCTGAAGTCTGG6 (0.000380%)
ACACAGTTCAGACACTTGTTTGTGGCCCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACT25 (0.001584%)
ACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACG3 (0.000190%)
ACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTCGGGGCGAAC7 (0.000443%)
ACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCAC6 (0.000380%)
ACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGT11 (0.000697%)
ACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAAT3 (0.000190%)
ACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCA3 (0.000190%)
ACATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAA3 (0.000190%)
ACCAAAATTCTTTATTTGAAGAAATGGTACAAATTAAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGC3 (0.000190%)
ACCAACCCGGTGAGCTCCCTCCCGGCTCCGGCCGGGGGTCGGGCGCCGGCGGCTTTGGTGACTCTAGATAACCTCGGGCCGATCGCACGCCCCCCGTGGC3 (0.000190%)
ACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGAGAGCTAAGCTGACTTCC5 (0.000317%)
ACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCG6 (0.000380%)
ACCACATCATGTGTTTAAGCACGAGTAGAGTACAAGAGTTTCTTCTGGCTGCTCAATGCTGCCTGGCAGAAAAATGGTCCAGTGCTCACTTCTGCTTAGA3 (0.000190%)
ACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGA7 (0.000443%)
ACCAGACAGCAGGAGAAGATAATTCCCAAGACCTCCACAAAAGCAATGCCCAGGGCCGCTGCAGCCACCAGCAGTATGTTCTTCCTTAGCCATATTGCTA3 (0.000190%)
ACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGA3 (0.000190%)
ACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGT5 (0.000317%)
ACCAGTTCTAAGTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAG15 (0.000950%)
ACCATACTCCCCCCGGAACCCAAAGACTTTGGTTTCCCGGAAGCTGCCCGGCGGGTCATGGGAATAACGCCGCCGCATCGCCAGTCGGCATCGTTTATGG4 (0.000253%)
ACCATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTT5 (0.000317%)
ACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCA5 (0.000317%)
ACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCC5 (0.000317%)
ACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTCGGGGCGAACCC6 (0.000380%)
ACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCA4 (0.000253%)
ACCGATCTCTCGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAA40 (0.002534%)
ACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATA3 (0.000190%)
ACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCA3 (0.000190%)
ACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCA5 (0.000317%)
ACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGT5 (0.000317%)
ACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCA4 (0.000253%)
ACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCG3 (0.000190%)
ACGAGACTCTGGCATGCTAACTAGTTACGCGACCCCCGAGCGGTCGGCGTCCCCCAACTTCTTAGAGGGACAAGTGGCGTTCAGCCACCCGAGATTGAGC7 (0.000443%)
ACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTG4 (0.000253%)
ACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGT35 (0.002217%)
ACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATA353 (0.022360%)
ACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCT7 (0.000443%)
ACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCC20 (0.001267%)
ACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTA221 (0.013999%)
ACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGG3 (0.000190%)
ACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCA3 (0.000190%)
ACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGC837 (0.053019%)
ACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGAGAGCTAAGCTGA15 (0.000950%)
ACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTT3 (0.000190%)
ACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTG16 (0.001500%)
ACTACACAGCAAGCAGTCATATATTAAATGTGTGTATCCCATGAGCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAAC4 (0.000253%)
ACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGA6 (0.000380%)
ACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAA6 (0.000380%)
ACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGC7 (0.000443%)
ACTCACCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTG450 (0.042187%)
ACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTC4 (0.000253%)
ACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGC5 (0.000317%)
ACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCG3 (0.000190%)
ACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGC8 (0.000507%)
ACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGT43 (0.002724%)
ACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGAGTCGTTC3 (0.000190%)
ACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGT8 (0.000507%)
ACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTAT4 (0.000253%)
ACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAA8 (0.000507%)
ACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAA4 (0.000253%)
ACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGAG3 (0.000190%)
ACTGGGTGGGCCTTGGCCTCCTTCAGACAGGCAGAGGGCAGCAATCTGAACCCAGGGTGAGGAACCACAGAACAGAACAGCTGGACAAGCTCCAGCCAGG4 (0.000253%)
ACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACGAGAAGTAATATCAG9 (0.000570%)
ACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAA12 (0.000760%)
ACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTT4 (0.000253%)
ACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCT12 (0.000760%)
ACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAA23 (0.001457%)
ACTTTCTTCTCCTCAGCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATTGC6 (0.000380%)
AGAAAAAGTTGTGGAGAACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGG5 (0.000317%)
AGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGA12 (0.000760%)
AGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAG3 (0.000190%)
AGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCT6 (0.000380%)
AGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAA95 (0.006018%)
AGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAAT20 (0.001267%)
AGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAA119 (0.003015%)
AGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCAT9 (0.000570%)
AGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCT37 (0.002344%)
AGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTT4 (0.000253%)
AGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGA12 (0.000760%)
AGAACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCAC7 (0.000443%)
AGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCG15 (0.000950%)
AGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGG11 (0.000697%)
AGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGTGCCGTTCCGAAGGGAC8 (0.000507%)
AGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCT4 (0.000253%)
AGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTT9 (0.000570%)
AGAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAA6 (0.000380%)
AGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGA40 (0.002534%)
AGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCC9 (0.000570%)
AGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAAC23 (0.001457%)
AGAAGGTCGGCATCGTCGGCAAGTACGGGACCCGCTATGGTGCCTCCCTCCGGAAAATGGTGAAGAAAATTGAAATCAGCCAGCACGCCAAGTACACTTG4 (0.000253%)
AGAAGTAGGTCTTCCTTTTCTCTTTATTAGAAATGGCAGCATCGATCTTCTTCACGGTTGCAGGGAGACCCAGGGTGTGAATGCTTTTAGGATAACCTGC4 (0.000253%)
AGACACTTGTTTGTGGCCCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGA3 (0.000190%)
AGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGT11 (0.000697%)
AGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAG4 (0.000253%)
AGAGAATGCGCAGGCTGAAGCGCAAGAGAAGAAAGATGAGGCAGAGGTCCAAGTAAGCCAGCCCGTGCACCTACGACGCCTGCAGGAGCAGAAGTGAGGG4 (0.000253%)
AGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGG11 (0.000697%)
AGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTGATGAGTTTCACCTCCT6 (0.000380%)
AGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACT13 (0.000823%)
AGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATA2317 (0.146767%)
AGAGCATCAACAACGCTGAGAAGAGAGGCAAACGCCAGGTCCTCATCAGGCCATGTTCTAAAGTCATCGTTCGGTTCTTAACCGTGATGATGAAGCACGG4 (0.000253%)
AGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAGTT23 (0.001457%)
AGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCAC3 (0.000190%)
AGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTC4 (0.000253%)
AGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAG17 (0.001077%)
AGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACA7 (0.000443%)
AGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCGCAGTTGGAATT7 (0.000443%)
AGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAAT10 (0.000633%)
AGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCT8 (0.000507%)
AGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTT6 (0.000380%)
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGCA1055 (0.026731%)
AGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTCACTT4 (0.000253%)
AGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGA31 (0.001964%)
AGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGG3 (0.000190%)
AGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAG5 (0.000317%)
AGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGG18 (0.001140%)
AGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGT6 (0.000380%)
AGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAAC11 (0.000697%)
AGCACATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGA67 (0.004244%)
AGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCAGGAAGT4 (0.000253%)
AGCAGGTTATCCTAAAAGCATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTC3 (0.000190%)
AGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATT3 (0.000190%)
AGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCT25 (0.001584%)
AGCATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAAT7 (0.000443%)
AGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAG3 (0.000190%)
AGCCACTCACCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACA241 (0.022593%)
AGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCT4 (0.000253%)
AGCCCACATAGCATGCAAGTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTGGTAAGAAGCTGGAAGATGGCCCCAAGTTCCTGAAGTCTGGCGAT4 (0.000253%)
AGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGG4 (0.000253%)
AGCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGCGGGGCC3 (0.000190%)
AGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCC4 (0.000253%)
AGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAG9 (0.000570%)
AGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAA33 (0.002090%)
AGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACC9 (0.000570%)
AGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACC18 (0.001140%)
AGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGC4 (0.000253%)
AGCTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCATCT4 (0.000253%)
AGCTATCTTCCTGGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTA3 (0.000190%)
AGCTATTGCTCTTCAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAA5 (0.000317%)
AGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGG10 (0.000633%)
AGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACT4 (0.000253%)
AGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTAT19 (0.001204%)
AGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAAC5 (0.000317%)
AGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTC6 (0.000380%)
AGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCGCAGTTGG9 (0.000570%)
AGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCT3 (0.000190%)
AGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGATTTAGTC3 (0.000190%)
AGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGC20 (0.001267%)
AGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAGTTTT7 (0.000443%)
AGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGA67 (0.004244%)
AGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTC4 (0.000253%)
AGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGA15 (0.000950%)
AGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCT3 (0.000190%)
AGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAGCAGGAGCAGCAGCTCTTCTTGCA5 (0.000317%)
AGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCA3 (0.000190%)
AGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCACACGCGCGGGACGCCCGCCCGCCCCCGC3 (0.000190%)
AGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCACACGCGCGGGA3 (0.000190%)
AGGCGCTCAAAGAGATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCA5 (0.000317%)
AGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCG7 (0.000443%)
AGGCTTCAGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACGGCTCTGGTAGTCCTCAGAGCCCAC4 (0.000253%)
AGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCG34 (0.002154%)
AGGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAG19 (0.001204%)
AGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTT19 (0.001204%)
AGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGATG7 (0.000443%)
AGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCC9 (0.000570%)
AGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAG3 (0.000190%)
AGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACGGCTCTGGTAGTCCTCAGAGCCCACGAGGACC3 (0.000190%)
AGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACAC3 (0.000190%)
AGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGT11 (0.000697%)
AGTAAACAGGGTGGAACTGTATAGGAAGACGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCAC32 (0.002027%)
AGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGC4 (0.000253%)
AGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCG3 (0.000190%)
AGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGG9 (0.000570%)
AGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCG11 (0.000697%)
AGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGC3 (0.000190%)
AGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCA3 (0.000190%)
AGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCAT58 (0.003674%)
AGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATG4 (0.000253%)
AGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATC3 (0.000190%)
AGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACA7 (0.000443%)
AGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTT5 (0.000317%)
AGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTG5 (0.000317%)
AGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGC6 (0.000380%)
AGTGGAACCATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTG12 (0.000760%)
AGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCC3 (0.000190%)
AGTTCAGACACTTGTTTGTGGCCCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGAC3 (0.000190%)
AGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGC4 (0.000253%)
AGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATAT3 (0.000190%)
AGTTCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTGAACACTCTAATTTTTTC4 (0.000253%)
AGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAA8 (0.000507%)
AGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCT36 (0.002280%)
AGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTTGCCTCTCGGCG14 (0.000887%)
AGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTT12 (0.000760%)
AGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAACTGGACCCATCTTTGGCTGTC24 (0.001520%)
ATAAAACCAGTACAGCTCTTCATACTTGGTTGAGGTACACAAAGCATAAAAATCCTATTGAAAAAGCATCGGCTGAGGACAGGACCAAGGAGAGCTGGCC5 (0.000317%)
ATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGC12 (0.000760%)
ATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGC4 (0.000253%)
ATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAG5 (0.000317%)
ATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGA7 (0.000443%)
ATACTCCCCCCGGAACCCAAAGACTTTGGTTTCCCGGAAGCTGCCCGGCGGGTCATGGGAATAACGCCGCCGCATCGCCAGTCGGCATCGTTTATGGTCG7 (0.000443%)
ATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAA4 (0.000253%)
ATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGAGTCGT6 (0.000380%)
ATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAG7 (0.000443%)
ATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAG4 (0.000253%)
ATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTA13 (0.000823%)
ATAGCATGCAAGTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTGGTAAGAAGCTGGAAGATGGCCCCAAGTTCCTGAAGTCTGGCGATGCTGCCA9 (0.000570%)
ATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACT5 (0.000317%)
ATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGAGTC5 (0.000317%)
ATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGG4 (0.000253%)
ATATGTATATGTATATGTATATGTATATGTATATGTATAT671 (0.017001%)
ATCAAAACCAACCCGGTGAGCTCCCTCCCGGCTCCGGCCGGGGGTCGGGCGCCGGCGGCTTTGGTGACTCTAGATAACCTCGGGCCGATCGCACGCCCCC432 (0.027364%)
ATCAAAAGTAATGTTCCCACTGTGTTTAATGTTCTTCTGCTTCTTCCTGTCTCTCGGTGGCTCCTTGAGGGCTTTGATGATCAGGGCTGAGGCAGAAGGC5 (0.000317%)
ATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCA13 (0.000823%)
ATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCC12 (0.000760%)
ATCACACCACATCATGTGTTTAAGCACGAGTAGAGTACAAGAGTTTCTTCTGGCTGCTCAATGCTGCCTGGCAGAAAAATGGTCCAGTGCTCACTTCTGC3 (0.000190%)
ATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGAT16 (0.001013%)
ATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAG12 (0.000760%)
ATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAGCAGGAGCAGCAGCTCTTCTT4 (0.000253%)
ATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACT6 (0.000380%)
ATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATC50 (0.003167%)
ATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACA22 (0.001394%)
ATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGG7 (0.000443%)
ATCATGGCCTCAGTTCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTGAACACT5 (0.000317%)
ATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGACCGTTCTTCCACCACTGATTAAGACTGGGGTGGCAGGTG5 (0.000317%)
ATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCC24 (0.001520%)
ATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGG4 (0.000253%)
ATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTC3 (0.000190%)
ATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGA4 (0.000253%)
ATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCAACCAA3 (0.000190%)
ATCCCGCCCAGGCGGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTC3 (0.000190%)
ATCCGGTAAAGCGAATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCC265 (0.016786%)
ATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCA4 (0.000253%)
ATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAG558 (0.035346%)
ATCGAAAGGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGG10 (0.000633%)
ATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAG25 (0.001584%)
ATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAA6 (0.000380%)
ATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGCATA12 (0.000304%)
ATCGTCCCTGTGCGGAGAGGCTACTGGGGGAACAAGATTGGCAAGCCCCACACTGTTCCATGCAAGGTGACAGGCCGCTGTGGCTCTGTGCTGGTGCGTC87 (0.005511%)
ATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAG6 (0.000380%)
ATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAG8 (0.000507%)
ATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGGGTGGCGGGGCC3 (0.000190%)
ATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGT6 (0.000380%)
ATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTT31 (0.001964%)
ATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGA6 (0.000380%)
ATCTGTGTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTC5 (0.000317%)
ATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGT10 (0.000633%)
ATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACGAGAAGTA8 (0.000507%)
ATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGG20 (0.001267%)
ATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGAGTCGTTCTGCCAAT7 (0.000443%)
ATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCA10 (0.000633%)
ATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGC11 (0.000697%)
ATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTT16 (0.001500%)
ATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAAC20 (0.001267%)
ATGAGCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAACTTGAAGGCTAACAAAATCTGTGTTCAAAAGCTGGCTAGGA15 (0.000950%)
ATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTG6 (0.000380%)
ATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTA282 (0.017863%)
ATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGA10 (0.000633%)
ATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCG5 (0.000317%)
ATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAA5 (0.000317%)
ATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAA7 (0.000443%)
ATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGA6 (0.000380%)
ATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACG14 (0.000887%)
ATGCTTTATAGAAAAAGTTGTGGAGAACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCC4 (0.000253%)
ATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAACTGG4 (0.000253%)
ATGGAGAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGG3 (0.000190%)
ATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATA4 (0.000253%)
ATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCA6 (0.000380%)
ATGGCCTCAGTTCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTGAACACTCTA4 (0.000253%)
ATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGATTTAGTCGGCCTG8 (0.000507%)
ATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGG3 (0.000190%)
ATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATAC3 (0.000190%)
ATGGTACAAATTAAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGT4 (0.000253%)
ATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGA9 (0.000570%)
ATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCG5 (0.000317%)
ATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTG8 (0.000507%)
ATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGT4 (0.000253%)
ATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACG9 (0.000570%)
ATTAAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCT15 (0.000950%)
ATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTTGCCTCT32 (0.002027%)
ATTAAATGTGTGTATCCCATGAGCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAACTTGAAGGCTAACAAAATCTGTG6 (0.000380%)
ATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGT9 (0.000570%)
ATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCT18 (0.001140%)
ATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGTGCCGTTC11 (0.000697%)
ATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACT10 (0.000633%)
ATTCAGCACATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGG37 (0.002344%)
ATTCCCAAGCAACCCGACTCCGGGAAGACCCGAGCCCGGCGCGCCGGGGGCCGCTACCGGCCTCACACCGTCCACGGGCTGGGCCTCGATCAGAAGGACT4 (0.000253%)
ATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAG11 (0.000697%)
ATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGT8 (0.000507%)
ATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAG46 (0.002914%)
ATTCTTTCCTTCTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGACCGT18 (0.001140%)
ATTGCTCTTCAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACA3 (0.000190%)
ATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCC29 (0.001837%)
ATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAA39 (0.002470%)
ATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGACCGTTCTTCCACCACTGATTAAGACTGGGGTGG3 (0.000190%)
ATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACA65 (0.004117%)
ATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGC27 (0.001710%)
ATTTATTCAGCACATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAA60 (0.003801%)
ATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCG18 (0.001140%)
ATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGA4 (0.000253%)
ATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGAT6 (0.000380%)
ATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTA6 (0.000380%)
ATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTT140 (0.008868%)
ATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAACTGGACCCATCT22 (0.001394%)
ATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCAACCAACACC14 (0.000887%)
ATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCA36 (0.002280%)
CAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGC36 (0.002280%)
CAAAAAGGGCCGCGGCCATGTGCAGCCCATTCGCTGCACGAACTGCGCCCGGTGCGTGCCCAAGGATAAGGCCATCAAGAAGTTTGTCATTCGGAACATT9 (0.000570%)
CAAAACCAACCCGGTGAGCTCCCTCCCGGCTCCGGCCGGGGGTCGGGCGCCGGCGGCTTTGGTGACTCTAGATAACCTCGGGCCGATCGCACGCCCCCCG10 (0.000633%)
CAAAAGTAATGTTCCCACTGTGTTTAATGTTCTTCTGCTTCTTCCTGTCTCTCGGTGGCTCCTTGAGGGCTTTGATGATCAGGGCTGAGGCAGAAGGCAC4 (0.000253%)
CAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCG12 (0.000760%)
CAAAATTCTTTATTTGAAGAAATGGTACAAATTAAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCAC44 (0.002787%)
CAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGTGCCGTTCCGA5 (0.000317%)
CAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGG9 (0.000570%)
CAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGC17 (0.001077%)
CAAAGAGATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTT15 (0.000950%)
CAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACA79 (0.005004%)
CAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCT3 (0.000190%)
CAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTC7 (0.000443%)
CAAAGGCCCCTACTGGTTTAATAGCTGCTGAGATGGATTGTCTTGTCCTGCCGCCCTTTGCTGTGTGGGCAGTACTCTGAAGCAGGCAAATGGGTCTTAG5 (0.000317%)
CAAAGGTGATGCACACCTCTGTGATGCTCCCGGGCTGGAAGGGGAAGGCAGGTTCCCGGTGTTCGGTTCCCCAGGTCCCATCTTCCTTGGTGTTACACAC3 (0.000190%)
CAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGC27 (0.001710%)
CAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAG31 (0.001964%)
CAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATA11 (0.000697%)
CAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGTGC40 (0.002534%)
CAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGGGCTGTGCGAAGTGCTCCCAGGGCTGCATCTGCAAAGAG5 (0.000317%)
CAAATTAAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTG35 (0.002217%)
CAACAACGCTGAGAAGAGAGGCAAACGCCAGGTCCTCATCAGGCCATGTTCTAAAGTCATCGTTCGGTTCTTAACCGTGATGATGAAGCACGGATACATT5 (0.000317%)
CAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAG3 (0.000190%)
CAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCG29 (0.001837%)
CAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCG6 (0.000380%)
CAACATTCTTTCCTTCTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGA60 (0.003801%)
CAACCATACTCCCCCCGGAACCCAAAGACTTTGGTTTCCCGGAAGCTGCCCGGCGGGTCATGGGAATAACGCCGCCGCATCGCCAGTCGGCATCGTTTAT6 (0.000380%)
CAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAA28 (0.001774%)
CAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACA8 (0.000507%)
CAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCAC3 (0.000190%)
CAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGAGAGCTAAGCTGACTTCCCC5 (0.000317%)
CAAGAAGGTCGGCATCGTCGGCAAGTACGGGACCCGCTATGGTGCCTCCCTCCGGAAAATGGTGAAGAAAATTGAAATCAGCCAGCACGCCAAGTACACT11 (0.000697%)
CAAGATTCGGCGTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTGCTCTACAAGAGGTGCTGAAG3 (0.000190%)
CAAGATTGGCAAGCCCCACACTGTTCCATGCAAGGTGACAGGCCGCTGTGGCTCTGTGCTGGTGCGTCTCATCCCTGCCCCCAGAGGCACTGGCATTGTC3 (0.000190%)
CAAGCAGTCATATATTAAATGTGTGTATCCCATGAGCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAACTTGAAGGCT3 (0.000190%)
CAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTG29 (0.001837%)
CAAGTATTTATTCAGCACATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGG33 (0.002090%)
CAAGTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTGGTAAGAAGCTGGAAGATGGCCCCAAGTTCCTGAAGTCTGGCGATGCTGCCATTGTTGAT6 (0.000380%)
CAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGC6 (0.000380%)
CAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACC4 (0.000253%)
CAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACT4 (0.000253%)
CAATCCTTATCCCGAAGTTACGGATCCGGCTTGCCGACTTCCCTTACCTACATTGTTCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGAT3 (0.000190%)
CAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTG10 (0.000633%)
CAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTC7 (0.000443%)
CAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGATTTAGTCGGCC3 (0.000190%)
CACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAG166 (0.015562%)
CACAACATTCTTTCCTTCTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGA24 (0.001520%)
CACAAGTATTTATTCAGCACATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTG374 (0.023691%)
CACACACAAAAAAAATGGTCCACAACATTCTTTCCTTCTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCA23 (0.001457%)
CACACAGCCCACATAGCATGCAAGTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTGGTAAGAAGCTGGAAGATGGCCCCAAGTTCCTGAAGTCTG5 (0.000317%)
CACACTGTTCCATGCAAGGTGACAGGCCGCTGTGGCTCTGTGCTGGTGCGTCTCATCCCTGCCCCCAGAGGCACTGGCATTGTCTCTGCTCCTGTGCCCA3 (0.000190%)
CACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCA43 (0.002724%)
CACAGCCCACATAGCATGCAAGTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTGGTAAGAAGCTGGAAGATGGCCCCAAGTTCCTGAAGTCTGGC9 (0.000570%)
CACAGTTCAGACACTTGTTTGTGGCCCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTT41 (0.002597%)
CACATAGCATGCAAGTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTGGTAAGAAGCTGGAAGATGGCCCCAAGTTCCTGAAGTCTGGCGATGCTG3 (0.000190%)
CACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGG11 (0.000697%)
CACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAA10 (0.000633%)
CACATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGA14 (0.000887%)
CACCAACATGCAAGTTCTTTTCCCTCTCTGCTAGCCAGACCATCAGATGGGTGGGAGAGGCAGGGGAGGCCTTCCTGCTCAGTAGTTCTGATTCTTTGAT4 (0.000253%)
CACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACC38 (0.002407%)
CACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATG17 (0.001077%)
CACCAGTTCTAAGTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGA10 (0.000633%)
CACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTCGGGGCGAACC14 (0.000887%)
CACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATC7 (0.000443%)
CACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATC7 (0.000443%)
CACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGC3 (0.000190%)
CACGGAATCCATGTCTGAATCTGCGGTAGACAATCTTTAGGTGCCTCATCCGACCAGTCCCGGTAGTGTTTCGTCTCTTAGCCTTGGCACTCCAGTTATA3 (0.000190%)
CACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTG33 (0.002090%)
CACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGAGAGCTAAGCTG52 (0.003294%)
CACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCT13 (0.000823%)
CACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGT190 (0.017812%)
CACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACG7 (0.000443%)
CACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAA34 (0.002154%)
CACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGG76 (0.004814%)
CACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAGGC9 (0.000570%)
CACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTA15 (0.000950%)
CACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTC7 (0.000443%)
CACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGC7 (0.000443%)
CACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATC18 (0.001140%)
CACTTGTTTGTGGCCCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTG3 (0.000190%)
CACTTTCTTCTCCTCAGCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATTG12 (0.000760%)
CAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACT24 (0.001520%)
CAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACC16 (0.001013%)
CAGAATCCCGCCCAGGCGGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCG13 (0.000823%)
CAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGT30 (0.001900%)
CAGACACTTGTTTGTGGCCCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTG18 (0.001140%)
CAGACAGCAGGAGAAGATAATTCCCAAGACCTCCACAAAAGCAATGCCCAGGGCCGCTGCAGCCACCAGCAGTATGTTCTTCCTTAGCCATATTGCTATA5 (0.000317%)
CAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGG11 (0.000697%)
CAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGA3 (0.000190%)
CAGACTTGGTGACTTTGCCAGCTCCAGCAGCCTTCTTGTCCACAGCTTTGATGACACCCACAGCAACTGTCTGCCTCATGTCACGAACAGCAAAGCGACC9 (0.000570%)
CAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTGATGAGTTTCACCTCC7 (0.000443%)
CAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCAC44 (0.002787%)
CAGAGAGTCTGGTGGCTTGGACAGCCAAGTTCCTCTCCACAAAGATCTGCCTCTATCCAACCCAGTCTGGAGAACTTCCAAAGGAGCCTGAGCCATTAAG41 (0.002597%)
CAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAGT10 (0.000633%)
CAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCA5 (0.000317%)
CAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGT4 (0.000253%)
CAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGC2828 (0.071654%)
CAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTCACT6 (0.000380%)
CAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGC15 (0.000950%)
CAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACG7 (0.000443%)
CAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAG45 (0.002850%)
CAGCAAGCAGTCATATATTAAATGTGTGTATCCCATGAGCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAACTTGAAG3 (0.000190%)
CAGCACATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAG51 (0.003231%)
CAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCAT14 (0.000887%)
CAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCA12 (0.000760%)
CAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAA23 (0.001457%)
CAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGAC34 (0.002154%)
CAGCGCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATAT10 (0.000633%)
CAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCGCGGCGGCGCGGGGTCTCC14 (0.000887%)
CAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAGCAGG38 (0.002407%)
CAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAAC4 (0.000253%)
CAGCTATCTTCCTGGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTT20 (0.001267%)
CAGCTATTGCTCTTCAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAA6 (0.000380%)
CAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGT6 (0.000380%)
CAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCG136 (0.008615%)
CAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAA9 (0.000570%)
CAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCGCAGTTG47 (0.002977%)
CAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTC41 (0.002597%)
CAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGG22 (0.001394%)
CAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCT35 (0.002217%)
CAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGG16 (0.001013%)
CAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATC20 (0.001267%)
CAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAGCAGGAGCAGCAGCTCTTCTTGC4 (0.000253%)
CAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGC6 (0.000380%)
CAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCA5 (0.000317%)
CAGGCGGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCGC4 (0.000253%)
CAGGCTTCAGTTTTTCCTGGGGGAAGGCTTCAGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACG128 (0.008108%)
CAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCAACCAACACCTTTTC3 (0.000190%)
CAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAA113 (0.007158%)
CAGGTTATCCTAAAAGCATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTT3 (0.000190%)
CAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGG4 (0.000253%)
CAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACG16 (0.001013%)
CAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGC3 (0.000190%)
CAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGG3 (0.000190%)
CAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCA16 (0.001013%)
CAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCAT40 (0.002534%)
CAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCT8 (0.000507%)
CAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCG16 (0.001013%)
CAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCT4 (0.000253%)
CAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATG3 (0.000190%)
CAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATA5 (0.000317%)
CAGTTCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTGAACACTCTAATTTTTT8 (0.000507%)
CAGTTCTAAGTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGT8 (0.000507%)
CAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATA8 (0.000507%)
CAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGT4 (0.000253%)
CAGTTTTTCCTGGGGGAAGGCTTCAGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACGGCTCTGG3 (0.000190%)
CATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCA5 (0.000317%)
CATACTCCCCCCGGAACCCAAAGACTTTGGTTTCCCGGAAGCTGCCCGGCGGGTCATGGGAATAACGCCGCCGCATCGCCAGTCGGCATCGTTTATGGTC3 (0.000190%)
CATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGA4 (0.000253%)
CATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTT4 (0.000253%)
CATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTATTAGAAATGGCAGCATCGATCTTCTTCACGGTTGCAGGGAGACC213 (0.013492%)
CATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCC9 (0.000570%)
CATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGA4 (0.000253%)
CATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAA3 (0.000190%)
CATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTG6 (0.000380%)
CATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTA3 (0.000190%)
CATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGG20 (0.001267%)
CATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAA6 (0.000380%)
CATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGG10 (0.000633%)
CATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAA7 (0.000443%)
CATGAGCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAACTTGAAGGCTAACAAAATCTGTGTTCAAAAGCTGGCTAGG5 (0.000317%)
CATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACT21 (0.001330%)
CATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGA5 (0.000317%)
CATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATG5 (0.000317%)
CATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACC6 (0.000380%)
CATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGA6 (0.000380%)
CATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGAC9 (0.000570%)
CATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGG6 (0.000380%)
CATGCTTTATAGAAAAAGTTGTGGAGAACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCC368 (0.023310%)
CATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAACTG7 (0.000443%)
CATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGAT4 (0.000253%)
CATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTC18 (0.001140%)
CATGGCCTCAGTTCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTGAACACTCT7 (0.000443%)
CATGGCTAAACGCACCAAGAAGGTCGGCATCGTCGGCAAGTACGGGACCCGCTATGGTGCCTCCCTCCGGAAAATGGTGAAGAAAATTGAAATCAGCCAG6 (0.000380%)
CATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCAC4 (0.000253%)
CATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCC22 (0.001394%)
CATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGACCGTTCTTCCACCACTGATTAAGACTGGGGTGGCAGGTGTT5 (0.000317%)
CATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATAC7 (0.000443%)
CATTCCCAAGCAACCCGACTCCGGGAAGACCCGAGCCCGGCGCGCCGGGGGCCGCTACCGGCCTCACACCGTCCACGGGCTGGGCCTCGATCAGAAGGAC21 (0.001330%)
CATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCA22 (0.001394%)
CATTCTTTCCTTCTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGACCG3 (0.000190%)
CATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCC34 (0.002154%)
CATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAA13 (0.000823%)
CATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGACCGTTCTTCCACCACTGATTAAGACTGGGGTG5 (0.000317%)
CATTGTTCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAG7 (0.000443%)
CATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGG4 (0.000253%)
CATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGA8 (0.000507%)
CATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCAACCAACAC13 (0.000823%)
CCAAAATTCTTTATTTGAAGAAATGGTACAAATTAAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCA21 (0.001330%)
CCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGAC15 (0.000950%)
CCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATAT3 (0.000190%)
CCAACATGCAAGTTCTTTTCCCTCTCTGCTAGCCAGACCATCAGATGGGTGGGAGAGGCAGGGGAGGCCTTCCTGCTCAGTAGTTCTGATTCTTTGATGT6 (0.000380%)
CCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGC6 (0.000380%)
CCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGAGAGCTAAGCTGACTTCCC8 (0.000507%)
CCAATCCTTATCCCGAAGTTACGGATCCGGCTTGCCGACTTCCCTTACCTACATTGTTCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGA3 (0.000190%)
CCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGT8 (0.000507%)
CCACAACATTCTTTCCTTCTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTG80 (0.005067%)
CCACAACCAAATGACTGTTTCTTCGCGCTAATATTTGGCTCCTCGGCGCTGCCTGAAGTAGCGGTTGTAGGCAGCGTTGTAGCCGTAGACCATGGCGTAG4 (0.000253%)
CCACACACAAAAAAAATGGTCCACAACATTCTTTCCTTCTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCC110 (0.006968%)
CCACACTGTTCCATGCAAGGTGACAGGCCGCTGTGGCTCTGTGCTGGTGCGTCTCATCCCTGCCCCCAGAGGCACTGGCATTGTCTCTGCTCCTGTGCCC4 (0.000253%)
CCACATAGCATGCAAGTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTGGTAAGAAGCTGGAAGATGGCCCCAAGTTCCTGAAGTCTGGCGATGCT3 (0.000190%)
CCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTG10 (0.000633%)
CCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGAC3 (0.000190%)
CCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGAT5 (0.000317%)
CCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGAT7 (0.000443%)
CCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACAT16 (0.001013%)
CCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAG29 (0.001837%)
CCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGT4 (0.000253%)
CCACTGTGTTTAATGTTCTTCTGCTTCTTCCTGTCTCTCGGTGGCTCCTTGAGGGCTTTGATGATCAGGGCTGAGGCAGAAGGCACCACCTCGATCTGGG8 (0.000507%)
CCACTTTCTTCTCCTCAGCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATT25 (0.001584%)
CCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGAC22 (0.001394%)
CCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTGATGAGTTTCACCTC6 (0.000380%)
CCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCA3 (0.000190%)
CCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTC9 (0.000570%)
CCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTT6 (0.000380%)
CCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTG4 (0.000253%)
CCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCA40 (0.002534%)
CCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAA9 (0.000570%)
CCAGCGCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATA4 (0.000253%)
CCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAA8 (0.000507%)
CCAGCTATTGCTCTTCAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCA12 (0.000760%)
CCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCG10 (0.000633%)
CCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCA68 (0.006375%)
CCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTG9 (0.000570%)
CCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGC36 (0.002280%)
CCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGAT37 (0.002344%)
CCAGGCGGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCG3 (0.000190%)
CCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTG22 (0.001394%)
CCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGG8 (0.000507%)
CCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCA908 (0.057516%)
CCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAACTGGACCCATCTTTGGCTGTCAACTCCC4 (0.000253%)
CCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCAT12 (0.000760%)
CCAGTTCTAAGTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGG38 (0.002407%)
CCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGG43 (0.002724%)
CCATACTCCCCCCGGAACCCAAAGACTTTGGTTTCCCGGAAGCTGCCCGGCGGGTCATGGGAATAACGCCGCCGCATCGCCAGTCGGCATCGTTTATGGT17 (0.001077%)
CCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTT5 (0.000317%)
CCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGC11 (0.000697%)
CCATGAGCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAACTTGAAGGCTAACAAAATCTGTGTTCAAAAGCTGGCTAG9 (0.000570%)
CCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAAT21 (0.001330%)
CCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACG6 (0.000380%)
CCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTT5 (0.000317%)
CCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCAACCAACA11 (0.000697%)
CCCACACTGTTCCATGCAAGGTGACAGGCCGCTGTGGCTCTGTGCTGGTGCGTCTCATCCCTGCCCCCAGAGGCACTGGCATTGTCTCTGCTCCTGTGCC3 (0.000190%)
CCCACATAGCATGCAAGTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTGGTAAGAAGCTGGAAGATGGCCCCAAGTTCCTGAAGTCTGGCGATGC8 (0.000507%)
CCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCA68 (0.004307%)
CCCACTGTGTTTAATGTTCTTCTGCTTCTTCCTGTCTCTCGGTGGCTCCTTGAGGGCTTTGATGATCAGGGCTGAGGCAGAAGGCACCACCTCGATCTGG4 (0.000253%)
CCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTGATGAGTTTCACCT3 (0.000190%)
CCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTT12 (0.000760%)
CCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCGCAGT11 (0.000697%)
CCCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAG51 (0.003231%)
CCCAGGCGGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCC3 (0.000190%)
CCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTG41 (0.002597%)
CCCATGAGCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAACTTGAAGGCTAACAAAATCTGTGTTCAAAAGCTGGCTA8 (0.000507%)
CCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCC27 (0.001710%)
CCCCCCGGAACCCAAAGACTTTGGTTTCCCGGAAGCTGCCCGGCGGGTCATGGGAATAACGCCGCCGCATCGCCAGTCGGCATCGTTTATGGTCGGAACT7 (0.000443%)
CCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCT12 (0.000760%)
CCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTCGGGGCGAACCCATTCCAG6 (0.000380%)
CCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTT19 (0.001204%)
CCCCGGAACCCAAAGACTTTGGTTTCCCGGAAGCTGCCCGGCGGGTCATGGGAATAACGCCGCCGCATCGCCAGTCGGCATCGTTTATGGTCGGAACTAC3 (0.000190%)
CCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTT4 (0.000253%)
CCCGAAGTTACGGATCCGGCTTGCCGACTTCCCTTACCTACATTGTTCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGG22 (0.001394%)
CCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCTCTT37 (0.002344%)
CCCGACGCTCCAGCGCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTG10 (0.000633%)
CCCGACTCCGGGAAGACCCGAGCCCGGCGCGCCGGGGGCCGCTACCGGCCTCACACCGTCCACGGGCTGGGCCTCGATCAGAAGGACTTGGGCCCCCCAC3 (0.000190%)
CCCGCCCAGGCGGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGT19 (0.001204%)
CCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCG16 (0.001013%)
CCCGGAACCCAAAGACTTTGGTTTCCCGGAAGCTGCCCGGCGGGTCATGGGAATAACGCCGCCGCATCGCCAGTCGGCATCGTTTATGGTCGGAACTACG8 (0.000507%)
CCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGC17 (0.001077%)
CCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTCGGGGCGAACCCATTCCAGGG14 (0.000887%)
CCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCC31 (0.001964%)
CCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTT18 (0.001140%)
CCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTG29 (0.001837%)
CCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCC12 (0.000760%)
CCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGCGGGGCCTCGCTCCACCCC8 (0.000507%)
CCCTACTGGTTTAATAGCTGCTGAGATGGATTGTCTTGTCCTGCCGCCCTTTGCTGTGTGGGCAGTACTCTGAAGCAGGCAAATGGGTCTTAGGATCCCT3 (0.000190%)
CCCTCACGGAATCCATGTCTGAATCTGCGGTAGACAATCTTTAGGTGCCTCATCCGACCAGTCCCGGTAGTGTTTCGTCTCTTAGCCTTGGCACTCCAGT3 (0.000190%)
CCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTCGGGGCGAACCCA11 (0.000697%)
CCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGA23 (0.001457%)
CCCTCTTAATCATGGCCTCAGTTCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTT196 (0.012415%)
CCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAG26 (0.001647%)
CCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTGATGAGTTTCACCTCCTTATCCA4 (0.000253%)
CCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTT7 (0.000443%)
CCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTT4 (0.000253%)
CCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGCGGGGCCTCGCTCC3 (0.000190%)
CCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTGAACACTCTAATTTTTTCAAAG36 (0.002280%)
CCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTT4 (0.000253%)
CCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCGCGGCGGCGCGGGGTCTCCCCCCG7 (0.000443%)
CCGAAGTTACGGATCCGGCTTGCCGACTTCCCTTACCTACATTGTTCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGC18 (0.001140%)
CCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCTCTTT13 (0.000823%)
CCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAAT136 (0.008615%)
CCGACGCTCCAGCGCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGC7 (0.000443%)
CCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGC40 (0.002534%)
CCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAG47 (0.002977%)
CCGAGGAAGCTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCT5 (0.000317%)
CCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTT30 (0.001900%)
CCGATCGAAAGGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGC333 (0.021093%)
CCGATCTCTCGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAA188 (0.011909%)
CCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGGGCTGTGC12 (0.000760%)
CCGCACCAGTTCTAAGTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGC33 (0.002090%)
CCGCACTGGACGCCTCGCGGCGCCCATCTCCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCGATCGGCCGAGGGCAACGGAGGCCATCGCC7 (0.000443%)
CCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATAC19 (0.001204%)
CCGCCCAGGCGGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTC9 (0.000570%)
CCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCA4 (0.000253%)
CCGCCGCCATGTCTCTAGTGATCCCTGAGAAGTTCCAGCACATTTTGCGAGTACTCAACACCAACATCGATGGGCGGCGGAAAATAGCCTTCGCCATCAC3 (0.000190%)
CCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAA62 (0.003927%)
CCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGC12 (0.000760%)
CCGCGGGTGCGCGTCTCTCGGGGTCGGGGGTGCGTGGCGGGGGCCCGTCCCCCGCCTCCCCTCCGCGCGCCGGGTTTCGCCCCCGCGGCGTCGGGCCCCG6 (0.000380%)
CCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGA360 (0.022804%)
CCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCATCTACTCCGCC8 (0.000507%)
CCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCGCCGGCAGTCG9 (0.000570%)
CCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCC28 (0.001774%)
CCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCT23 (0.001457%)
CCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCTCTTTTCTTTG14 (0.000887%)
CCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTCGGGGCGAACCCATTCCAGGGC11 (0.000697%)
CCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCA20 (0.001267%)
CCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCACACGCGCGGGACGCCC6 (0.000380%)
CCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCT31 (0.001964%)
CCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTA54 (0.003421%)
CCGGCTTCTCCGGGATCGGTCGCGTTACCGCACTGGACGCCTCGCGGCGCCCATCTCCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCGAT45 (0.002850%)
CCGGGATCGGTCGCGTTACCGCACTGGACGCCTCGCGGCGCCCATCTCCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCGATCGGCCGAGG55 (0.003484%)
CCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCT236 (0.014949%)
CCGGGCAATGTTGACAATCTCATCAAAAGTAATGTTCCCACTGTGTTTAATGTTCTTCTGCTTCTTCCTGTCTCTCGGTGGCTCCTTGAGGGCTTTGATG5 (0.000317%)
CCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGCGGGGCCTC18 (0.001140%)
CCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAG13 (0.000823%)
CCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGC32 (0.002027%)
CCGGGTATGGGCCCGACGCTCCAGCGCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGG9 (0.000570%)
CCGGTAAAGCGAATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGG3 (0.000190%)
CCGGTGAGCTCCCTCCCGGCTCCGGCCGGGGGTCGGGCGCCGGCGGCTTTGGTGACTCTAGATAACCTCGGGCCGATCGCACGCCCCCCGTGGCGGCGAC6 (0.000380%)
CCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCC22 (0.001394%)
CCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATC4 (0.000253%)
CCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTGCTCTACAAGAGGTGCTGAAGACCGCCCTCATCCACG8 (0.000507%)
CCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAAT3 (0.000190%)
CCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGCGGGGCCTCGCTCCACCCCC8 (0.000507%)
CCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCATCGAAAGTTGATAGGGCAG3 (0.000190%)
CCTAAAAGCATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGG5 (0.000317%)
CCTACATTGTTCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTT3 (0.000190%)
CCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGA35 (0.002217%)
CCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTG19 (0.001204%)
CCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGT7 (0.000443%)
CCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTCCTAGTCGT3 (0.000190%)
CCTCAGCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATTGCAGATGAGGCT3 (0.000190%)
CCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCA14 (0.000887%)
CCTCAGTTCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTGAACACTCTAATTT20 (0.001267%)
CCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGGGTGGCGG8 (0.000507%)
CCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATA7 (0.000443%)
CCTCCACTTTCTTCTCCTCAGCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTAC7 (0.000443%)
CCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAG4 (0.000253%)
CCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTC14 (0.000887%)
CCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCT3 (0.000190%)
CCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCAT26 (0.001647%)
CCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTCGGGGCGAACCCAT20 (0.001267%)
CCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAG29 (0.001837%)
CCTCTCTCATATCTACTCCTACAGTGAGAAAGAGACCGAATGAGCTGCAGTAGAAGCACACCGCGGTCAGACTCCGCAGTTCCGAATATACTGGGACAGA3 (0.000190%)
CCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATA25 (0.001584%)
CCTCTTAATCATGGCCTCAGTTCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTT11 (0.000697%)
CCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCAC15 (0.000950%)
CCTCTTGCTCCTTCCTGCTCACCTTCAGGCCTTTGCCAGGCCAGAGTTGGAGGGGCAGTAGAACGTGGTGCCATCCCCAAGCTGGGTGATGGGTCTGGGT21 (0.001330%)
CCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAG5 (0.000317%)
CCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTG50 (0.003167%)
CCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGA8 (0.000507%)
CCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAA24 (0.001520%)
CCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTA6 (0.000380%)
CCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGA5 (0.000317%)
CCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGC40 (0.002534%)
CCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAA7 (0.000443%)
CCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAAC6 (0.000380%)
CCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTG3 (0.000190%)
CCTGGGGGAAGGCTTCAGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACGGCTCTGGTAGTCCTC11 (0.000697%)
CCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTT47 (0.002977%)
CCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTG10 (0.000633%)
CCTTCACCAACATGCAAGTTCTTTTCCCTCTCTGCTAGCCAGACCATCAGATGGGTGGGAGAGGCAGGGGAGGCCTTCCTGCTCAGTAGTTCTGATTCTT12 (0.000760%)
CCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTC8 (0.000507%)
CCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACT221 (0.020718%)
CCTTCCTGCTCACCTTCAGGCCTTTGCCAGGCCAGAGTTGGAGGGGCAGTAGAACGTGGTGCCATCCCCAAGCTGGGTGATGGGTCTGGGTCAGAGCAGG3 (0.000190%)
CCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCA7 (0.000443%)
CCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGA10 (0.000633%)
CCTTCTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGACCGTTCTTCCA8 (0.000507%)
CCTTCTTTGCCTCCACTTTCTTCTCCTCAGCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACC4 (0.000253%)
CCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCG7 (0.000443%)
CCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGA265 (0.016786%)
CCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCATCGA10 (0.000633%)
CCTTGGCCATGGAGAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCA3 (0.000190%)
CCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTC9 (0.000570%)
CCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGAT3 (0.000190%)
CGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTGAACACTCTAATTTTTTCAAAGT11 (0.000697%)
CGAAACTCCACAACCAAATGACTGTTTCTTCGCGCTAATATTTGGCTCCTCGGCGCTGCCTGAAGTAGCGGTTGTAGGCAGCGTTGTAGCCGTAGACCAT124 (0.007855%)
CGAAAGGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCG8 (0.000507%)
CGAAATATTTTAGTGGAACCATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTT5 (0.000317%)
CGAAGTTACGGATCCGGCTTGCCGACTTCCCTTACCTACATTGTTCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCC8 (0.000507%)
CGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGA34 (0.002154%)
CGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCTCTTTT24 (0.001520%)
CGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATC35 (0.002217%)
CGAATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAAT8 (0.000507%)
CGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCA11 (0.000697%)
CGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCAC23 (0.001457%)
CGACGCTCCAGCGCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCT28 (0.001774%)
CGACGGCCGGGTATGGGCCCGACGCTCCAGCGCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTT591 (0.037436%)
CGACTCTGGACGCGAGCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCC28 (0.001774%)
CGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCA170 (0.010768%)
CGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGTGCCGTTCCGAAGGG21 (0.001330%)
CGAGACTCTGGCATGCTAACTAGTTACGCGACCCCCGAGCGGTCGGCGTCCCCCAACTTCTTAGAGGGACAAGTGGCGTTCAGCCACCCGAGATTGAGCA16 (0.001013%)
CGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGC6 (0.000380%)
CGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTCG8 (0.000507%)
CGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGA720 (0.045607%)
CGAGCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGCGGGG13 (0.000823%)
CGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAG29 (0.001837%)
CGAGGAAGCTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTT7 (0.000443%)
CGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGA11 (0.000697%)
CGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGT6 (0.000380%)
CGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCCCGATGCCGACGCTCATCAGACCCCAG171 (0.010832%)
CGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCC3 (0.000190%)
CGATAACGAACGAGACTCTGGCATGCTAACTAGTTACGCGACCCCCGAGCGGTCGGCGTCCCCCAACTTCTTAGAGGGACAAGTGGCGTTCAGCCACCCG259 (0.016406%)
CGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCGCGGCGGCGCG3 (0.000190%)
CGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTG19 (0.001204%)
CGATCGAAAGGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCC5 (0.000317%)
CGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAG16 (0.001013%)
CGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTA36 (0.002280%)
CGATCTCTCGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAAT22 (0.001394%)
CGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCC21 (0.001330%)
CGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGA11 (0.000697%)
CGATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAA5 (0.000317%)
CGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCA5 (0.000317%)
CGCACCAAGAAGGTCGGCATCGTCGGCAAGTACGGGACCCGCTATGGTGCCTCCCTCCGGAAAATGGTGAAGAAAATTGAAATCAGCCAGCACGCCAAGT3 (0.000190%)
CGCACCAGTTCTAAGTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCG23 (0.001457%)
CGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCT7 (0.000443%)
CGCCAAAAAGGGCCGCGGCCATGTGCAGCCCATTCGCTGCACGAACTGCGCCCGGTGCGTGCCCAAGGATAAGGCCATCAAGAAGTTTGTCATTCGGAAC3 (0.000190%)
CGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAG39 (0.002470%)
CGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTG887 (0.056186%)
CGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACT38 (0.002407%)
CGCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCAA7 (0.000443%)
CGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTGATGAGTTTCAC13 (0.000823%)
CGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCGCGGCGGCGCGGGGTCTCCCCC19 (0.001204%)
CGCCGCCATGTCTCTAGTGATCCCTGAGAAGTTCCAGCACATTTTGCGAGTACTCAACACCAACATCGATGGGCGGCGGAAAATAGCCTTCGCCATCACT5 (0.000317%)
CGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTG29 (0.001837%)
CGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCACACGCGCGGGACGC37 (0.002344%)
CGCCGGCTTCTCCGGGATCGGTCGCGTTACCGCACTGGACGCCTCGCGGCGCCCATCTCCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCG315 (0.019953%)
CGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGGGCTGTGCGAAGTGCTCCCAGGGCTGCATCTGC3 (0.000190%)
CGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCT10 (0.000633%)
CGCGAGCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGCGG33 (0.002090%)
CGCGATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCC56 (0.003547%)
CGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTT99 (0.009281%)
CGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCAC43 (0.002724%)
CGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCA19 (0.001204%)
CGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGG27 (0.001710%)
CGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAG10 (0.000633%)
CGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTG56 (0.003547%)
CGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGA21 (0.001330%)
CGCGGGTGCGCGTCTCTCGGGGTCGGGGGTGCGTGGCGGGGGCCCGTCCCCCGCCTCCCCTCCGCGCGCCGGGTTTCGCCCCCGCGGCGTCGGGCCCCGC14 (0.000887%)
CGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAG22 (0.001394%)
CGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGG3 (0.000190%)
CGCGTTACCGCACTGGACGCCTCGCGGCGCCCATCTCCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCGATCGGCCGAGGGCAACGGAGGC28 (0.001774%)
CGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCATCTACTCCGCCC6 (0.000380%)
CGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCGCCGGCAGTCGG3 (0.000190%)
CGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAA5 (0.000317%)
CGCTCAAAGAGATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCT4 (0.000253%)
CGCTCCAGCGCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTC7 (0.000443%)
CGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCA3 (0.000190%)
CGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGGGCTGTGCGAAGTGCTCCCAGGGCTGC3 (0.000190%)
CGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCC14 (0.000887%)
CGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTC47 (0.002977%)
CGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAGCAGGAGC16 (0.001013%)
CGCTTTGGGCTGCATTCCCAAGCAACCCGACTCCGGGAAGACCCGAGCCCGGCGCGCCGGGGGCCGCTACCGGCCTCACACCGTCCACGGGCTGGGCCTC362 (0.022930%)
CGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCT47 (0.002977%)
CGGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCGCGGCG22 (0.001394%)
CGGAACGGGACGGGAGCGGCCGCGGGTGCGCGTCTCTCGGGGTCGGGGGTGCGTGGCGGGGGCCCGTCCCCCGCCTCCCCTCCGCGCGCCGGGTTTCGCC289 (0.018306%)
CGGAAGAAGAGAATGCGCAGGCTGAAGCGCAAGAGAAGAAAGATGAGGCAGAGGTCCAAGTAAGCCAGCCCGTGCACCTACGACGCCTGCAGGAGCAGAA3 (0.000190%)
CGGAAGAGCACACGTCTGAACTCCAGTCACCGTGCATAGA10 (0.000253%)
CGGAAGCTCGGGTGCGTTCAAGATTCGGCGTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTGCT4 (0.000253%)
CGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCGCCGG8 (0.000507%)
CGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGGGT14 (0.000887%)
CGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCTCTTTTCTTTGTGAAGGGCAGGGCGCCCTGGAATGGGTTCGCCCCGAGAGAGGGGCCCGTGCCTTGGA94 (0.008812%)
CGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGC14 (0.000887%)
