fastp report
General
fastp version:0.23.1 (https://github.com/OpenGene/fastp)
sequencing:paired end (150 cycles + 150 cycles)
mean length before filtering:150bp, 150bp
mean length after filtering:143bp, 142bp
duplication rate:18.951886%
Insert size peak:262
Before filtering
total reads:41.048664 M
total bases:6.157300 G
Q20 bases:5.973286 G (97.011461%)
Q30 bases:5.689995 G (92.410565%)
GC content:51.468477%
After filtering
total reads:40.720034 M
total bases:5.820110 G
Q20 bases:5.680296 G (97.597757%)
Q30 bases:5.422950 G (93.176075%)
GC content:51.322003%
Filtering result
reads passed filters:40.720034 M (99.199414%)
reads with low quality:298.048000 K (0.726085%)
reads with too many N:10.688000 K (0.026037%)
reads too short:19.894000 K (0.048464%)
Adapter or bad ligation of read1
SequenceOccurrences
A22671
AG23926
AGA25877
AGAT23660
AGATC23159
AGATCG24920
AGATCGG23101
AGATCGGA21237
AGATCGGAA21147
AGATCGGAAG21299
AGATCGGAAGA20023
AGATCGGAAGAG21021
AGATCGGAAGAGC21352
AGATCGGAAGAGCA21873
AGATCGGAAGAGCAC24432
AGATCGGAAGAGCACA23363
AGATCGGAAGAGCACAC20278
AGATCGGAAGAGCACACG18898
AGATCGGAAGAGCACACGT18224
AGATCGGAAGAGCACACGTC17587
AGATCGGAAGAGCACACGTCT18746
AGATCGGAAGAGCACACGTCTG18954
AGATCGGAAGAGCACACGTCTGA19589
AGATCGGAAGAGCACACGTCTGAA18982
AGATCGGAAGAGCACACGTCTGAAC19875
AGATCGGAAGAGCACACGTCTGAACT19343
AGATCGGAAGAGCACACGTCTGAACTC19147
AGATCGGAAGAGCACACGTCTGAACTCC17567
AGATCGGAAGAGCACACGTCTGAACTCCA16465
AGATCGGAAGAGCACACGTCTGAACTCCAG15134
AGATCGGAAGAGCACACGTCTGAACTCCAGT15201
AGATCGGAAGAGCACACGTCTGAACTCCAGTC17394
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA17897
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC16154
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACG15510
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGT16041
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTT14520
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTA14976
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTAC16260
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTACA14972
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTACAC14132
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTACACT16921
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTACACTG20146
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTACACTGC14018
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTACACTGCA51238
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTACACTGCAT14684
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTACACTGCATC12129
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTACACTGCATCT15825
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTACACTGCATCTC25394
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTACACTGCATCTCGT13698
other adapter sequences213526
Adapter or bad ligation of read2
SequenceOccurrences
A24030
AG24941
AGA26133
AGAT23901
AGATC24976
AGATCG34095
AGATCGG22256
AGATCGGA21426
AGATCGGAA17213
AGATCGGAAG18542
AGATCGGAAGA16858
AGATCGGAAGAG25183
AGATCGGAAGAGC20894
AGATCGGAAGAGCG20946
AGATCGGAAGAGCGT33336
AGATCGGAAGAGCGTC18869
AGATCGGAAGAGCGTCG29192
AGATCGGAAGAGCGTCGT19734
AGATCGGAAGAGCGTCGTG15817
AGATCGGAAGAGCGTCGTGTAG19949
AGATCGGAAGAGCGTCGTGTAGG29036
AGATCGGAAGAGCGTCGTGTAGGG21440
AGATCGGAAGAGCGTCGTGTAGGGA15818
AGATCGGAAGAGCGTCGTGTAGGGAAAGAG12904
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGT12427
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG17344
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT20736
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTG14405
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGA15475
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGATG12415
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGATGTGT12079
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGATGTGTCGTGTG14252
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGATGTGTCGTGTGTAGATCTCGGT12495
other adapter sequences537164
This estimation is based on paired-end overlap analysis, and there are 57.950605% reads found not overlapped.
The nonoverlapped read pairs may have insert size <30 or >270, or contain too much sequencing errors to be detected as overlapped.
Value of each position will be shown on mouse over.
Value of each position will be shown on mouse over.