CGGAGGCGGAAGCTCGGGTGCGTTCAAGATTCGGCGTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAAC25 (0.001584%)
CGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAA26 (0.001647%)
CGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTG52 (0.003294%)
CGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCTCTTTTCTTTGT4 (0.000253%)
CGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTC16 (0.001013%)
CGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTCGGGGCGAACCCATTCCAGGGCG12 (0.000760%)
CGGCAAGTACGGGACCCGCTATGGTGCCTCCCTCCGGAAAATGGTGAAGAAAATTGAAATCAGCCAGCACGCCAAGTACACTTGCTCCTTCTGTGGCAAG5 (0.000317%)
CGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCGCGGCGGCGCGGGGTC11 (0.000697%)
CGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCAACCAACACCTTTTCTGGGGTCTGATGAGC8 (0.000507%)
CGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATTGCAGATGAGGCTCCCAATGTTGACATT15 (0.000950%)
CGGCATCGTCGGCAAGTACGGGACCCGCTATGGTGCCTCCCTCCGGAAAATGGTGAAGAAAATTGAAATCAGCCAGCACGCCAAGTACACTTGCTCCTTC6 (0.000380%)
CGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATA63 (0.003991%)
CGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCA35 (0.002217%)
CGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAG15 (0.000950%)
CGGCCGCGGGTGCGCGTCTCTCGGGGTCGGGGGTGCGTGGCGGGGGCCCGTCCCCCGCCTCCCCTCCGCGCGCCGGGTTTCGCCCCCGCGGCGTCGGGCC3 (0.000190%)
CGGCCGGGTATGGGCCCGACGCTCCAGCGCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCA4 (0.000253%)
CGGCGACATGGCTAAACGCACCAAGAAGGTCGGCATCGTCGGCAAGTACGGGACCCGCTATGGTGCCTCCCTCCGGAAAATGGTGAAGAAAATTGAAATC120 (0.007601%)
CGGCGACTCTGGACGCGAGCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGT39 (0.002470%)
CGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTC43 (0.002724%)
CGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATTGCAGATGAGGCTCCCAATGTTGAC11 (0.000697%)
CGGCGTTGTTCCCTCACGGAATCCATGTCTGAATCTGCGGTAGACAATCTTTAGGTGCCTCATCCGACCAGTCCCGGTAGTGTTTCGTCTCTTAGCCTTG6 (0.000380%)
CGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAA34 (0.002154%)
CGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCACAC21 (0.001330%)
CGGCTTCTCCGGGATCGGTCGCGTTACCGCACTGGACGCCTCGCGGCGCCCATCTCCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCGATC6 (0.000380%)
CGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAA10 (0.000633%)
CGGGACGGGAGCGGCCGCGGGTGCGCGTCTCTCGGGGTCGGGGGTGCGTGGCGGGGGCCCGTCCCCCGCCTCCCCTCCGCGCGCCGGGTTTCGCCCCCGC5 (0.000317%)
CGGGAGCGGCCGCGGGTGCGCGTCTCTCGGGGTCGGGGGTGCGTGGCGGGGGCCCGTCCCCCGCCTCCCCTCCGCGCGCCGGGTTTCGCCCCCGCGGCGT25 (0.001584%)
CGGGATCGGTCGCGTTACCGCACTGGACGCCTCGCGGCGCCCATCTCCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCGATCGGCCGAGGG9 (0.000570%)
CGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGCGGGGCCTCG25 (0.001584%)
CGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGT23 (0.001457%)
CGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATG9 (0.000570%)
CGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCC9 (0.000570%)
CGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAAC10 (0.000633%)
CGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCC45 (0.002850%)
CGGGTATGGGCCCGACGCTCCAGCGCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGC7 (0.000443%)
CGGGTGCGTTCAAGATTCGGCGTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTGCTCTACAAGA3 (0.000190%)
CGGGTGTTGACGCGATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGGTAAACGGCGGGAGTAACTATGACTCTCT230 (0.014569%)
CGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGG14 (0.000887%)
CGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTC14 (0.000887%)
CGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCT11 (0.000697%)
CGGTCCTTCCGAGGAAGCTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCG4 (0.000253%)
CGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGT8 (0.000507%)
CGGTGAGCTCCCTCCCGGCTCCGGCCGGGGGTCGGGCGCCGGCGGCTTTGGTGACTCTAGATAACCTCGGGCCGATCGCACGCCCCCCGTGGCGGCGACG18 (0.001140%)
CGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCG95 (0.006018%)
CGGTTACAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGA64 (0.004054%)
CGGTTTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTC47 (0.002977%)
CGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGCCCCCTCGATGCTCTTAGCTG27 (0.001710%)
CGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTTG6 (0.000380%)
CGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAGCAGGAGCAGCAGCT10 (0.000633%)
CGTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTGCTCTACAAGAGGTGCTGAAGACCGCCCTCA3 (0.000190%)
CGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAA88 (0.005574%)
CGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGC13 (0.000823%)
CGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGC25 (0.001584%)
CGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCAT15 (0.000950%)
CGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGAGAGCTAAGCTGAC9 (0.000570%)
CGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATC4 (0.000253%)
CGTGCTTGAGAGTGAGGCGCTCAAAGAGATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGT640 (0.040540%)
CGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGCGGGGCCTCGCTCCACCCCCC35 (0.002217%)
CGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTG33 (0.002090%)
CGTGTACTGGGTGGGCCTTGGCCTCCTTCAGACAGGCAGAGGGCAGCAATCTGAACCCAGGGTGAGGAACCACAGAACAGAACAGCTGGACAAGCTCCAG4 (0.000253%)
CGTTACCGCACTGGACGCCTCGCGGCGCCCATCTCCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCGATCGGCCGAGGGCAACGGAGGCCA14 (0.000887%)
CGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGA7 (0.000443%)
CGTTGTTCCCTCACGGAATCCATGTCTGAATCTGCGGTAGACAATCTTTAGGTGCCTCATCCGACCAGTCCCGGTAGTGTTTCGTCTCTTAGCCTTGGCA3 (0.000190%)
CGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCATCGAAAGTTGATAGGGCAGA4 (0.000253%)
CTAAAAGCATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGA16 (0.001013%)
CTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAACTTGAAGGCTAACAAAATCTGTGTTCAAAAGCTGGCTAGGACGTTG8 (0.000507%)
CTAAACGCACCAAGAAGGTCGGCATCGTCGGCAAGTACGGGACCCGCTATGGTGCCTCCCTCCGGAAAATGGTGAAGAAAATTGAAATCAGCCAGCACGC3 (0.000190%)
CTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAG18 (0.001140%)
CTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGA13 (0.000823%)
CTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCGCCGGCAGTCGGAA5 (0.000317%)
CTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCATCTAC9 (0.000570%)
CTAAGTCAGAATCCCGCCCAGGCGGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGG8 (0.000507%)
CTAAGTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCC3 (0.000190%)
CTACACAGTTCAGACACTTGTTTGTGGCCCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAA39 (0.002470%)
CTACAGTGAGAAAGAGACCGAATGAGCTGCAGTAGAAGCACACCGCGGTCAGACTCCGCAGTTCCGAATATACTGGGACAGATCTCGGTTTTGACAGTGT5 (0.000317%)
CTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAG4 (0.000253%)
CTACATTGTTCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTC6 (0.000380%)
CTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGAT22 (0.001394%)
CTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAAC9 (0.000570%)
CTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAG9 (0.000570%)
CTACTACACAGCAAGCAGTCATATATTAAATGTGTGTATCCCATGAGCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAA197 (0.012479%)
CTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGG17 (0.001077%)
CTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAG6 (0.000380%)
CTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTT14 (0.000887%)
CTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAG37 (0.002344%)
CTAGCACAGTGGTTGACACTTAGTGGTCTCCCAATAAATATTAGTTTAATGAAATATTTTAAGCCTACCCATCTTTAAACTGAACAAGCAGAACTGAACT38 (0.002407%)
CTAGCAGGTTATCCTAAAAGCATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACT12 (0.000760%)
CTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGATTTAG11 (0.000697%)
CTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCACACGCGCGG9 (0.000570%)
CTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGC37 (0.002344%)
CTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTCCTAGTCGTG4 (0.000253%)
CTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCC10 (0.000633%)
CTATCTTCCTGGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTATT3 (0.000190%)
CTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGAGTCGTTCTGCCA4 (0.000253%)
CTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAG84 (0.005321%)
CTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACT15 (0.000950%)
CTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTG11 (0.000697%)
CTATTGCTCTTCAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGA3 (0.000190%)
CTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCA8 (0.000507%)
CTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCT25 (0.001584%)
CTCAAAGAGATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTC5 (0.000317%)
CTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCA8 (0.000507%)
CTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACAC20 (0.001267%)
CTCACCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGG357 (0.033468%)
CTCACCTTCAGGCCTTTGCCAGGCCAGAGTTGGAGGGGCAGTAGAACGTGGTGCCATCCCCAAGCTGGGTGATGGGTCTGGGTCAGAGCAGGTTTCTGGG7 (0.000443%)
CTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCT28 (0.001774%)
CTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGA11 (0.000697%)
CTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTCA29 (0.001837%)
CTCAGCTATCTTCCTGGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCT300 (0.019003%)
CTCAGCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATTGCAGATGAGGCTC7 (0.000443%)
CTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCATCGAAAGTTGATAGGGCAGACGTTC3 (0.000190%)
CTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAG15 (0.000950%)
CTCAGTTCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTGAACACTCTAATTTT44 (0.002787%)
CTCATATCTACTCCTACAGTGAGAAAGAGACCGAATGAGCTGCAGTAGAAGCACACCGCGGTCAGACTCCGCAGTTCCGAATATACTGGGACAGATCTCG3 (0.000190%)
CTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGGGTGGCGGG40 (0.002534%)
CTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATAC4 (0.000253%)
CTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGA20 (0.001267%)
CTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCT97 (0.006144%)
CTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCC17 (0.001077%)
CTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAG12 (0.000760%)
CTCCACTTTCTTCTCCTCAGCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACA30 (0.001900%)
CTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATC13 (0.000823%)
CTCCCCCCGGAACCCAAAGACTTTGGTTTCCCGGAAGCTGCCCGGCGGGTCATGGGAATAACGCCGCCGCATCGCCAGTCGGCATCGTTTATGGTCGGAA8 (0.000507%)
CTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTCGGGGCGAACCCATTCC21 (0.001330%)
CTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAG47 (0.002977%)
CTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGA3 (0.000190%)
CTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGGGCTGT6 (0.000380%)
CTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAG16 (0.001013%)
CTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAG8 (0.000507%)
CTCCGGGATCGGTCGCGTTACCGCACTGGACGCCTCGCGGCGCCCATCTCCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCGATCGGCCGA26 (0.001647%)
CTCCTACAGTGAGAAAGAGACCGAATGAGCTGCAGTAGAAGCACACCGCGGTCAGACTCCGCAGTTCCGAATATACTGGGACAGATCTCGGTTTTGACAG9 (0.000570%)
CTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGG21 (0.001330%)
CTCCTCAGCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATTGCAGATGAGG11 (0.000697%)
CTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCA72 (0.004561%)
CTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAG3 (0.000190%)
CTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCC134 (0.008488%)
CTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCT94 (0.005954%)
CTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCC28 (0.001774%)
CTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTG9 (0.000570%)
CTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAA184 (0.017250%)
CTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTGATGAGTTTC8 (0.000507%)
CTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGGC4 (0.000253%)
CTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATC33 (0.002090%)
CTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTTCGC18 (0.001140%)
CTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGA292 (0.018496%)
CTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACA10 (0.000633%)
CTCGGGTGCGTTCAAGATTCGGCGTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTGCTCTACAA7 (0.000443%)
CTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTT108 (0.006841%)
CTCGGTCCTTCCGAGGAAGCTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTC238 (0.015076%)
CTCGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAAC23 (0.001457%)
CTCGTGTACTGGGTGGGCCTTGGCCTCCTTCAGACAGGCAGAGGGCAGCAATCTGAACCCAGGGTGAGGAACCACAGAACAGAACAGCTGGACAAGCTCC10 (0.000633%)
CTCTCATATCTACTCCTACAGTGAGAAAGAGACCGAATGAGCTGCAGTAGAAGCACACCGCGGTCAGACTCCGCAGTTCCGAATATACTGGGACAGATCT4 (0.000253%)
CTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTCGGGGCGAACCCATT9 (0.000570%)
CTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGG21 (0.001330%)
CTCTCGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAA27 (0.001710%)
CTCTCTCATATCTACTCCTACAGTGAGAAAGAGACCGAATGAGCTGCAGTAGAAGCACACCGCGGTCAGACTCCGCAGTTCCGAATATACTGGGACAGAT3 (0.000190%)
CTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAAT51 (0.003231%)
CTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCT21 (0.001330%)
CTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTC284 (0.026625%)
CTCTGGACGCGAGCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTC3 (0.000190%)
CTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGGGTGGCGGGGCCAC5 (0.000317%)
CTCTTAATCATGGCCTCAGTTCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTG27 (0.001710%)
CTCTTCAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCAT8 (0.000507%)
CTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAGGCCC12 (0.000760%)
CTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACGAGAAGTAATATCAGTATCG4 (0.000253%)
CTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACT69 (0.004371%)
CTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGC43 (0.002724%)
CTCTTGCTCCTTCCTGCTCACCTTCAGGCCTTTGCCAGGCCAGAGTTGGAGGGGCAGTAGAACGTGGTGCCATCCCCAAGCTGGGTGATGGGTCTGGGTC6 (0.000380%)
CTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGA3 (0.000190%)
CTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAG40 (0.002534%)
CTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAAC11 (0.000697%)
CTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCT8 (0.000507%)
CTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTT23 (0.001457%)
CTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGACCGTTCTTCCACCAC3 (0.000190%)
CTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGA25 (0.001584%)
CTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGC66 (0.004181%)
CTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGAGTCGTTCT13 (0.000823%)
CTGAGAAGAGAGGCAAACGCCAGGTCCTCATCAGGCCATGTTCTAAAGTCATCGTTCGGTTCTTAACCGTGATGATGAAGCACGGATACATTGGTGAATT3 (0.000190%)
CTGAGCTTTCTGGGCAGACTTGGTGACTTTGCCAGCTCCAGCAGCCTTCTTGTCCACAGCTTTGATGACACCCACAGCAACTGTCTGCCTCATGTCACGA244 (0.015456%)
CTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTG18 (0.001140%)
CTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAACTGGACCCATCTTTGGCT50 (0.003167%)
CTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGT23 (0.001457%)
CTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAA17 (0.001077%)
CTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATT36 (0.002280%)
CTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCAGGAAGTACATT5 (0.000317%)
CTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGC11 (0.000697%)
CTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAA26 (0.001647%)
CTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAG39 (0.002470%)
CTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTAC34 (0.002154%)
CTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGCCCCC12 (0.000760%)
CTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCA4 (0.000253%)
CTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCT92 (0.005828%)
CTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTT78 (0.004941%)
CTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTC32 (0.002027%)
CTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCC7 (0.000443%)
CTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCT3 (0.000190%)
CTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAG9 (0.000570%)
CTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTCCTAGT5 (0.000317%)
CTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTA13 (0.000823%)
CTGCCTTGGCCATGGAGAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAG16 (0.001013%)
CTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCT11 (0.000697%)
CTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCG8 (0.000507%)
CTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCACACGCG17 (0.001077%)
CTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGA23 (0.001457%)
CTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGAC6 (0.000380%)
CTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCT18 (0.001140%)
CTGCTTCTTCTTCCGATAGTGCATCTTGGCCTTTTCCTTCCGTTTCTCCTCCAGAGTGGCTGTCACTGCCTGGTACTTCCACCCGACCTCATGCGCCAGA131 (0.008298%)
CTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCC15 (0.000950%)
CTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAAC79 (0.005004%)
CTGGAATCACACCACATCATGTGTTTAAGCACGAGTAGAGTACAAGAGTTTCTTCTGGCTGCTCAATGCTGCCTGGCAGAAAAATGGTCCAGTGCTCACT17 (0.001077%)
CTGGACGCGAGCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCC26 (0.001647%)
CTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAAT33 (0.002090%)
CTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGGGCTGTGCGAAGTGCTCCCAGGGCTGCAT6 (0.000380%)
CTGGCGGATGCTCTCAAGAGCATCAACAACGCTGAGAAGAGAGGCAAACGCCAGGTCCTCATCAGGCCATGTTCTAAAGTCATCGTTCGGTTCTTAACCG13 (0.000823%)
CTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCCC19 (0.001204%)
CTGGCTGGCTTCACTCAAAGGCCACGCACTTAATCTTGAAGTCTCCATCCGCCGCCATGTAGTTGATGGCCTCCATGTTGAGGCGGTTGGGGAACTTGAA4 (0.000253%)
CTGGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTATTAGAAATGG9 (0.000570%)
CTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAAC70 (0.004434%)
CTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACT30 (0.001900%)
CTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGG38 (0.002407%)
CTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTGATGAGTTTCACCTCCTTATCCAGA10 (0.000633%)
CTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATTGCAGATGAGGCTCCCAAT6 (0.000380%)
CTGGGGGAAGGCTTCAGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACGGCTCTGGTAGTCCTCA11 (0.000697%)
CTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTG16 (0.001013%)
CTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGAGA10 (0.000633%)
CTGGGTGGGCCTTGGCCTCCTTCAGACAGGCAGAGGGCAGCAATCTGAACCCAGGGTGAGGAACCACAGAACAGAACAGCTGGACAAGCTCCAGCCAGGT5 (0.000317%)
CTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGA40 (0.002534%)
CTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCT55 (0.003484%)
CTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGA18 (0.001140%)
CTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCC12 (0.000760%)
CTGGTGGCTTGGACAGCCAAGTTCCTCTCCACAAAGATCTGCCTCTATCCAACCCAGTCTGGAGAACTTCCAAAGGAGCCTGAGCCATTAAGGACTAAAT3 (0.000190%)
CTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGG13 (0.000823%)
CTGGTTTAATAGCTGCTGAGATGGATTGTCTTGTCCTGCCGCCCTTTGCTGTGTGGGCAGTACTCTGAAGCAGGCAAATGGGTCTTAGGATCCCTCCCAG12 (0.000760%)
CTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAG272 (0.017229%)
CTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTC6 (0.000380%)
CTGTCCTCTTGCTCCTTCCTGCTCACCTTCAGGCCTTTGCCAGGCCAGAGTTGGAGGGGCAGTAGAACGTGGTGCCATCCCCAAGCTGGGTGATGGGTCT7 (0.000443%)
CTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGA7 (0.000443%)
CTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGGGTGGCGGGGCCACAA17 (0.001077%)
CTGTGTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCG18 (0.001140%)
CTGTGTTTAATGTTCTTCTGCTTCTTCCTGTCTCTCGGTGGCTCCTTGAGGGCTTTGATGATCAGGGCTGAGGCAGAAGGCACCACCTCGATCTGGGCCT5 (0.000317%)
CTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAGCAGGAGCAG10 (0.000633%)
CTTAATCATGGCCTCAGTTCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTGAA44 (0.002787%)
CTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAA12 (0.000760%)
CTTATCCCGAAGTTACGGATCCGGCTTGCCGACTTCCCTTACCTACATTGTTCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGG3 (0.000190%)
CTTATCTGGAATCACACCACATCATGTGTTTAAGCACGAGTAGAGTACAAGAGTTTCTTCTGGCTGCTCAATGCTGCCTGGCAGAAAAATGGTCCAGTGC5 (0.000317%)
CTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATAT6 (0.000380%)
CTTCAAAGGCCCCTACTGGTTTAATAGCTGCTGAGATGGATTGTCTTGTCCTGCCGCCCTTTGCTGTGTGGGCAGTACTCTGAAGCAGGCAAATGGGTCT13 (0.000823%)
CTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCA105 (0.006651%)
CTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTC18 (0.001140%)
CTTCAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCC35 (0.002217%)
CTTCACCAACATGCAAGTTCTTTTCCCTCTCTGCTAGCCAGACCATCAGATGGGTGGGAGAGGCAGGGGAGGCCTTCCTGCTCAGTAGTTCTGATTCTTT3 (0.000190%)
CTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCC12 (0.000760%)
CTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCT17 (0.001077%)
CTTCAGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACGGCTCTGGTAGTCCTCAGAGCCCACGAG5 (0.000317%)
CTTCAGTTTTTCCTGGGGGAAGGCTTCAGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACGGCTC6 (0.000380%)
CTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAA10 (0.000633%)
CTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAACTGGACCCATCTTTGGCTGTCAACTCCCAGGATCAAGATG5 (0.000317%)
CTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTC48 (0.003040%)
CTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGCGGGGCCTCGCTCCAC6 (0.000380%)
CTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTC360 (0.033750%)
CTTCCGAGGAAGCTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTC3 (0.000190%)
CTTCCGATAGTGCATCTTGGCCTTTTCCTTCCGTTTCTCCTCCAGAGTGGCTGTCACTGCCTGGTACTTCCACCCGACCTCATGCGCCAGACGCCCCAGG22 (0.001394%)
CTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCA69 (0.004371%)
CTTCCTGGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTATTAGAA9 (0.000570%)
CTTCCTTCTTTGCCTCCACTTTCTTCTCCTCAGCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCC216 (0.013682%)
CTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCAT13 (0.000823%)
CTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTC97 (0.006144%)
CTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGAT6 (0.000380%)
CTTCCTTTTCTCTTTATTAGAAATGGCAGCATCGATCTTCTTCACGGTTGCAGGGAGACCCAGGGTGTGAATGCTTTTAGGATAACCTGCTAGCTCCTCG8 (0.000507%)
CTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGG80 (0.005067%)
CTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACGAGAAGTAATATCAGTATCGTA5 (0.000317%)
CTTCTCCTCAGCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATTGCAGATG8 (0.000507%)
CTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCC25 (0.001584%)
CTTCTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGACCGTTCTTCCAC9 (0.000570%)
CTTCTGTCCTCTTGCTCCTTCCTGCTCACCTTCAGGCCTTTGCCAGGCCAGAGTTGGAGGGGCAGTAGAACGTGGTGCCATCCCCAAGCTGGGTGATGGG7 (0.000443%)
CTTCTTCCGATAGTGCATCTTGGCCTTTTCCTTCCGTTTCTCCTCCAGAGTGGCTGTCACTGCCTGGTACTTCCACCCGACCTCATGCGCCAGACGCCCC4 (0.000253%)
CTTCTTTGCCTCCACTTTCTTCTCCTCAGCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCA6 (0.000380%)
CTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACC75 (0.004751%)
CTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTCCTAGTCGTGCTTGAGA6 (0.000380%)
CTTGAGAGTGAGGCGCTCAAAGAGATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGA68 (0.004307%)
CTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAG74 (0.004687%)
CTTGCTCCTTCCTGCTCACCTTCAGGCCTTTGCCAGGCCAGAGTTGGAGGGGCAGTAGAACGTGGTGCCATCCCCAAGCTGGGTGATGGGTCTGGGTCAG27 (0.001710%)
CTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCA28 (0.001774%)
CTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTG38 (0.002407%)
CTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGG15 (0.000950%)
CTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAA129 (0.008171%)
CTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAG51 (0.003231%)
CTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCATCGAA38 (0.002407%)
CTTGGCCATGGAGAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCAC10 (0.000633%)
CTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGG7 (0.000443%)
CTTGGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAG366 (0.023184%)
CTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCA28 (0.001774%)
CTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTTGCTG12 (0.000760%)
CTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAA9 (0.000570%)
CTTGTTTGTGGCCCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGT11 (0.000697%)
CTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGA38 (0.002407%)
CTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTAT28 (0.001774%)
CTTTATTAGAAATGGCAGCATCGATCTTCTTCACGGTTGCAGGGAGACCCAGGGTGTGAATGCTTTTAGGATAACCTGCTAGCTCCTCGTGCCCTCGTAT4 (0.000253%)
CTTTATTTGAAGAAATGGTACAAATTAAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCA4 (0.000253%)
CTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTTCA20 (0.001267%)
CTTTCCTTCTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGACCGTTCT4 (0.000253%)
CTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAA26 (0.001647%)
CTTTCTGGGCAGACTTGGTGACTTTGCCAGCTCCAGCAGCCTTCTTGTCCACAGCTTTGATGACACCCACAGCAACTGTCTGCCTCATGTCACGAACAGC3 (0.000190%)
CTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTG5 (0.000317%)
CTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAACTGGACCCATCTTTGGCTGTCAACTCCCAGGATCAA15 (0.000950%)
CTTTCTTCTCCTCAGCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATTGCA56 (0.003547%)
CTTTGAAGGCAGCCTCGTGTACTGGGTGGGCCTTGGCCTCCTTCAGACAGGCAGAGGGCAGCAATCTGAACCCAGGGTGAGGAACCACAGAACAGAACAG3 (0.000190%)
CTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGTGCCGTTCCGAAGGGACGGGC14 (0.000887%)
CTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAG62 (0.003927%)
CTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGAT26 (0.001647%)
CTTTGCCAGCTCCAGCAGCCTTCTTGTCCACAGCTTTGATGACACCCACAGCAACTGTCTGCCTCATGTCACGAACAGCAAAGCGACCAAGTGGAGGGTA4 (0.000253%)
CTTTGGGCTGCATTCCCAAGCAACCCGACTCCGGGAAGACCCGAGCCCGGCGCGCCGGGGGCCGCTACCGGCCTCACACCGTCCACGGGCTGGGCCTCGA22 (0.001394%)
CTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAA247 (0.015646%)
CTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTC163 (0.010325%)
CTTTTCTCTTTATTAGAAATGGCAGCATCGATCTTCTTCACGGTTGCAGGGAGACCCAGGGTGTGAATGCTTTTAGGATAACCTGCTAGCTCCTCGTGCC10 (0.000633%)
CTTTTTAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAG67 (0.004244%)
GAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGA56 (0.003547%)
GAAAAAGTTGTGGAGAACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGC8 (0.000507%)
GAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTG24 (0.001520%)
GAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGAC12 (0.000760%)
GAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGG7 (0.000443%)
GAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTC50 (0.003167%)
GAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACGAGAAGTAAT18 (0.001140%)
GAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACG105 (0.009844%)
GAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATG39 (0.002470%)
GAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAA117 (0.002964%)
GAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGG76 (0.004814%)
GAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATC30 (0.001900%)
GAAAGGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGG12 (0.000760%)
GAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTG83 (0.005258%)
GAAATATTTTAGTGGAACCATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTT4 (0.000253%)
GAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTG24 (0.001520%)
GAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCA10 (0.000633%)
GAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGT15 (0.000950%)
GAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCT7 (0.000443%)
GAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGC28 (0.001774%)
GAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTG65 (0.004117%)
GAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCG6 (0.000380%)
GAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAG6 (0.000380%)
GAACGAGACTCTGGCATGCTAACTAGTTACGCGACCCCCGAGCGGTCGGCGTCCCCCAACTTCTTAGAGGGACAAGTGGCGTTCAGCCACCCGAGATTGA3 (0.000190%)
GAACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACT63 (0.003991%)
GAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCGCGGCGGC8 (0.000507%)
GAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATG20 (0.001267%)
GAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCG10 (0.000633%)
GAACGGGACGGGAGCGGCCGCGGGTGCGCGTCTCTCGGGGTCGGGGGTGCGTGGCGGGGGCCCGTCCCCCGCCTCCCCTCCGCGCGCCGGGTTTCGCCCC3 (0.000190%)
GAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGA10 (0.000633%)
GAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCA39 (0.002470%)
GAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGG21 (0.001330%)
GAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATG8 (0.000507%)
GAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGG3 (0.000190%)
GAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGTGCCGTTCCGAAGGGACG8 (0.000507%)
GAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTG20 (0.001267%)
GAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTT29 (0.001837%)
GAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTC11 (0.000697%)
GAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAG36 (0.002280%)
GAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTC69 (0.004371%)
GAAGAAGAGAATGCGCAGGCTGAAGCGCAAGAGAAGAAAGATGAGGCAGAGGTCCAAGTAAGCCAGCCCGTGCACCTACGACGCCTGCAGGAGCAGAAGT4 (0.000253%)
GAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATG4 (0.000253%)
GAAGACCCGAGCCCGGCGCGCCGGGGGCCGCTACCGGCCTCACACCGTCCACGGGCTGGGCCTCGATCAGAAGGACTTGGGCCCCCCACGAGCGGCGCCG4 (0.000253%)
GAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCA3 (0.000190%)
GAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGAGTCGTTCTGCCAATAG13 (0.000823%)
GAAGACGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACA306 (0.019383%)
GAAGAGAATGCGCAGGCTGAAGCGCAAGAGAAGAAAGATGAGGCAGAGGTCCAAGTAAGCCAGCCCGTGCACCTACGACGCCTGCAGGAGCAGAAGTGAG3 (0.000190%)
GAAGAGCACACGTCTGAACTCCAGTCACCGTGCATAGAAT8 (0.000203%)
GAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCGCAGTTGGAA3 (0.000190%)
GAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAG12 (0.000760%)
GAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTC86 (0.005448%)
GAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCG6 (0.000380%)
GAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGA30 (0.001900%)
GAAGCTCGGGTGCGTTCAAGATTCGGCGTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTGCTCT5 (0.000317%)
GAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCA39 (0.002470%)
GAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGG10 (0.000633%)
GAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACT4 (0.000253%)
GAAGGCTTCAGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACGGCTCTGGTAGTCCTCAGAGCCC7 (0.000443%)
GAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGACCGTTCTTCCACCACTG10 (0.000633%)
GAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAACTGGACC9 (0.000570%)
GAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATT7 (0.000443%)
GAAGTTACGGATCCGGCTTGCCGACTTCCCTTACCTACATTGTTCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCC3 (0.000190%)
GAATACGTAGGCTTGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGATTAGGTGTATTAATAAGTGTCCTGCA6 (0.000562%)
GAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGAG4 (0.000253%)
GAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAA9 (0.000570%)
GAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAA44 (0.002787%)
GAATCCCGCCCAGGCGGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCG5 (0.000317%)
GAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCGCCGGCA4 (0.000253%)
GAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCA46 (0.002914%)
GAATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATG20 (0.001267%)
GAATGTTCTGGCGGATGCTCTCAAGAGCATCAACAACGCTGAGAAGAGAGGCAAACGCCAGGTCCTCATCAGGCCATGTTCTAAAGTCATCGTTCGGTTC6 (0.000380%)
GACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTC24 (0.001520%)
GACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGGGAGACG18 (0.001140%)
GACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACT23 (0.001457%)
GACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTA9 (0.000570%)
GACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGAGAGCTAAGCTGACTTC37 (0.002344%)
GACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGAGAGCTAAG3 (0.000190%)
GACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACC8 (0.000507%)
GACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTGATGAGTTTCACCTCCTTAT3 (0.000190%)
GACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACC4 (0.000253%)
GACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGT3 (0.000190%)
GACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGC3 (0.000190%)
GACGCGAGCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGC4 (0.000253%)
GACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTC24 (0.001520%)
GACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGG5 (0.000317%)
GACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAA881 (0.055806%)
GACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGG3 (0.000190%)
GACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGAGTCGTTCTGC5 (0.000317%)
GACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAGTTTTCT5 (0.000317%)
GACTCTGGACGCGAGCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCC6 (0.000380%)
GACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGA7 (0.000443%)
GACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAA6 (0.000380%)
GAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGG8 (0.000507%)
GAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAA170 (0.010768%)
GAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATC45 (0.002850%)
GAGAACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCA8 (0.000507%)
GAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGTGCCGTTCCGAAGGGA6 (0.000380%)
GAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCTCTTTTCTTTGTGAAGGGCAGGGCGCCCTGGAATGGGTTCGCCCCGAGAGAGGGGCCCGTGCCTTGGAA380 (0.024071%)
GAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGG77 (0.004877%)
GAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTGATGAGTTTCACCTCCTT8 (0.000507%)
GAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACC5 (0.000317%)
GAGACTCTGGCATGCTAACTAGTTACGCGACCCCCGAGCGGTCGGCGTCCCCCAACTTCTTAGAGGGACAAGTGGCGTTCAGCCACCCGAGATTGAGCAA6 (0.000380%)
GAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTT7 (0.000443%)
GAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGA20 (0.001267%)
GAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTCCTAGTCGTGCTTGAGAGTG11 (0.000697%)
GAGAGTGAGGCGCTCAAAGAGATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGG12 (0.000760%)
GAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAA24 (0.001520%)
GAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGC2867 (0.072643%)
GAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCG7 (0.000443%)
GAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTC5 (0.000317%)
GAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTCGG3 (0.000190%)
GAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTG7 (0.000443%)
GAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGC25 (0.001584%)
GAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAA9 (0.000570%)
GAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTC3 (0.000190%)
GAGCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGCGGGGC4 (0.000253%)
GAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGC6 (0.000380%)
GAGCGGCCGCGGGTGCGCGTCTCTCGGGGTCGGGGGTGCGTGGCGGGGGCCCGTCCCCCGCCTCCCCTCCGCGCGCCGGGTTTCGCCCCCGCGGCGTCGG4 (0.000253%)
GAGCTCCCTCCCGGCTCCGGCCGGGGGTCGGGCGCCGGCGGCTTTGGTGACTCTAGATAACCTCGGGCCGATCGCACGCCCCCCGTGGCGGCGACGACCC7 (0.000443%)
GAGCTTTCTGGGCAGACTTGGTGACTTTGCCAGCTCCAGCAGCCTTCTTGTCCACAGCTTTGATGACACCCACAGCAACTGTCTGCCTCATGTCACGAAC3 (0.000190%)
GAGGAAGCTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTG9 (0.000570%)
GAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAGTTT53 (0.003357%)
GAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGG19 (0.001204%)
GAGGCGGAAGCTCGGGTGCGTTCAAGATTCGGCGTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACAC3 (0.000190%)
GAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGA17 (0.001077%)
GAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCC5 (0.000317%)
GAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGC53 (0.003357%)
GAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGCCTCTCAAATTATAAAGATCATGAT98 (0.006208%)
GAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGAC11 (0.000697%)
GAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAG14 (0.000887%)
GAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTCCTAGTCGTGCTTGAGAGTGAG3 (0.000190%)
GAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAA5 (0.000317%)
GAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCAT4 (0.000253%)
GAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCC3 (0.000190%)
GAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGAC14 (0.000887%)
GAGTGAGGCGCTCAAAGAGATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTT13 (0.000823%)
GAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCT7 (0.000443%)
GAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAA8 (0.000507%)
GAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTC12 (0.000760%)
GAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAACTGGACCCATCTTTGGCTGT3 (0.000190%)
GATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGG5 (0.000317%)
GATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTGATGAG4 (0.000253%)
GATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCGCAGTTGGAATTT3 (0.000190%)
GATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAAC6 (0.000380%)
GATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCA3 (0.000190%)
GATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTC17 (0.001077%)
GATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTC76 (0.004814%)
GATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGGGCTGTGCGAAGTG3 (0.000190%)
GATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCA24 (0.001520%)
GATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGA3 (0.000190%)
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGCAT102 (0.002584%)
GATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAA3 (0.000190%)
GATCTCTCGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATG19 (0.001204%)
GATCTGTGTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCT8 (0.000507%)
GATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGT23 (0.001457%)
GATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCT67 (0.006281%)
GATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAG7 (0.000443%)
GATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGAT9 (0.000570%)
GATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACT3 (0.000190%)
GATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTT6 (0.000380%)
GATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGGGCTGTGCGA18 (0.001140%)
GATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATA16 (0.001013%)
GATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTG4 (0.000253%)
GATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGG3 (0.000190%)
GATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAG15 (0.000950%)
GATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAG3 (0.000190%)
GATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCAT3 (0.000190%)
GATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCAACCAACACCTTTTCTGGGGTCTGAT7 (0.000443%)
GATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGA30 (0.001900%)
GATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCA13 (0.000823%)
GATTGTCACACAGCCCACATAGCATGCAAGTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTGGTAAGAAGCTGGAAGATGGCCCCAAGTTCCTGA5 (0.000317%)
GATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTCGGGG4 (0.000253%)
GATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTC13 (0.000823%)
GATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGC17 (0.001077%)
GCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGG20 (0.001267%)
GCAAAGTGACGGCTCTGGTAGTCCTCAGAGCCCACGAGGACCTGATCCGTCCACAAACAGTGAGTGTCACTCTCCAGTTTGCAAGGGATAGATAAACAGG319 (0.020207%)
GCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGG26 (0.001647%)
GCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGTG6 (0.000380%)
GCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGGGCTGTGCGAAGTGCTCCCAGGGCTGCATCTGCAAAGA6 (0.000380%)
GCAACCATACTCCCCCCGGAACCCAAAGACTTTGGTTTCCCGGAAGCTGCCCGGCGGGTCATGGGAATAACGCCGCCGCATCGCCAGTCGGCATCGTTTA355 (0.022487%)
GCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAAC16 (0.001013%)
GCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACC42 (0.002660%)
GCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGTCCCGTGGGCTGCTCCAAATGTGCCCAGGGCTGTGTCTGCAAAGGCGCCGC3 (0.000190%)
GCAAGCCCCACACTGTTCCATGCAAGGTGACAGGCCGCTGTGGCTCTGTGCTGGTGCGTCTCATCCCTGCCCCCAGAGGCACTGGCATTGTCTCTGCTCC7 (0.000443%)
GCAAGTTCTTTTCCCTCTCTGCTAGCCAGACCATCAGATGGGTGGGAGAGGCAGGGGAGGCCTTCCTGCTCAGTAGTTCTGATTCTTTGATGTGAAAGGG3 (0.000190%)
GCAAGTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTGGTAAGAAGCTGGAAGATGGCCCCAAGTTCCTGAAGTCTGGCGATGCTGCCATTGTTGA5 (0.000317%)
GCAATGTTGACAATCTCATCAAAAGTAATGTTCCCACTGTGTTTAATGTTCTTCTGCTTCTTCCTGTCTCTCGGTGGCTCCTTGAGGGCTTTGATGATCA3 (0.000190%)
GCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGAC38 (0.002407%)
GCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAGCAGGAGCAGCAGCTCTTCTTGCAGG3 (0.000190%)
GCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCAGG6 (0.000380%)
GCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACA4 (0.000253%)
GCACATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAG57 (0.003611%)
GCACATTTTGCGAGTACTCAACACCAACATCGATGGGCGGCGGAAAATAGCCTTCGCCATCACTGCCATTAAGGGCGTGGGGCGGAGATATGCTCATGTG5 (0.000317%)
GCACCAGTTCTAAGTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGG8 (0.000507%)
GCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAGG8 (0.000507%)
GCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGT1994 (0.126307%)
GCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTG3 (0.000190%)
GCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTC5 (0.000317%)
GCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTAT18 (0.001140%)
GCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCAC121 (0.007665%)
GCAGACTTGGTGACTTTGCCAGCTCCAGCAGCCTTCTTGTCCACAGCTTTGATGACACCCACAGCAACTGTCTGCCTCATGTCACGAACAGCAAAGCGAC12 (0.000760%)
GCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAG13 (0.000823%)
GCAGCATCGATCTTCTTCACGGTTGCAGGGAGACCCAGGGTGTGAATGCTTTTAGGATAACCTGCTAGCTCCTCGTGCCCTCGTATAGCCCAGAACTGAT33 (0.002090%)
GCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCA21 (0.001330%)
GCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCGCGGCGGCGCGGGGTCTC12 (0.000760%)
GCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATA25 (0.001584%)
GCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTT7 (0.000443%)
GCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTG87 (0.005511%)
GCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCAACCAACACCTTTTCTGGGGTCTGATGAGCGT4 (0.000253%)
GCAGGTTATCCTAAAAGCATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCT19 (0.001204%)
GCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATTGCAGATGAGGCTCCCAATGTTGACATTGG3 (0.000190%)
GCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGCCCCCTC3 (0.000190%)
GCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTAT10 (0.000633%)
GCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTG22 (0.001394%)
GCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAAC9 (0.000570%)
GCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTG12 (0.000760%)
GCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGA27 (0.001710%)
GCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAACT20 (0.001267%)
GCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGACCGTTCTTCCACCACTGATTAAGACTGGGGT6 (0.000380%)
GCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGA95 (0.006018%)
GCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATA23 (0.001457%)
GCCAATCCTTATCCCGAAGTTACGGATCCGGCTTGCCGACTTCCCTTACCTACATTGTTCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGG18 (0.001140%)
GCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCT83 (0.005258%)
GCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGA14 (0.000887%)
GCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACA29 (0.001837%)
GCCACTCACCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACAT472 (0.044249%)
GCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACT19 (0.001204%)
GCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGA70 (0.004434%)
GCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACC17 (0.001077%)
GCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCT15 (0.000950%)
GCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTT91 (0.005764%)
GCCAGCTCCAGCAGCCTTCTTGTCCACAGCTTTGATGACACCCACAGCAACTGTCTGCCTCATGTCACGAACAGCAAAGCGACCAAGTGGAGGGTAGTCA9 (0.000570%)
GCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCC290 (0.027187%)
GCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGA13 (0.000823%)
GCCAGGCCAGAGTTGGAGGGGCAGTAGAACGTGGTGCCATCCCCAAGCTGGGTGATGGGTCTGGGTCAGAGCAGGTTTCTGGGAGGGATCCTAAGACCCA3 (0.000190%)
GCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTG124 (0.007855%)
GCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTT14 (0.000887%)
GCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTG10 (0.000633%)
GCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCAAC7 (0.000443%)
GCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAA24 (0.001520%)
GCCATGGAGAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATC4 (0.000253%)
GCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCA28 (0.001774%)
GCCCACATAGCATGCAAGTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTGGTAAGAAGCTGGAAGATGGCCCCAAGTTCCTGAAGTCTGGCGATG7 (0.000443%)
GCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTGATGAGTTTCACC3 (0.000190%)
GCCCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATA10 (0.000633%)
GCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCC30 (0.001900%)
GCCCGACGCTCCAGCGCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCT12 (0.000760%)
GCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAG14 (0.000887%)
GCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGT27 (0.001710%)
GCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCA5 (0.000317%)
GCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATC6 (0.000380%)
GCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACT14 (0.000887%)
GCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCGCGGCGGCGCGGGGTCTCCCCCC18 (0.001140%)
GCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAA211 (0.013366%)
GCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATG22 (0.001394%)
GCCGCCGCCATGTCTCTAGTGATCCCTGAGAAGTTCCAGCACATTTTGCGAGTACTCAACACCAACATCGATGGGCGGCGGAAAATAGCCTTCGCCATCA84 (0.005321%)
GCCGCGGGTGCGCGTCTCTCGGGGTCGGGGGTGCGTGGCGGGGGCCCGTCCCCCGCCTCCCCTCCGCGCGCCGGGTTTCGCCCCCGCGGCGTCGGGCCCC16 (0.001013%)
GCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCATCTACTCCGC13 (0.000823%)
GCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGC13 (0.000823%)
GCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCACACGCGCGGGACGCC18 (0.001140%)
GCCGGCTTCTCCGGGATCGGTCGCGTTACCGCACTGGACGCCTCGCGGCGCCCATCTCCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCGA23 (0.001457%)
GCCGGGCAATGTTGACAATCTCATCAAAAGTAATGTTCCCACTGTGTTTAATGTTCTTCTGCTTCTTCCTGTCTCTCGGTGGCTCCTTGAGGGCTTTGAT57 (0.003611%)
GCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGCGGGGCCT22 (0.001394%)
GCCGGGTATGGGCCCGACGCTCCAGCGCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATG14 (0.000887%)
GCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAA20 (0.001267%)
GCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCATCGAAAGTTGATAGGGCA26 (0.001647%)
GCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCT50 (0.003167%)
GCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTCCTAGTCG3 (0.000190%)
GCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCC43 (0.002724%)
GCCTCAGTTCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTGAACACTCTAATT22 (0.001394%)
GCCTCCACTTTCTTCTCCTCAGCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTA6 (0.000380%)
GCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGGGCT5 (0.000317%)
GCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGA14 (0.000887%)
GCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGTCCCGTGGGCTGCTCCAAATGTGCCCAGGGCTGTGTCTGCAAAGGCG285 (0.018053%)
GCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGC79 (0.005004%)
GCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGT38 (0.002407%)
GCCTTCAAAGGCCCCTACTGGTTTAATAGCTGCTGAGATGGATTGTCTTGTCCTGCCGCCCTTTGCTGTGTGGGCAGTACTCTGAAGCAGGCAAATGGGT21 (0.001330%)
GCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTT83 (0.005258%)
GCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACC10 (0.000633%)
GCCTTGGCCATGGAGAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCC8 (0.000507%)
GCCTTTGAAGGCAGCCTCGTGTACTGGGTGGGCCTTGGCCTCCTTCAGACAGGCAGAGGGCAGCAATCTGAACCCAGGGTGAGGAACCACAGAACAGAAC222 (0.014062%)
GCGAATGAATGTTCTGGCGGATGCTCTCAAGAGCATCAACAACGCTGAGAAGAGAGGCAAACGCCAGGTCCTCATCAGGCCATGTTCTAAAGTCATCGTT130 (0.008235%)
GCGAATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAA17 (0.001077%)
GCGACATGGCTAAACGCACCAAGAAGGTCGGCATCGTCGGCAAGTACGGGACCCGCTATGGTGCCTCCCTCCGGAAAATGGTGAAGAAAATTGAAATCAG23 (0.001457%)
GCGACTCTGGACGCGAGCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCC17 (0.001077%)
GCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTC71 (0.004497%)
GCGAGCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGCGGG52 (0.003294%)
GCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGA16 (0.001013%)
GCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCG5 (0.000317%)
GCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAG143 (0.009058%)
GCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCC44 (0.002787%)
GCGATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCA13 (0.000823%)
GCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGC7 (0.000443%)
GCGCCAAAAAGGGCCGCGGCCATGTGCAGCCCATTCGCTGCACGAACTGCGCCCGGTGCGTGCCCAAGGATAAGGCCATCAAGAAGTTTGTCATTCGGAA3 (0.000190%)
GCGCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCA53 (0.003357%)
GCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCGCGGCGGCGCGGGGTCTCCCC4 (0.000253%)
GCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCACACGCGCGGGACG22 (0.001394%)
GCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGGGCTGTGCGAAGTGCTCCCAGGGCTGCATCTG3 (0.000190%)
GCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTC6 (0.000380%)
GCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCA3 (0.000190%)
GCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAG19 (0.001204%)
GCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGA14 (0.000887%)
GCGCTCAAAGAGATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATC6 (0.000380%)
GCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGGGCTGTGCGAAGTGCTCCCAGGGCTG67 (0.004244%)
GCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAGCAGGAG19 (0.001204%)
GCGGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCGCGGC25 (0.001584%)
GCGGAAGAAGAGAATGCGCAGGCTGAAGCGCAAGAGAAGAAAGATGAGGCAGAGGTCCAAGTAAGCCAGCCCGTGCACCTACGACGCCTGCAGGAGCAGA468 (0.029645%)
GCGGAAGCTCGGGTGCGTTCAAGATTCGGCGTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTGC19 (0.001204%)
GCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGGG25 (0.001584%)
GCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCTCTTTTCTTTGTGAAGGGC22 (0.001394%)
GCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGG5 (0.000317%)
GCGGAGGCGGAAGCTCGGGTGCGTTCAAGATTCGGCGTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAA211 (0.013366%)
GCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGA103 (0.006524%)
GCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTT79 (0.005004%)
GCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATTGCAGATGAGGCTCCCAATGTTGACAT22 (0.001394%)
GCGGCCGCGGGTGCGCGTCTCTCGGGGTCGGGGGTGCGTGGCGGGGGCCCGTCCCCCGCCTCCCCTCCGCGCGCCGGGTTTCGCCCCCGCGGCGTCGGGC25 (0.001584%)
GCGGCGACTCTGGACGCGAGCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGG25 (0.001584%)
GCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATTGCAGATGAGGCTCCCAATGTTGA8 (0.000507%)
GCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGGGTCGGAGGGGTCGAGC3 (0.000190%)
GCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAA17 (0.001077%)
GCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGT17 (0.001077%)
GCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGGG9 (0.000570%)
GCGGTTACAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAG364 (0.023057%)
GCGGTTTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTT1719 (0.108888%)
GCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTT5 (0.000317%)
GCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCG15 (0.000950%)
GCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATG3 (0.000190%)
GCGTTACCGCACTGGACGCCTCGCGGCGCCCATCTCCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCGATCGGCCGAGGGCAACGGAGGCC5 (0.000317%)
GCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAACTTGAAGGCTAACAAAATCTGTGTTCAAAAGCTGGCTAGGACGTT17 (0.001077%)
GCTAAACGCACCAAGAAGGTCGGCATCGTCGGCAAGTACGGGACCCGCTATGGTGCCTCCCTCCGGAAAATGGTGAAGAAAATTGAAATCAGCCAGCACG27 (0.001710%)
GCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGA62 (0.003927%)
GCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCG69 (0.004371%)
GCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCGCCGGCAGTCGGA5 (0.000317%)
GCTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCATCTA28 (0.001774%)
GCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAA6 (0.000380%)
GCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAAT9 (0.000570%)
GCTAGCAGGTTATCCTAAAAGCATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTAC319 (0.020207%)
GCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCACACGCGCG9 (0.000570%)
GCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAG4 (0.000253%)
GCTATCTTCCTGGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTAT3 (0.000190%)
GCTCAAAGAGATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTT7 (0.000443%)
GCTCACCTTCAGGCCTTTGCCAGGCCAGAGTTGGAGGGGCAGTAGAACGTGGTGCCATCCCCAAGCTGGGTGATGGGTCTGGGTCAGAGCAGGTTTCTGG4 (0.000253%)
GCTCCAGCAGCCTTCTTGTCCACAGCTTTGATGACACCCACAGCAACTGTCTGCCTCATGTCACGAACAGCAAAGCGACCAAGTGGAGGGTAGTCAGAGA3 (0.000190%)
GCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCAT7 (0.000443%)
GCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTA94 (0.005954%)
GCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGC17 (0.001077%)
GCTCCTTCCTGCTCACCTTCAGGCCTTTGCCAGGCCAGAGTTGGAGGGGCAGTAGAACGTGGTGCCATCCCCAAGCTGGGTGATGGGTCTGGGTCAGAGC6 (0.000380%)
GCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGC25 (0.001584%)
GCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGG11 (0.000697%)
GCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGAC11 (0.000697%)
GCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAA25 (0.001584%)
GCTCTTCAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCA7 (0.000443%)
GCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGG17 (0.001077%)
GCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAA32 (0.002027%)
GCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTG12 (0.000760%)
GCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGCCCC7 (0.000443%)
GCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACT6 (0.000380%)
GCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAA27 (0.001710%)
GCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTCCTAG5 (0.000317%)
GCTGCCTTCAAAGGCCCCTACTGGTTTAATAGCTGCTGAGATGGATTGTCTTGTCCTGCCGCCCTTTGCTGTGTGGGCAGTACTCTGAAGCAGGCAAATG255 (0.016153%)
GCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACT14 (0.000887%)
GCTGCCTTGGCCATGGAGAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAA50 (0.003167%)
GCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGC3 (0.000190%)
GCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCACACGC5 (0.000317%)
GCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGGGCTGTGCGAAGTGCTCCCAGGGCTGCA5 (0.000317%)
GCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCC3 (0.000190%)
GCTGGCTGGCTTCACTCAAAGGCCACGCACTTAATCTTGAAGTCTCCATCCGCCGCCATGTAGTTGATGGCCTCCATGTTGAGGCGGTTGGGGAACTTGA134 (0.008488%)
GCTGGCTTCACTCAAAGGCCACGCACTTAATCTTGAAGTCTCCATCCGCCGCCATGTAGTTGATGGCCTCCATGTTGAGGCGGTTGGGGAACTTGAATTC17 (0.001077%)
GCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATTGCAGATGAGGCTCCCAA7 (0.000443%)
GCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCC45 (0.002850%)
GCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATG42 (0.002660%)
GCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCG56 (0.003547%)
GCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGA9 (0.000570%)
GCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGAC33 (0.002090%)
GCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAGCAGGAGCA9 (0.000570%)
GCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAA12 (0.000760%)
GCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCC26 (0.001647%)
GCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCT4 (0.000253%)
GCTTCACTCAAAGGCCACGCACTTAATCTTGAAGTCTCCATCCGCCGCCATGTAGTTGATGGCCTCCATGTTGAGGCGGTTGGGGAACTTGAATTCATGT3 (0.000190%)
GCTTCAGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACGGCTCTGGTAGTCCTCAGAGCCCACGA3 (0.000190%)
GCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACA42 (0.002660%)
GCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTG21 (0.001330%)
GCTTCTGTCCTCTTGCTCCTTCCTGCTCACCTTCAGGCCTTTGCCAGGCCAGAGTTGGAGGGGCAGTAGAACGTGGTGCCATCCCCAAGCTGGGTGATGG4 (0.000253%)
GCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCAC18 (0.001140%)
GCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTCCTAGTCGTGCTTGAG9 (0.000570%)
GCTTGAGAGTGAGGCGCTCAAAGAGATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAG52 (0.003294%)
GCTTTATAGAAAAAGTTGTGGAGAACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCC36 (0.002280%)
GCTTTCTGGGCAGACTTGGTGACTTTGCCAGCTCCAGCAGCCTTCTTGTCCACAGCTTTGATGACACCCACAGCAACTGTCTGCCTCATGTCACGAACAG6 (0.000380%)
GCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAACTGGACCCATCTTTGGCTGTCAACTCCCAGGATCA15 (0.000950%)
GCTTTGGGCTGCATTCCCAAGCAACCCGACTCCGGGAAGACCCGAGCCCGGCGCGCCGGGGGCCGCTACCGGCCTCACACCGTCCACGGGCTGGGCCTCG14 (0.000887%)
GCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTA58 (0.003674%)
GGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAG32 (0.002027%)
GGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGT62 (0.003927%)
GGAAAGGCTTATCTGGAATCACACCACATCATGTGTTTAAGCACGAGTAGAGTACAAGAGTTTCTTCTGGCTGCTCAATGCTGCCTGGCAGAAAAATGGT88 (0.005574%)
GGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTATTAGAAATGGCAG5 (0.000317%)
GGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGG39 (0.002470%)
GGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCC21 (0.001330%)
GGAACCATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTG6 (0.000380%)
GGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTC34 (0.002154%)
GGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCGCGGCGG6 (0.000380%)
GGAACGGGACGGGAGCGGCCGCGGGTGCGCGTCTCTCGGGGTCGGGGGTGCGTGGCGGGGGCCCGTCCCCCGCCTCCCCTCCGCGCGCCGGGTTTCGCCC5 (0.000317%)
GGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGC19 (0.001204%)
GGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTG7 (0.000443%)
GGAAGAAGAGAATGCGCAGGCTGAAGCGCAAGAGAAGAAAGATGAGGCAGAGGTCCAAGTAAGCCAGCCCGTGCACCTACGACGCCTGCAGGAGCAGAAG4 (0.000253%)
GGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCC93 (0.005891%)
GGAAGAGCACACGTCTGAACTCCAGTCACCGTGCATAGAA15 (0.000380%)
GGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCGCAGTTGGA35 (0.002217%)
GGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTT68 (0.004307%)
GGAAGCTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCA22 (0.001394%)
GGAAGCTCGGGTGCGTTCAAGATTCGGCGTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTGCTC6 (0.000380%)
GGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTG487 (0.030848%)
GGAAGGCTTCAGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACGGCTCTGGTAGTCCTCAGAGCC8 (0.000507%)
GGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTC4 (0.000253%)
GGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCGCCGGC5 (0.000317%)
GGAATGTGACCTCTCTCATATCTACTCCTACAGTGAGAAAGAGACCGAATGAGCTGCAGTAGAAGCACACCGCGGTCAGACTCCGCAGTTCCGAATATAC4 (0.000253%)
GGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGATTTAGTCG9 (0.000570%)
GGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGGGTG12 (0.000760%)
GGACGCGAGCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCG5 (0.000317%)
GGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCT46 (0.002914%)
GGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACTGAGTTTTC20 (0.001267%)
GGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGAT89 (0.005638%)
GGAGAACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGC50 (0.003167%)
GGAGAAGAACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGAT5 (0.000317%)
GGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAAC4 (0.000253%)
GGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAG99 (0.006271%)
GGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAAAGATACT7 (0.000443%)
GGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGG101 (0.006398%)
GGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGT5 (0.000317%)
GGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATG15 (0.000950%)
GGAGCGGCCGCGGGTGCGCGTCTCTCGGGGTCGGGGGTGCGTGGCGGGGGCCCGTCCCCCGCCTCCCCTCCGCGCGCCGGGTTTCGCCCCCGCGGCGTCG7 (0.000443%)
GGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCC5 (0.000317%)
GGAGGCGGAAGCTCGGGTGCGTTCAAGATTCGGCGTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACA7 (0.000443%)
GGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAG21 (0.001330%)
GGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGA12 (0.000760%)
GGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGA218 (0.013809%)
GGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCC3 (0.000190%)
GGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCC11 (0.000697%)
GGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCTCTTTTCTTTGTG3 (0.000190%)
GGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCGCCGGCAGTCGGAACGGA13 (0.000823%)
GGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGA11 (0.000697%)
GGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCT11 (0.000697%)
GGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAA9 (0.000570%)
GGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCC6 (0.000380%)
GGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCT36 (0.002280%)
GGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGGGCTGTGCGAAGT17 (0.001077%)
GGATCTGTGTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCC19 (0.001204%)
GGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCATCGAAAGT4 (0.000253%)
GGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCA60 (0.003801%)
GGATTGTCACACAGCCCACATAGCATGCAAGTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTGGTAAGAAGCTGGAAGATGGCCCCAAGTTCCTG157 (0.009945%)
GGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTT32 (0.002027%)
GGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCG85 (0.005384%)
GGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATG48 (0.003040%)
GGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAGCAGGAGCAGCAGCTCTTCTTGCAG5 (0.000317%)
GGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTGCAG6 (0.000380%)
GGCAGACTTGGTGACTTTGCCAGCTCCAGCAGCCTTCTTGTCCACAGCTTTGATGACACCCACAGCAACTGTCTGCCTCATGTCACGAACAGCAAAGCGA15 (0.000950%)
GGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTC50 (0.003167%)
GGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAGCA16 (0.001013%)
GGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCAACCAACACCTTTTCTGGGGTCTGATGAGCG4 (0.000253%)
GGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATTGCAGATGAGGCTCCCAATGTTGACATTG4 (0.000253%)
GGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAG9 (0.000570%)
GGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCAC21 (0.001330%)
GGCCAGAGTTGGAGGGGCAGTAGAACGTGGTGCCATCCCCAAGCTGGGTGATGGGTCTGGGTCAGAGCAGGTTTCTGGGAGGGATCCTAAGACCCATTTG6 (0.000380%)
GGCCCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCAT4 (0.000253%)
GGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGC4 (0.000253%)
GGCCCCTACTGGTTTAATAGCTGCTGAGATGGATTGTCTTGTCCTGCCGCCCTTTGCTGTGTGGGCAGTACTCTGAAGCAGGCAAATGGGTCTTAGGATC3 (0.000190%)
GGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGCGGGGCCTCGCT6 (0.000380%)
GGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGA12 (0.000760%)
GGCCGCAGCCCGCGCAGATGTAGAGGCGGCGCCGCATGTGCGCGCGACGGTGGCGGATGAAGTGTGAGCTGAGGCGGAAGCGCCGGCCGCACTCCGTGCA7 (0.000443%)
GGCCGCGGGTGCGCGTCTCTCGGGGTCGGGGGTGCGTGGCGGGGGCCCGTCCCCCGCCTCCCCTCCGCGCGCCGGGTTTCGCCCCCGCGGCGTCGGGCCC5 (0.000317%)
GGCCTCAGTTCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTGAACACTCTAAT5 (0.000317%)
GGCGACATGGCTAAACGCACCAAGAAGGTCGGCATCGTCGGCAAGTACGGGACCCGCTATGGTGCCTCCCTCCGGAAAATGGTGAAGAAAATTGAAATCA10 (0.000633%)
GGCGACTCTGGACGCGAGCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTC23 (0.001457%)
GGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGG56 (0.003547%)
GGCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGG285 (0.018053%)
GGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCACACGCGCGGGAC14 (0.000887%)
GGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGGGCTGTGCGAAGTGCTCCCAGGGCTGCATCT4 (0.000253%)
GGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCT6 (0.000380%)
GGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTGATGAGTTTCACCTCCTTATCCAGATAGT3 (0.000190%)
GGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGG8 (0.000507%)
GGCGCTCAAAGAGATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCAT14 (0.000887%)
GGCGGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCGCGG13 (0.000823%)
GGCGGAAGCTCGGGTGCGTTCAAGATTCGGCGTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTG5 (0.000317%)
GGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCTCTTTTCTTTGTGAAGGG10 (0.000633%)
GGCGGATGCTCTCAAGAGCATCAACAACGCTGAGAAGAGAGGCAAACGCCAGGTCCTCATCAGGCCATGTTCTAAAGTCATCGTTCGGTTCTTAACCGTG4 (0.000253%)
GGCGGCGACTCTGGACGCGAGCCGGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGG636 (0.040287%)
GGCGTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTGCTCTACAAGAGGTGCTGAAGACCGCCCT3 (0.000190%)
GGCTAAACGCACCAAGAAGGTCGGCATCGTCGGCAAGTACGGGACCCGCTATGGTGCCTCCCTCCGGAAAATGGTGAAGAAAATTGAAATCAGCCAGCAC4 (0.000253%)
GGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCA5 (0.000317%)
GGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCAACCAACACCTTTTCTGG6 (0.000380%)
GGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAG12 (0.000760%)
GGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGA9 (0.000570%)
GGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAAC16 (0.001013%)
GGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGC30 (0.001900%)
GGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCACACG12 (0.000760%)
GGCTGGCTTCACTCAAAGGCCACGCACTTAATCTTGAAGTCTCCATCCGCCGCCATGTAGTTGATGGCCTCCATGTTGAGGCGGTTGGGGAACTTGAATT5 (0.000317%)
GGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGG10 (0.000633%)
GGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGA10 (0.000633%)
GGCTTCAGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACGGCTCTGGTAGTCCTCAGAGCCCACG3 (0.000190%)
GGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCT36 (0.002280%)
GGCTTCTCCGGGATCGGTCGCGTTACCGCACTGGACGCCTCGCGGCGCCCATCTCCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCGATCG5 (0.000317%)
GGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTCCTAGTCGTGCTTGA4 (0.000253%)
GGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGT9 (0.000570%)
GGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTATTAGAAATGGCA28 (0.001774%)
GGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTG37 (0.002344%)
GGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAG24 (0.001520%)
GGGAAGGCTTCAGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACGGCTCTGGTAGTCCTCAGAGC4 (0.000253%)
GGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGAT284 (0.026625%)
GGGAATGTGACCTCTCTCATATCTACTCCTACAGTGAGAAAGAGACCGAATGAGCTGCAGTAGAAGCACACCGCGGTCAGACTCCGCAGTTCCGAATATA140 (0.008868%)
GGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGACCTGCTGGCCTGCCTAAA77 (0.004877%)
GGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCA10 (0.000633%)
GGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCG3 (0.000190%)
GGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGG70 (0.004434%)
GGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAAT38 (0.002407%)
GGGAGCGGCCGCGGGTGCGCGTCTCTCGGGGTCGGGGGTGCGTGGCGGGGGCCCGTCCCCCGCCTCCCCTCCGCGCGCCGGGTTTCGCCCCCGCGGCGTC10 (0.000633%)
GGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGC3 (0.000190%)
GGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGG11 (0.000697%)
GGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTC8 (0.000507%)
GGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTT42 (0.002660%)
GGGATCGGTCGCGTTACCGCACTGGACGCCTCGCGGCGCCCATCTCCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCGATCGGCCGAGGGC3 (0.000190%)
GGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTC85 (0.005384%)
GGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCT6 (0.000380%)
GGGCAATGTTGACAATCTCATCAAAAGTAATGTTCCCACTGTGTTTAATGTTCTTCTGCTTCTTCCTGTCTCTCGGTGGCTCCTTGAGGGCTTTGATGAT10 (0.000633%)
GGGCAGACTTGGTGACTTTGCCAGCTCCAGCAGCCTTCTTGTCCACAGCTTTGATGACACCCACAGCAACTGTCTGCCTCATGTCACGAACAGCAAAGCG3 (0.000190%)
GGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACT32 (0.002027%)
GGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGATTTAGTCGGCCTGGG3 (0.000190%)
GGGCCCTTCCCGTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGCGGGGCCTCGC9 (0.000570%)
GGGCCGCGGCCATGTGCAGCCCATTCGCTGCACGAACTGCGCCCGGTGCGTGCCCAAGGATAAGGCCATCAAGAAGTTTGTCATTCGGAACATTGTAGAA3 (0.000190%)
GGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTG15 (0.000950%)
GGGCCTTGGCCTCCTTCAGACAGGCAGAGGGCAGCAATCTGAACCCAGGGTGAGGAACCACAGAACAGAACAGCTGGACAAGCTCCAGCCAGGTCTCCCC6 (0.000380%)
GGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGCCCATCTTCTTGATGAGTTTCACCTCCTTATCCAGATAG10 (0.000633%)
GGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAG399 (0.025274%)
GGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACATTGCAGATGAGGCTCCCAATGTT3 (0.000190%)
GGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCAACCAACACCTTTTCTG3 (0.000190%)
GGGCTGCATTCCCAAGCAACCCGACTCCGGGAAGACCCGAGCCCGGCGCGCCGGGGGCCGCTACCGGCCTCACACCGTCCACGGGCTGGGCCTCGATCAG3 (0.000190%)
GGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGG4 (0.000253%)
GGGGAACAAGATTGGCAAGCCCCACACTGTTCCATGCAAGGTGACAGGCCGCTGTGGCTCTGTGCTGGTGCGTCTCATCCCTGCCCCCAGAGGCACTGGC4 (0.000253%)
GGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGA30 (0.001900%)
GGGGAAGGCTTCAGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACGGCTCTGGTAGTCCTCAGAG12 (0.000760%)
GGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTG221 (0.013999%)
GGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGC10 (0.000633%)
GGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAA42 (0.002660%)
GGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCT45 (0.002850%)
GGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTC23 (0.001457%)
GGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCAC18 (0.001140%)
GGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCC4 (0.000253%)
GGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCT14 (0.000887%)
GGGGGAACAAGATTGGCAAGCCCCACACTGTTCCATGCAAGGTGACAGGCCGCTGTGGCTCTGTGCTGGTGCGTCTCATCCCTGCCCCCAGAGGCACTGG5 (0.000317%)
GGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGG6 (0.000380%)
GGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCA90 (0.005701%)
GGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCA13 (0.000823%)
GGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACC25 (0.001584%)
GGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCC14 (0.000887%)
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG602 (0.015253%)
GGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCA28 (0.001774%)
GGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCG9 (0.000570%)
GGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCATCTACTCCGCCCTCATCC3 (0.000190%)
GGGGTTTAGTAAACAGGGTGGAACTGTATAGGAAGACGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCA660 (0.041807%)
GGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGA23 (0.001457%)
GGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCA232 (0.014696%)
GGGTACCAAAATTCTTTATTTGAAGAAATGGTACAAATTAAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGC31 (0.001964%)
GGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCA6 (0.000380%)
GGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAGTC7 (0.000443%)
GGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAG7 (0.000443%)
GGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCC3 (0.000190%)
GGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGAT5 (0.000317%)
GGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGAGAGC26 (0.001647%)
GGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCATCTACTCCGCCCTCATCCT8 (0.000507%)
GGGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTG348 (0.022044%)
GGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACC8 (0.000507%)
GGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGG3 (0.000190%)
GGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGC31 (0.001964%)
GGGTTTAGTAAACAGGGTGGAACTGTATAGGAAGACGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCAC31 (0.001964%)
GGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAA4 (0.000253%)
GGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCA36 (0.002280%)
GGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCAT4 (0.000253%)
GGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGG6 (0.000380%)
GGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTG7 (0.000443%)
GGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATG9 (0.000570%)
GGTCCACAACATTCTTTCCTTCTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTT6 (0.000380%)
GGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTC9 (0.000570%)
GGTCGCGTTACCGCACTGGACGCCTCGCGGCGCCCATCTCCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCGATCGGCCGAGGGCAACGGA7 (0.000443%)
GGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCG3 (0.000190%)
GGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTC4 (0.000253%)
GGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGAGAGCT12 (0.000760%)
GGTGACTATTGCATTGTCTCCGGAATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATAT160 (0.010135%)
GGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCATCTACTCCGCCCTCATCCTG4 (0.000253%)
GGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGC11 (0.000697%)
GGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTT41 (0.002597%)
GGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTG10 (0.000633%)
GGTGGGCCTTGGCCTCCTTCAGACAGGCAGAGGGCAGCAATCTGAACCCAGGGTGAGGAACCACAGAACAGAACAGCTGGACAAGCTCCAGCCAGGTCTC10 (0.000633%)
GGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGA4 (0.000253%)
GGTTACAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAG10 (0.000633%)
GGTTATCCTAAAAGCATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTG8 (0.000507%)
GGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTCCTAGTCGTGCTTGAGAGTGAGGC13 (0.000823%)
GGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGG12 (0.000760%)
GGTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGA14 (0.000887%)
GGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTC11 (0.000697%)
GGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGAT4 (0.000253%)
GGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGC3 (0.000190%)
GGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGG21 (0.001330%)
GGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCC35 (0.002217%)
GGTTTAATAGCTGCTGAGATGGATTGTCTTGTCCTGCCGCCCTTTGCTGTGTGGGCAGTACTCTGAAGCAGGCAAATGGGTCTTAGGATCCCTCCCAGAA5 (0.000317%)
GGTTTAGTAAACAGGGTGGAACTGTATAGGAAGACGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACG22 (0.001394%)
GGTTTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCC8 (0.000507%)
GGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAA53 (0.003357%)
GTAAAGCGAATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCG19 (0.001204%)
GTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCA7 (0.000443%)
GTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAAC12 (0.000760%)
GTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCAC9 (0.000570%)
GTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATG15 (0.000950%)
GTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTT32 (0.002027%)
GTACAAATTAAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCAC6 (0.000380%)
GTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACCGTCTCTT6 (0.000380%)
GTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGT7 (0.000443%)
GTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCATCGAAAGTTGATAGG5 (0.000317%)
GTAGGTCTTCCTTTTCTCTTTATTAGAAATGGCAGCATCGATCTTCTTCACGGTTGCAGGGAGACCCAGGGTGTGAATGCTTTTAGGATAACCTGCTAGC3 (0.000190%)
GTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGG10 (0.000633%)
GTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAG5 (0.000317%)
GTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGT19 (0.001204%)
GTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTTGC3 (0.000190%)
GTATCCCATGAGCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAACTTGAAGGCTAACAAAATCTGTGTTCAAAAGCTG4 (0.000253%)
GTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAG6 (0.000380%)
GTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATAT38 (0.002407%)
GTATTTATTCAGCACATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAAC12 (0.000760%)
GTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGG89 (0.005638%)
GTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGG40 (0.002534%)
GTCAAAGGTGATGCACACCTCTGTGATGCTCCCGGGCTGGAAGGGGAAGGCAGGTTCCCGGTGTTCGGTTCCCCAGGTCCCATCTTCCTTGGTGTTACAC117 (0.007411%)
GTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGC29 (0.001837%)
GTCACACAGCCCACATAGCATGCAAGTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTGGTAAGAAGCTGGAAGATGGCCCCAAGTTCCTGAAGTC5 (0.000317%)
GTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCA9 (0.000570%)
GTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAGCAGGAGCAGCAGCTC17 (0.001077%)
GTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTGCTCTACAAGAGGTGCTGAAGACCGCCCTCAT5 (0.000317%)
GTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCAT6 (0.000380%)
GTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATT65 (0.004117%)
GTCAGAATCCCGCCCAGGCGGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCC22 (0.001394%)
GTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAACTGGACCCATCTTTGGCTGTCAACTCCCAGGATCAAGATGCAAAGA9 (0.000570%)
GTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTC49 (0.003104%)
GTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGG34 (0.002154%)
GTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCA30 (0.001900%)
GTCATATATTAAATGTGTGTATCCCATGAGCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAACTTGAAGGCTAACAAA10 (0.000633%)
GTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGA20 (0.001267%)
GTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCA11 (0.000697%)
GTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGGGTCGGAG7 (0.000443%)
GTCCACAACATTCTTTCCTTCTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTC26 (0.001647%)
GTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCC52 (0.003294%)
GTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTT21 (0.001330%)
GTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACAT112 (0.007094%)
GTCCGCACCAGTTCTAAGTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGAC834 (0.052829%)
GTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCA57 (0.003611%)
GTCCTCTTGCTCCTTCCTGCTCACCTTCAGGCCTTTGCCAGGCCAGAGTTGGAGGGGCAGTAGAACGTGGTGCCATCCCCAAGCTGGGTGATGGGTCTGG16 (0.001013%)
GTCCTGAGTACCTTCTCCTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAA321 (0.030093%)
GTCCTTCCGAGGAAGCTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAG13 (0.000823%)
GTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGG160 (0.015000%)
GTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCAACCGCC74 (0.004687%)
GTCGCGCCAAAAAGGGCCGCGGCCATGTGCAGCCCATTCGCTGCACGAACTGCGCCCGGTGCGTGCCCAAGGATAAGGCCATCAAGAAGTTTGTCATTCG242 (0.015329%)
GTCGCGTTACCGCACTGGACGCCTCGCGGCGCCCATCTCCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCGATCGGCCGAGGGCAACGGAG13 (0.000823%)
GTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGC303 (0.019193%)
GTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCGCC377 (0.023881%)
GTCGGCATCGTCGGCAAGTACGGGACCCGCTATGGTGCCTCCCTCCGGAAAATGGTGAAGAAAATTGAAATCAGCCAGCACGCCAAGTACACTTGCTCCT16 (0.001013%)
GTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCAC72 (0.004561%)
GTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCG35 (0.002217%)
GTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCG16 (0.001013%)
GTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGG12 (0.000760%)
GTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATG6 (0.000380%)
GTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAA23 (0.001457%)
GTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCG15 (0.000950%)
GTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCAC55 (0.003484%)
GTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGA14 (0.000887%)
GTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGG22 (0.001394%)
GTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGAC14 (0.000887%)
GTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGT7 (0.000443%)
GTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATG10 (0.000633%)
GTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTG3 (0.000190%)
GTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCC99 (0.006271%)
GTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAA16 (0.001013%)
GTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCA6 (0.000380%)
GTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGA41 (0.002597%)
GTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGAGAGCTAAGCTGACT17 (0.001077%)
GTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGTGATGAGAGCTA6 (0.000380%)
GTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTC9 (0.000570%)
GTGACTATTGCATTGTCTCCGGAATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATG10 (0.000633%)
GTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAA6 (0.000380%)
GTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGGGTGGCGGGGCCACAACC16 (0.001013%)
GTGACTTTGCCAGCTCCAGCAGCCTTCTTGTCCACAGCTTTGATGACACCCACAGCAACTGTCTGCCTCATGTCACGAACAGCAAAGCGACCAAGTGGAG3 (0.000190%)
GTGAGCTCCCTCCCGGCTCCGGCCGGGGGTCGGGCGCCGGCGGCTTTGGTGACTCTAGATAACCTCGGGCCGATCGCACGCCCCCCGTGGCGGCGACGAC10 (0.000633%)
GTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCATCTACTCCGCCCTCATCCTGC6 (0.000380%)
GTGAGGCGCTCAAAGAGATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTCAGATGGTTGC4 (0.000253%)
GTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCAACCAACACCTTTTCTGGGGTCTGATGAGCGTCGGC11 (0.000697%)
GTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTGCTCTACAAGAGGTGCTGAAGACCGCCCTCATCCACGAT6 (0.000380%)
GTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTGGCCATGGAGAAGAACCTGAATCA48 (0.003040%)
GTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTT29 (0.001837%)
GTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCCGTGGG662 (0.041934%)
GTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGT6 (0.000380%)
GTGCGTTCAAGATTCGGCGTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTGCTCTACAAGAGGT9 (0.000570%)
GTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCC32 (0.002027%)
GTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCC10 (0.000633%)
GTGCTTGAGAGTGAGGCGCTCAAAGAGATACTCGCCCAGAGACCCCTGGGGCGCGCCAGTCTGCGCTGGTTGTGGCCCCGCCACCCTGCGGAGGTTGGTC26 (0.001647%)
GTGGAACCATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGT34 (0.002154%)
GTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTG22 (0.001394%)
GTGGAGAACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCT19 (0.001204%)
GTGGATCGCCTCAGCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTGCCGGCGCGGGTCCCCTCCCCGCGGGGCCTCGCTCCACCCCCCC6 (0.000380%)
GTGGATCTGTGTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAG448 (0.028378%)
GTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAG9 (0.000570%)
GTGGCCCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCC3 (0.000190%)
GTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGT19 (0.001204%)
GTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGG16 (0.001013%)
GTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCTCTTTTCTTTGTGAAG3 (0.000190%)
GTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCC56 (0.003547%)
GTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTCCTAGTCGTGCTT11 (0.000697%)
GTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGC47 (0.002977%)
GTGGGCCTTGGCCTCCTTCAGACAGGCAGAGGGCAGCAATCTGAACCCAGGGTGAGGAACCACAGAACAGAACAGCTGGACAAGCTCCAGCCAGGTCTCC16 (0.001013%)
GTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCA6 (0.000380%)
GTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCG41 (0.002597%)
GTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCACCCTTGAG10 (0.000633%)
GTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGAT5 (0.000317%)
GTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGA4 (0.000253%)
GTGTCTTGCTTCAACAGTGTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGG5 (0.000317%)
GTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGT65 (0.004117%)
GTGTTTAATGTTCTTCTGCTTCTTCCTGTCTCTCGGTGGCTCCTTGAGGGCTTTGATGATCAGGGCTGAGGCAGAAGGCACCACCTCGATCTGGGCCTGT3 (0.000190%)
GTTACAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGG15 (0.000950%)
GTTACCGCACTGGACGCCTCGCGGCGCCCATCTCCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCGATCGGCCGAGGGCAACGGAGGCCAT5 (0.000317%)
GTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAACTGGACCCATCTTTGGCTGTCAACTCCCAGG5 (0.000317%)
GTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGACCGTTCTTCCACCACTGATTAAGACTGGGGTGGCAG19 (0.001204%)
GTTATCCTAAAAGCATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGT10 (0.000633%)
GTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCT35 (0.002217%)
GTTCAAGATTCGGCGTCACCCGTGATTCACCGCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGGACGTCAACACTGCTCTACAAGAGGTGCTG7 (0.000443%)
GTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGC30 (0.001900%)
GTTCAGACACTTGTTTGTGGCCCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACG19 (0.001204%)
GTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAG10 (0.000633%)
GTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCT28 (0.001774%)
GTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCCTCCTAGTCGTGCTTGAGAGTGAGGCG51 (0.003231%)
GTTCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCC18 (0.001140%)
GTTCCAGCACATTTTGCGAGTACTCAACACCAACATCGATGGGCGGCGGAAAATAGCCTTCGCCATCACTGCCATTAAGGGCGTGGGGCGGAGATATGCT3 (0.000190%)
GTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATC16 (0.001013%)
GTTCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTGAACACTCTAATTTTTTCA15 (0.000950%)
GTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAG12 (0.000760%)
GTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAAAGGC8 (0.000507%)
GTTCGATTCCTTCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAA121 (0.007665%)
GTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAGCAGGAGCAGCA10 (0.000633%)
GTTCTAAGTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTC28 (0.001774%)
GTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCA13 (0.000823%)
GTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATC19 (0.001204%)
GTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAA11 (0.000697%)
GTTCTGGCGGATGCTCTCAAGAGCATCAACAACGCTGAGAAGAGAGGCAAACGCCAGGTCCTCATCAGGCCATGTTCTAAAGTCATCGTTCGGTTCTTAA8 (0.000507%)
GTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCC11 (0.000697%)
GTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAA34 (0.002154%)
GTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCAACCAACACCTTTTCTGGGGTCT14 (0.000887%)
GTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTT20 (0.001267%)
GTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGC6 (0.000380%)
GTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGCCCCCTCGATGCTCTTAGCTGAGTG24 (0.001520%)
GTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCA6 (0.000380%)
GTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCATCTACTCCGCCCTCA11 (0.000697%)
GTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGC16 (0.001013%)
GTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATACTGATATTACTTCTCGTTTTGAAGCAA11 (0.000697%)
GTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCT51 (0.003231%)
GTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCAT23 (0.001457%)
GTTTAATAGCTGCTGAGATGGATTGTCTTGTCCTGCCGCCCTTTGCTGTGTGGGCAGTACTCTGAAGCAGGCAAATGGGTCTTAGGATCCCTCCCAGAAA24 (0.001520%)
GTTTAATGTTCTTCTGCTTCTTCCTGTCTCTCGGTGGCTCCTTGAGGGCTTTGATGATCAGGGCTGAGGCAGAAGGCACCACCTCGATCTGGGCCTGTCT7 (0.000443%)
GTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTAT180 (0.011402%)
GTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAAACCCAGGAGGCCATGGAAGCTGCCTTG7 (0.000443%)
GTTTCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCG65 (0.004117%)
GTTTCGGCGTTGTTCCCTCACGGAATCCATGTCTGAATCTGCGGTAGACAATCTTTAGGTGCCTCATCCGACCAGTCCCGGTAGTGTTTCGTCTCTTAGC56 (0.003547%)
GTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCATCGAAAGTTGATAGGGCAGAC10 (0.000633%)
GTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGA8 (0.000507%)
GTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAA168 (0.010642%)
GTTTGAACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCT14 (0.000887%)
GTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCA30 (0.001900%)
GTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTT17 (0.001077%)
GTTTGTGGCCCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTC10 (0.000633%)
GTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGACCGTTCTTCCACCACTGATTA5 (0.000317%)
GTTTTCGAAATATTTTAGTGGAACCATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGT286 (0.018116%)
GTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAACTGGACCCATCTTTGGCTGTCA65 (0.004117%)
GTTTTTCCTGGGGGAAGGCTTCAGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACGGCTCTGGTA31 (0.001964%)
TAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGCCCCCTCGATGC48 (0.003040%)
TAAAAGCATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGAC15 (0.000950%)
TAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCA7 (0.000443%)
TAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCACACCCTGGGACACGGT27 (0.001710%)
TAAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTT20 (0.001267%)
TAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCT12 (0.000760%)
TAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCAC3 (0.000190%)
TAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGT9 (0.000570%)
TAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTTGCCTCTCG26 (0.001647%)
TAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGA6 (0.000380%)
TAACAATTAAACCAGCTATTGCTCTTCAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACC6 (0.000380%)
TAACGAACGAGACTCTGGCATGCTAACTAGTTACGCGACCCCCGAGCGGTCGGCGTCCCCCAACTTCTTAGAGGGACAAGTGGCGTTCAGCCACCCGAGA7 (0.000443%)
TAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGAT8 (0.000507%)
TAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACG11 (0.000697%)
TAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCGCCGGCAGTCGGAAC11 (0.000697%)
TAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGCTTGCATCTACT4 (0.000253%)
TAAGTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCC8 (0.000507%)
TAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGC4 (0.000253%)
TAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACC6 (0.000380%)
TACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTT24 (0.001520%)
TACAAAGCTGCCTAGTGGCTTGAGAGGTTCATTCAGGTGGAGGTCCCAGGGCGGGCTGGTGCAGAGCAGAGGGGGGAGCCCCTTGGAAGGTACAGAGGCC17 (0.001077%)
TACAAATTAAAGAACTTAAGCAGATGTTTTGGTGCAACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACG51 (0.003231%)
TACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCC8 (0.000507%)
TACACAGCAAGCAGTCATATATTAAATGTGTGTATCCCATGAGCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAACTT7 (0.000443%)
TACACAGTTCAGACACTTGTTTGTGGCCCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAAC10 (0.000633%)
TACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTCGGGGCGAA7 (0.000443%)
TACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGC12 (0.000760%)
TACCACCAGGACGCGGAGGCTGCCATCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATG25 (0.001584%)
TACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCT3 (0.000190%)
TACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACC28 (0.001774%)
TACGGATCCGGCTTGCCGACTTCCCTTACCTACATTGTTCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGC5 (0.000317%)
TACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCGTCCCCGCGGCGGCGCGGGG3 (0.000190%)
TACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGC4 (0.000253%)
TACTACACAGCAAGCAGTCATATATTAAATGTGTGTATCCCATGAGCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAA6 (0.000380%)
TACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAG3 (0.000190%)
TACTCCCCCCGGAACCCAAAGACTTTGGTTTCCCGGAAGCTGCCCGGCGGGTCATGGGAATAACGCCGCCGCATCGCCAGTCGGCATCGTTTATGGTCGG3 (0.000190%)
TACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGG5 (0.000317%)
TACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAG12 (0.000760%)
TACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGA3 (0.000190%)
TACTGGGTGGGCCTTGGCCTCCTTCAGACAGGCAGAGGGCAGCAATCTGAACCCAGGGTGAGGAACCACAGAACAGAACAGCTGGACAAGCTCCAGCCAG3 (0.000190%)
TAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCA4 (0.000253%)
TAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGG54 (0.003421%)
TAGAGCCAATCCTTATCCCGAAGTTACGGATCCGGCTTGCCGACTTCCCTTACCTACATTGTTCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCT9 (0.000570%)
TAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGC16 (0.001013%)
TAGCAGGTTATCCTAAAAGCATTCACACCCTGGGTCTCCCTGCAACCGTGAAGAAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTT22 (0.001394%)
TAGCATGCAAGTTTGCTGAGCTTAAAGAAAAGATCGATCGTCGTTCTGGTAAGAAGCTGGAAGATGGCCCCAAGTTCCTGAAGTCTGGCGATGCTGCCAT13 (0.000823%)
TAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTC6 (0.000380%)
TAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACTGTTGCTTGATTTAGT3 (0.000190%)
TAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCACACGCGCGGG26 (0.001647%)
TAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCC34 (0.002154%)
TAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTT137 (0.008678%)
TAGTAAACAGGGTGGAACTGTATAGGAAGACGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCA86 (0.005448%)
TAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGC3 (0.000190%)
TAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGG5 (0.000317%)
TAGTGATCCCTGAGAAGTTCCAGCACATTTTGCGAGTACTCAACACCAACATCGATGGGCGGCGGAAAATAGCCTTCGCCATCACTGCCATTAAGGGCGT4 (0.000253%)
TAGTGGAACCATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGTTTGATGTTACT12 (0.000760%)
TATAAAACCAGTACAGCTCTTCATACTTGGTTGAGGTACACAAAGCATAAAAATCCTATTGAAAAAGCATCGGCTGAGGACAGGACCAAGGAGAGCTGGC231 (0.014632%)
TATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTG31 (0.001964%)
TATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGAGTCG4 (0.000253%)
TATAGAAAAAGTTGTGGAGAACGAGTCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTC4 (0.000253%)
TATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTG3 (0.000190%)
TATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGACCGTTCTTCCACCACTGATTAAGACTGGGGTGGCAGGT6 (0.000380%)
TATCCCATGAGCTAAACCTTAATCCATTTTTACATTCAAGTTAAGACAATTCAGCACCGTTTAAACTTGAAGGCTAACAAAATCTGTGTTCAAAAGCTGG3 (0.000190%)
TATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCT3 (0.000190%)
TATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCG28 (0.001774%)
TATGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGAGTCGTTCTGCCAA7 (0.000443%)
TATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGG20 (0.001267%)
TATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGG23 (0.001457%)
TATGGGCCCGACGCTCCAGCGCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACC3 (0.000190%)
TATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAG6 (0.000380%)
TATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTG10 (0.000633%)
TATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCCGTCCCCGCCCCTTGCCTC5 (0.000317%)
TATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATC30 (0.001900%)
TATTCAGCACATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAG5 (0.000317%)
TATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGG3 (0.000190%)
TATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACG5 (0.000317%)
TATTGCTCTTCAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGAC13 (0.000823%)
TATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCAC25 (0.001584%)
TATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAG9 (0.000570%)
TATTTATTCAGCACATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACA18 (0.001140%)
TATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGT28 (0.001774%)
TATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGC6 (0.000380%)
TCAAAACCAACCCGGTGAGCTCCCTCCCGGCTCCGGCCGGGGGTCGGGCGCCGGCGGCTTTGGTGACTCTAGATAACCTCGGGCCGATCGCACGCCCCCC4 (0.000253%)
TCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGTGCCGTTCCG3 (0.000190%)
TCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTG4 (0.000253%)
TCAAAGGCCCCTACTGGTTTAATAGCTGCTGAGATGGATTGTCTTGTCCTGCCGCCCTTTGCTGTGTGGGCAGTACTCTGAAGCAGGCAAATGGGTCTTA12 (0.000760%)
TCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGC8 (0.000507%)
TCAACCGCCAGATCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAA17 (0.001077%)
TCAACCTGGAGTTGTATGCCTCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCA15 (0.000950%)
TCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCT3 (0.000190%)
TCAATATGTGGGTCACTTTTTTGGCATTTGGGTCAAATTCCAACTGCGAAGATCCACTGAAGAAGTAGAGAAACCCAAATGCTTCAAAGACAGCATCCAC7 (0.000443%)
TCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCG3 (0.000190%)
TCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATT20 (0.001267%)
TCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTA10 (0.000633%)
TCAGACACTTGTTTGTGGCCCAGGAGTGCCTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTT6 (0.000380%)
TCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAG3 (0.000190%)
TCAGCACATTGGGATGTTTAGGGATCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAA30 (0.001900%)
TCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCC6 (0.000380%)
TCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCTTG3 (0.000190%)
TCAGGGTTGTACAAAAAAGGCTAGGCTTCTACATGGTCTATTTACACAGATGTGGGGACCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGA41 (0.002597%)
TCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCAC16 (0.001013%)
TCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCC19 (0.001204%)
TCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGC3 (0.000190%)
TCAGTTCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTGAACACTCTAATTTTT18 (0.001140%)
TCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACAT8 (0.000507%)
TCAGTTTTTCCTGGGGGAAGGCTTCAGGTCATCGGGCCCCAAGGGATCTCCAGGTGCACAAGCCTGGATTCCGTGGCAGGCAAGCAAAGTGACGGCTCTG9 (0.000570%)
TCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTTGCCAATGAGTGGGGCCGGAGTGGCAA3 (0.000190%)
TCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCG5 (0.000317%)
TCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACA7 (0.000443%)
TCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGAC7 (0.000443%)
TCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCC7 (0.000443%)
TCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTC19 (0.001204%)
TCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACGGCCCGGCGCGAGATTTACACCCTCTCCCCCGGATTTTCAAGGGCCAG4 (0.000253%)
TCCACAACATTCTTTCCTTCTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCT4 (0.000253%)
TCCACAACCAAATGACTGTTTCTTCGCGCTAATATTTGGCTCCTCGGCGCTGCCTGAAGTAGCGGTTGTAGGCAGCGTTGTAGCCGTAGACCATGGCGTA3 (0.000190%)
TCCACTTTCTTCTCCTCAGCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCACCAGCCCCTACAT9 (0.000570%)
TCCAGATTTTAGAAAATATCTCAACCCAGTAGTTGCTCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGC9 (0.000570%)
TCCAGCGCCATCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTAT7 (0.000443%)
TCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGCTGCCATCA21 (0.001330%)
TCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGTCACCGCCC35 (0.002217%)
TCCAGTAGTGACTGATTCACACTCTTTTCCAAGTGCAGTGCACACTCCATTGCATTCAGCCCGCTCTCCCAGTCATCACGGTCTGGTTTCTTTATATCCT6 (0.000380%)
TCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGAACTGGACCCATCTTTGGCTGTCAACTCC7 (0.000443%)
TCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCA9 (0.000570%)
TCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCAC4 (0.000253%)
TCCATTTTCAGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTCCGACTTCCATGGCCACCGTCCTGCTGTCTATATCAACCAAC7 (0.000443%)
TCCCAAGCAACCCGACTCCGGGAAGACCCGAGCCCGGCGCGCCGGGGGCCGCTACCGGCCTCACACCGTCCACGGGCTGGGCCTCGATCAGAAGGACTTG3 (0.000190%)
TCCCAATAAATATTAGTTTAATGAAATATTTTAAGCCTACCCATCTTTAAACTGAACAAGCAGAACTGAACTACCATCGATGAAATGTATCCACACTGTT3 (0.000190%)
TCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTAGGACCAGTCTGCACC14 (0.000887%)
TCCCACTGTGTTTAATGTTCTTCTGCTTCTTCCTGTCTCTCGGTGGCTCCTTGAGGGCTTTGATGATCAGGGCTGAGGCAGAAGGCACCACCTCGATCTG11 (0.000697%)
TCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCGCAG5 (0.000317%)
TCCCCCCGGAACCCAAAGACTTTGGTTTCCCGGAAGCTGCCCGGCGGGTCATGGGAATAACGCCGCCGCATCGCCAGTCGGCATCGTTTATGGTCGGAAC4 (0.000253%)
TCCCCCGGATTTTCAAGGGCCAGCGAGAGCTCACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGCACGGGCCCCTCTCTCGGGGCGAACCCATTCCA5 (0.000317%)
TCCCGAAGTTACGGATCCGGCTTGCCGACTTCCCTTACCTACATTGTTCCAACATGCCAGAGGCTGTTCACCTTGGAGACCTGCTGCGGATATGGGTACG3 (0.000190%)
TCCCGCCCAGGCGGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGGTCCCCGTCCGTCCCCGCTCGGCGGGGTCCCCGCGTCG3 (0.000190%)
TCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAGTTCACGGGACATGGAGCAGAGGACTCAAGAGCTGACCAGTTT7 (0.000443%)
TCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGG39 (0.002470%)
TCCGAAAACCAACAAAATAGAACCGCGGTCCTATTCCATTATTCCTAGCTGCGGTATCCAGGCGGCTCGGGCCTGCTTTGAACACTCTAATTTTTTCAAA6 (0.000380%)
TCCGAGGAAGCTAAGGCCGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGCACCGTGCCGGCAGTCTACAGCATGGCTTCCGTCTCCGAGCTCGC4 (0.000253%)
TCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATT15 (0.000950%)
TCCGCACCAGTTCTAAGTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACG12 (0.000760%)
TCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAGGACGCGGAGGC5 (0.000317%)
TCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCTCTTTTCTTT7 (0.000443%)
TCCGGCCCCACTCATTGGCAAACTGGTCAGCTCTTGAGTCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGC16 (0.001013%)
TCCTACGTCTATCTGTCTATGTCTTGTTATTTTGACCGAGATGATGTGGCTCTGAAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGG14 (0.000887%)
TCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCAT14 (0.000887%)
TCCTCTGCTCCATGTCCCGTGAACTTCTGAACAGCCTCTCTGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCAT16 (0.001013%)
TCCTCTTCTCGGGGGGCAGCATGACTGGGAACAACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCA31 (0.001964%)
TCCTCTTGCTCCTTCCTGCTCACCTTCAGGCCTTTGCCAGGCCAGAGTTGGAGGGGCAGTAGAACGTGGTGCCATCCCCAAGCTGGGTGATGGGTCTGGG8 (0.000507%)
TCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAA20 (0.001267%)
TCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACT11 (0.000697%)
TCCTGCTTCAACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCG25 (0.001584%)
TCCTGGGAAATCCTGGCTCCATGGATTGTTTCTTCTCATCAAACCTCCAGTATTTGTCCTCTACAAAGAAGTAGGTCTTCCTTTTCTCTTTATTAGAAAT8 (0.000507%)
TCCTTCACCAACATGCAAGTTCTTTTCCCTCTCTGCTAGCCAGACCATCAGATGGGTGGGAGAGGCAGGGGAGGCCTTCCTGCTCAGTAGTTCTGATTCT56 (0.003547%)
TCCTTCTGAAGGTTTTACGATGCATTGTTATCATTAACCAGTCTTTTACTATTAAACTTAAATGGCCAATTGAGACAAACAGTTCTGAGACCGTTCTTCC10 (0.000633%)
TCCTTCTTTGCCTCCACTTTCTTCTCCTCAGCTGGGGCGGCGGCAGTGGATGGAGCAGCACCACCAGCAGGCGCAGCTCCAGCTGCTGGAGCGGGCCCAC5 (0.000317%)
TCCTTTCACAAAGACTCAGATGAAGAACTATAAGCATCAGTTAAAACACAGGATGCCTTCCTTGGATCTCTTTTTAACAATTAAACCAGCTATTGCTCTT14 (0.000887%)
TCCTTTCTTATTTTACTTTTACATAGGTTGGTTCCTCGAATGTGTGATATGGTGGAGGGCAGCCATGAAGTCATTCTAAATTTGTTGAAGCATACGATAC3 (0.000190%)
TCGAAAGGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGC10 (0.000633%)
TCGAAATATTTTAGTGGAACCATTTCTAGGACAATGGGCATAAAGCTATGGTTAGATCCACAAATTTCAGAGCATTGGCCATAGAATAACCCTGGTCGGT5 (0.000317%)