Darker background means larger counts. The count will be shown on mouse over.
AAATACAGTATTTCTGCACTCCCGGAGTGCGG
AAAAAAAAAAAATAAAACAAAAGAAATAAAATTAAATCAAATGAAACAAAACTAAACCAAACGAAAGAAAAGTAAAGCAAAGG
AATAATAAAATATAATACAATAGAATTAAATTTAATTCAATTGAATCAAATCTAATCCAATCGAATGAAATGTAATGCAATGG
AACAACAAAACATAACACAACAGAACTAAACTTAACTCAACTGAACCAAACCTAACCCAACCGAACGAAACGTAACGCAACGG
AAGAAGAAAAGATAAGACAAGAGAAGTAAAGTTAAGTCAAGTGAAGCAAAGCTAAGCCAAGCGAAGGAAAGGTAAGGCAAGGG
ATAATAAAATAATATAACATAAGATATAATATTATATCATATGATACAATACTATACCATACGATAGAATAGTATAGCATAGG
ATTATTAAATTATATTACATTAGATTTAATTTTATTTCATTTGATTCAATTCTATTCCATTCGATTGAATTGTATTGCATTGG
ATCATCAAATCATATCACATCAGATCTAATCTTATCTCATCTGATCCAATCCTATCCCATCCGATCGAATCGTATCGCATCGG
ATGATGAAATGATATGACATGAGATGTAATGTTATGTCATGTGATGCAATGCTATGCCATGCGATGGAATGGTATGGCATGGG
ACAACAAAACAATACAACACAAGACATAACATTACATCACATGACACAACACTACACCACACGACAGAACAGTACAGCACAGG
ACTACTAAACTATACTACACTAGACTTAACTTTACTTCACTTGACTCAACTCTACTCCACTCGACTGAACTGTACTGCACTGG
ACCACCAAACCATACCACACCAGACCTAACCTTACCTCACCTGACCCAACCCTACCCCACCCGACCGAACCGTACCGCACCGG
ACGACGAAACGATACGACACGAGACGTAACGTTACGTCACGTGACGCAACGCTACGCCACGCGACGGAACGGTACGGCACGGG
AGAAGAAAAGAATAGAACAGAAGAGATAAGATTAGATCAGATGAGACAAGACTAGACCAGACGAGAGAAGAGTAGAGCAGAGG
AGTAGTAAAGTATAGTACAGTAGAGTTAAGTTTAGTTCAGTTGAGTCAAGTCTAGTCCAGTCGAGTGAAGTGTAGTGCAGTGG
AGCAGCAAAGCATAGCACAGCAGAGCTAAGCTTAGCTCAGCTGAGCCAAGCCTAGCCCAGCCGAGCGAAGCGTAGCGCAGCGG
AGGAGGAAAGGATAGGACAGGAGAGGTAAGGTTAGGTCAGGTGAGGCAAGGCTAGGCCAGGCGAGGGAAGGGTAGGGCAGGGG
TAATAAAATAAATTAAACTAAAGTAATATAATTTAATCTAATGTAACATAACTTAACCTAACGTAAGATAAGTTAAGCTAAGG
TATTATAATATATTATACTATAGTATTATATTTTATTCTATTGTATCATATCTTATCCTATCGTATGATATGTTATGCTATGG
TACTACAATACATTACACTACAGTACTATACTTTACTCTACTGTACCATACCTTACCCTACCGTACGATACGTTACGCTACGG
TAGTAGAATAGATTAGACTAGAGTAGTATAGTTTAGTCTAGTGTAGCATAGCTTAGCCTAGCGTAGGATAGGTTAGGCTAGGG
TTATTAAATTAATTTAACTTAAGTTATATTATTTTATCTTATGTTACATTACTTTACCTTACGTTAGATTAGTTTAGCTTAGG
TTTTTTAATTTATTTTACTTTAGTTTTATTTTTTTTTCTTTTGTTTCATTTCTTTTCCTTTCGTTTGATTTGTTTTGCTTTGG
TTCTTCAATTCATTTCACTTCAGTTCTATTCTTTTCTCTTCTGTTCCATTCCTTTCCCTTCCGTTCGATTCGTTTCGCTTCGG
TTGTTGAATTGATTTGACTTGAGTTGTATTGTTTTGTCTTGTGTTGCATTGCTTTGCCTTGCGTTGGATTGGTTTGGCTTGGG
TCATCAAATCAATTCAACTCAAGTCATATCATTTCATCTCATGTCACATCACTTCACCTCACGTCAGATCAGTTCAGCTCAGG
TCTTCTAATCTATTCTACTCTAGTCTTATCTTTTCTTCTCTTGTCTCATCTCTTCTCCTCTCGTCTGATCTGTTCTGCTCTGG
TCCTCCAATCCATTCCACTCCAGTCCTATCCTTTCCTCTCCTGTCCCATCCCTTCCCCTCCCGTCCGATCCGTTCCGCTCCGG
TCGTCGAATCGATTCGACTCGAGTCGTATCGTTTCGTCTCGTGTCGCATCGCTTCGCCTCGCGTCGGATCGGTTCGGCTCGGG
TGATGAAATGAATTGAACTGAAGTGATATGATTTGATCTGATGTGACATGACTTGACCTGACGTGAGATGAGTTGAGCTGAGG
TGTTGTAATGTATTGTACTGTAGTGTTATGTTTTGTTCTGTTGTGTCATGTCTTGTCCTGTCGTGTGATGTGTTGTGCTGTGG
TGCTGCAATGCATTGCACTGCAGTGCTATGCTTTGCTCTGCTGTGCCATGCCTTGCCCTGCCGTGCGATGCGTTGCGCTGCGG
TGGTGGAATGGATTGGACTGGAGTGGTATGGTTTGGTCTGGTGTGGCATGGCTTGGCCTGGCGTGGGATGGGTTGGGCTGGGG
CAACAAAACAAATCAAACCAAAGCAATACAATTCAATCCAATGCAACACAACTCAACCCAACGCAAGACAAGTCAAGCCAAGG
CATCATAACATATCATACCATAGCATTACATTTCATTCCATTGCATCACATCTCATCCCATCGCATGACATGTCATGCCATGG
CACCACAACACATCACACCACAGCACTACACTTCACTCCACTGCACCACACCTCACCCCACCGCACGACACGTCACGCCACGG
CAGCAGAACAGATCAGACCAGAGCAGTACAGTTCAGTCCAGTGCAGCACAGCTCAGCCCAGCGCAGGACAGGTCAGGCCAGGG
CTACTAAACTAATCTAACCTAAGCTATACTATTCTATCCTATGCTACACTACTCTACCCTACGCTAGACTAGTCTAGCCTAGG
CTTCTTAACTTATCTTACCTTAGCTTTACTTTTCTTTCCTTTGCTTCACTTCTCTTCCCTTCGCTTGACTTGTCTTGCCTTGG
CTCCTCAACTCATCTCACCTCAGCTCTACTCTTCTCTCCTCTGCTCCACTCCTCTCCCCTCCGCTCGACTCGTCTCGCCTCGG
CTGCTGAACTGATCTGACCTGAGCTGTACTGTTCTGTCCTGTGCTGCACTGCTCTGCCCTGCGCTGGACTGGTCTGGCCTGGG
CCACCAAACCAATCCAACCCAAGCCATACCATTCCATCCCATGCCACACCACTCCACCCCACGCCAGACCAGTCCAGCCCAGG
CCTCCTAACCTATCCTACCCTAGCCTTACCTTTCCTTCCCTTGCCTCACCTCTCCTCCCCTCGCCTGACCTGTCCTGCCCTGG
CCCCCCAACCCATCCCACCCCAGCCCTACCCTTCCCTCCCCTGCCCCACCCCTCCCCCCCCCGCCCGACCCGTCCCGCCCCGG
CCGCCGAACCGATCCGACCCGAGCCGTACCGTTCCGTCCCGTGCCGCACCGCTCCGCCCCGCGCCGGACCGGTCCGGCCCGGG
CGACGAAACGAATCGAACCGAAGCGATACGATTCGATCCGATGCGACACGACTCGACCCGACGCGAGACGAGTCGAGCCGAGG
CGTCGTAACGTATCGTACCGTAGCGTTACGTTTCGTTCCGTTGCGTCACGTCTCGTCCCGTCGCGTGACGTGTCGTGCCGTGG
CGCCGCAACGCATCGCACCGCAGCGCTACGCTTCGCTCCGCTGCGCCACGCCTCGCCCCGCCGCGCGACGCGTCGCGCCGCGG
CGGCGGAACGGATCGGACCGGAGCGGTACGGTTCGGTCCGGTGCGGCACGGCTCGGCCCGGCGCGGGACGGGTCGGGCCGGGG
GAAGAAAAGAAATGAAACGAAAGGAATAGAATTGAATCGAATGGAACAGAACTGAACCGAACGGAAGAGAAGTGAAGCGAAGG
GATGATAAGATATGATACGATAGGATTAGATTTGATTCGATTGGATCAGATCTGATCCGATCGGATGAGATGTGATGCGATGG
GACGACAAGACATGACACGACAGGACTAGACTTGACTCGACTGGACCAGACCTGACCCGACCGGACGAGACGTGACGCGACGG
GAGGAGAAGAGATGAGACGAGAGGAGTAGAGTTGAGTCGAGTGGAGCAGAGCTGAGCCGAGCGGAGGAGAGGTGAGGCGAGGG
GTAGTAAAGTAATGTAACGTAAGGTATAGTATTGTATCGTATGGTACAGTACTGTACCGTACGGTAGAGTAGTGTAGCGTAGG
GTTGTTAAGTTATGTTACGTTAGGTTTAGTTTTGTTTCGTTTGGTTCAGTTCTGTTCCGTTCGGTTGAGTTGTGTTGCGTTGG
GTCGTCAAGTCATGTCACGTCAGGTCTAGTCTTGTCTCGTCTGGTCCAGTCCTGTCCCGTCCGGTCGAGTCGTGTCGCGTCGG
GTGGTGAAGTGATGTGACGTGAGGTGTAGTGTTGTGTCGTGTGGTGCAGTGCTGTGCCGTGCGGTGGAGTGGTGTGGCGTGGG
GCAGCAAAGCAATGCAACGCAAGGCATAGCATTGCATCGCATGGCACAGCACTGCACCGCACGGCAGAGCAGTGCAGCGCAGG
GCTGCTAAGCTATGCTACGCTAGGCTTAGCTTTGCTTCGCTTGGCTCAGCTCTGCTCCGCTCGGCTGAGCTGTGCTGCGCTGG
GCCGCCAAGCCATGCCACGCCAGGCCTAGCCTTGCCTCGCCTGGCCCAGCCCTGCCCCGCCCGGCCGAGCCGTGCCGCGCCGG
GCGGCGAAGCGATGCGACGCGAGGCGTAGCGTTGCGTCGCGTGGCGCAGCGCTGCGCCGCGCGGCGGAGCGGTGCGGCGCGGG
GGAGGAAAGGAATGGAACGGAAGGGATAGGATTGGATCGGATGGGACAGGACTGGACCGGACGGGAGAGGAGTGGAGCGGAGG
GGTGGTAAGGTATGGTACGGTAGGGTTAGGTTTGGTTCGGTTGGGTCAGGTCTGGTCCGGTCGGGTGAGGTGTGGTGCGGTGG
GGCGGCAAGGCATGGCACGGCAGGGCTAGGCTTGGCTCGGCTGGGCCAGGCCTGGCCCGGCCGGGCGAGGCGTGGCGCGGCGG
GGGGGGAAGGGATGGGACGGGAGGGGTAGGGTTGGGTCGGGTGGGGCAGGGCTGGGCCGGGCGGGGGAGGGGTGGGGCGGGGG
Sampling rate: 1 / 20
overrepresented sequencecount (% of bases)distribution: cycle 1 ~ cycle 150
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA297 (0.007718%)
AAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGA27 (0.001754%)
AAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAG8 (0.000520%)
AAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAA8 (0.000520%)
AAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGA6 (0.000390%)
AAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAAT4 (0.000260%)
AAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGG55 (0.003573%)
AAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGC36 (0.002339%)
AAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAAC11 (0.000715%)
AAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCAC141 (0.009160%)
AAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATC4 (0.000260%)
AAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGA6 (0.000390%)
AAAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTA1335 (0.034691%)
AAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGG5 (0.000325%)
AAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGG33 (0.002144%)
AAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCA13 (0.000845%)
AAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCA29 (0.001884%)
AAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCA12 (0.000780%)
AAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGA6 (0.000390%)
AAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGTGCCGTTCCGAAGGGACGGGCGATGGCCTCCGTTGCCCTCGGCCGATCGAAA27 (0.002596%)
AAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCT3 (0.000195%)
AACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTG5 (0.000325%)
AACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGCA3 (0.000195%)
AACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACT8 (0.000520%)
AACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGG217 (0.014097%)
AACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCC13 (0.000338%)
AAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACA33 (0.002144%)
AAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCA17 (0.001104%)
AAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGAT7 (0.000455%)
AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTAC1490 (0.038718%)
AAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGT4 (0.000260%)
AAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCA3 (0.000195%)
AAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGC5 (0.000325%)
AAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGC8 (0.000520%)
AAGTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTG4 (0.000260%)
AAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCA3 (0.000195%)
AAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAG11 (0.000715%)
AAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCC3 (0.000195%)
AATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATG4 (0.000260%)
AATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAA9 (0.000585%)
AATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAAC4 (0.000260%)
AATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAG3 (0.000195%)
AATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTC7 (0.000455%)
ACACACACACACACACACACACACACACACACACACACAC204 (0.005301%)
ACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTC10 (0.000650%)
ACACGTCTGAACTCCAGTCACGTTACACTGCATCTCGTAT9 (0.000234%)
ACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGT9 (0.000585%)
ACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTG11 (0.000715%)
ACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGT3 (0.000195%)
ACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTAC6 (0.000390%)
ACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTA8 (0.000520%)
ACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCA18 (0.001169%)
ACCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGT3 (0.000195%)
ACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCG14 (0.000364%)
ACGTCTGAACTCCAGTCACGTTACACTGCATCTCGTATGC8 (0.000208%)
ACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTT3 (0.000195%)
ACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGC3 (0.000195%)
ACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCAT7 (0.000455%)
ACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCC7 (0.000455%)
ACTTCTTCCGCGAATTGGCCGAGGAGAAGCGCGAGGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCA3 (0.000195%)
ACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCA8 (0.000520%)
AGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAA31 (0.002014%)
AGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCT7 (0.000455%)
AGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCT3 (0.000195%)
AGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGCTGAAGTCCTGTGACTTAGAGGGGAAATCGAGG3 (0.000195%)
AGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCA3 (0.000195%)
AGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATG6 (0.000390%)
AGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTA2191 (0.056934%)
AGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCC5 (0.000325%)
AGAGCTGTGGGAAGTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGA6 (0.000390%)
AGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGA3 (0.000195%)
AGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAAT12 (0.000780%)
AGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGA4 (0.000260%)
AGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAG5 (0.000325%)
AGCAAAGTTGCCCAGGGTGGCAGTGCAGCCTCTGGCTGAAGTGTAGCAGTCATCTATACCGGCCATCATCAGGAGCTTCTTGGGCACAGGAGCAGAGACA7 (0.000455%)
AGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCAT5 (0.000325%)
AGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGA5 (0.000325%)
AGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCC6 (0.000390%)
AGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGC3 (0.000195%)
AGCTAGGAATAATGGAATAGGACCGCGGTTCTATTTTGTTGGTTTTCGGAACTGAGGCCATGATTAAGAGGGACGGCCGGGGGCATTCGTATTGCGCCGC66 (0.004288%)
AGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACC5 (0.000325%)
AGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATC3 (0.000195%)
AGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTA41 (0.002664%)
AGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCA18 (0.001169%)
AGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGT5 (0.000325%)
AGGTGGTACAGAGCTGTGGGAAGTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAG17 (0.001104%)
AGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCA3 (0.000195%)
AGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCAC4 (0.000260%)
AGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATG3 (0.000195%)
AGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTT4 (0.000260%)
AGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGA3 (0.000195%)
AGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGT3 (0.000195%)
ATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACT4 (0.000260%)
ATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGA4 (0.000260%)
ATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAGAAG3 (0.000195%)
ATAGAGGGACTGAATACCATCTACATCATCTTGAGAGAGATGGAAACGGGACAAGTCTGTGGAGGACTTGTAGACTGGGTACATCAGAGCTTCAGCCTTG5 (0.000325%)
ATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGG7 (0.000455%)
ATATGTATATGTATATGTATATGTATATGTATATGTATAT315 (0.008185%)
ATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGA5 (0.000325%)
ATCACCTACAGGATTGTGAATTATACACCGGATTTGCCAAGACAGAGTGTGGATTCTGCCATTGAAAAAGCTTTGAAGGTCTGGGAGGAGGTGACCCCAC8 (0.000520%)
ATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGAT11 (0.000715%)
ATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACT3 (0.000195%)
ATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACA14 (0.000909%)
ATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGG5 (0.000325%)
ATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATG5 (0.000325%)
ATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTA12 (0.000780%)
ATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTACACT17 (0.000442%)
ATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAG4 (0.000260%)
ATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGGGTGGCGGGGCC3 (0.000195%)
ATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTT4 (0.000260%)
ATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGA3 (0.000195%)
ATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCAT11 (0.000715%)
ATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGG13 (0.000845%)
ATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAA3 (0.000195%)
ATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCT8 (0.000520%)
ATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAAC18 (0.001169%)
ATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGA13 (0.000845%)
ATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTG5 (0.000325%)
ATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACG8 (0.000520%)
ATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCT4 (0.000260%)
ATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCA6 (0.000390%)
ATGGCATCAAAGGTGGCCTTAGCAAAGTTGCCCAGGGTGGCAGTGCAGCCTCTGGCTGAAGTGTAGCAGTCATCTATACCGGCCATCATCAGGAGCTTCT4 (0.000260%)
ATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAA7 (0.000455%)
ATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTG144 (0.009355%)
ATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAG11 (0.000715%)
ATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGT6 (0.000390%)
ATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAG9 (0.000585%)
ATTGGATGGCCGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATC4 (0.000260%)
ATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACT9 (0.000585%)
ATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTT61 (0.003963%)
ATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGC6 (0.000390%)
CAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACG34 (0.002209%)
CAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTA36 (0.002339%)
CAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCG8 (0.000520%)
CAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAG22 (0.001429%)
CAAAGGTGGCCTTAGCAAAGTTGCCCAGGGTGGCAGTGCAGCCTCTGGCTGAAGTGTAGCAGTCATCTATACCGGCCATCATCAGGAGCTTCTTGGGCAC5 (0.000325%)
CAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGC40 (0.002599%)
CAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTCAG11 (0.000715%)
CAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGTGC138 (0.008965%)
CAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTA5 (0.000325%)
CAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCG5 (0.000325%)
CAAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTA1888 (0.049060%)
CAAGGGAGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGCTGAAGTCCTGTGACTTAGAGGGGAAA3 (0.000195%)
CAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTT3 (0.000195%)
CACACACACACACACACACACACACACACACACACACACA156 (0.004054%)
CACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTT543 (0.035275%)
CACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTG3 (0.000195%)
CACATCACCTACAGGATTGTGAATTATACACCGGATTTGCCAAGACAGAGTGTGGATTCTGCCATTGAAAAAGCTTTGAAGGTCTGGGAGGAGGTGACCC213 (0.013837%)
CACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGG4 (0.000260%)
CACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTAC8 (0.000520%)
CACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAG4 (0.000260%)
CACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGG10 (0.000650%)
CACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTT118 (0.007666%)
CACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCC4 (0.000260%)
CACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATC3 (0.000195%)
CACGAACAGCAAAGCGACCAAGTGGAGGGTAGTCAGAGAAGCTCTCAACACACATGGGCTTGCCAGGGACCATATCAACAATGGCAGCATCGCCAGACTT4 (0.000260%)
CACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGT6 (0.000390%)
CACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTT10 (0.000650%)
CACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTG15 (0.000974%)
CACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGT64 (0.004158%)
CACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCA16 (0.001039%)
CACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCC6 (0.000390%)
CACTTCTTCCGCGAATTGGCCGAGGAGAAGCGCGAGGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGC5 (0.000325%)
CAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGT5 (0.000325%)
CAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGC17 (0.001104%)
CAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTC6 (0.000390%)
CAGAGATCCTGGAGAAAGTGAGTGGGGTCACCTCCTCCCAGACCTTCAAAGCTTTTTCAATGGCAGAATCCACACTCTGTCTTGGCAAATCCGGTGTATA144 (0.009355%)
CAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCG9 (0.000585%)
CAGAGCTGTGGGAAGTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGG15 (0.000974%)
CAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGG6 (0.000390%)
CAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTAC3933 (0.102201%)
CAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCA9 (0.000585%)
CAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTG8 (0.000520%)
CAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTC21 (0.001364%)
CAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAA8 (0.000520%)
CAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTC15 (0.000974%)
CAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCAT6 (0.000390%)
CAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAGG43 (0.002793%)
CAGGGCTGTGCTGACTGACAAGGGAGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGCTGAAGTCC8 (0.000520%)
CAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAA5 (0.000325%)
CAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTC15 (0.000974%)
CAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCAT24 (0.001559%)
CAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCT5 (0.000325%)
CAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCC8 (0.000520%)
CAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATA3 (0.000195%)
CATAGAGGGACTGAATACCATCTACATCATCTTGAGAGAGATGGAAACGGGACAAGTCTGTGGAGGACTTGTAGACTGGGTACATCAGAGCTTCAGCCTT7 (0.000455%)
CATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTC11 (0.000715%)
CATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTG7 (0.000455%)
CATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAG5 (0.000325%)
CATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAA4 (0.000260%)
CATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAA5 (0.000325%)
CATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCT5 (0.000325%)
CATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATA4 (0.000260%)
CATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATG3 (0.000195%)
CATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGAC3 (0.000195%)
CATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGA4 (0.000260%)
CCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTG9 (0.000585%)
CCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACAT4 (0.000260%)
CCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAG3 (0.000195%)
CCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCT3 (0.000195%)
CCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGA3 (0.000195%)
CCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCC4 (0.000260%)
CCACTTCTTCCGCGAATTGGCCGAGGAGAAGCGCGAGGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTG7 (0.000455%)
CCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGG18 (0.001169%)
CCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGT9 (0.000585%)
CCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCC23 (0.001494%)
CCAGCGTCCAGGGCTGTGCTGACTGACAAGGGAGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGC4 (0.000260%)
CCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGT31 (0.002014%)
CCAGGGCTGTGCTGACTGACAAGGGAGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGCTGAAGTC3 (0.000195%)
CCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTT105 (0.006821%)
CCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCA14 (0.000909%)
CCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTC9 (0.000585%)
CCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAAT6 (0.000390%)
CCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCG813 (0.052815%)
CCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTGCTCCT5 (0.000325%)
CCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGC19 (0.001234%)
CCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGA5 (0.000325%)
CCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGG21 (0.001364%)
CCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCA119 (0.007731%)
CCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTA7 (0.000455%)
CCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATT47 (0.003053%)
CCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTC24 (0.001559%)
CCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTT16 (0.001039%)
CCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGAT23 (0.001494%)
CCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTG18 (0.001169%)
CCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCT7 (0.000455%)
CCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCC7 (0.000455%)
CCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTT3 (0.000195%)
CCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCA68 (0.004418%)
CCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCA5 (0.000325%)
CCCCTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAG307 (0.019944%)
CCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCAT15 (0.000974%)
CCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCG12 (0.000780%)
CCCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATT296 (0.019229%)
CCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCT11 (0.000715%)
CCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCG8 (0.000520%)
CCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCAC12 (0.000780%)
CCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTC28 (0.001819%)
CCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGA12 (0.000780%)
CCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGG4 (0.000260%)
CCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAAT37 (0.002404%)
CCGAGATCTCACCGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTCGTGACTACTGCCGAGCGTGAGATTGTCCGTGACATCAAGGAGAAG14 (0.000909%)
CCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATG7 (0.000455%)
CCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGG58 (0.003768%)
CCGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTCT4 (0.000260%)
CCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTT8 (0.000520%)
CCGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTC13 (0.000845%)
CCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTA5 (0.000325%)
CCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCA3 (0.000195%)
CCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTT5 (0.000325%)
CCGCGAATTGGCCGAGGAGAAGCGCGAGGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCA4 (0.000260%)
CCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGC7 (0.000455%)
CCGCGGTTCTATTTTGTTGGTTTTCGGAACTGAGGCCATGATTAAGAGGGACGGCCGGGGGCATTCGTATTGCGCCGCTAGAGGTGAAATTCTTGGACCG3 (0.000195%)
CCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACA40 (0.002599%)
CCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCT39 (0.002534%)
CCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGAC20 (0.001299%)
CCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACC4 (0.000260%)
CCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACT14 (0.000909%)
CCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAA29 (0.001884%)
CCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTG7 (0.000455%)
CCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCA5 (0.000325%)
CCTCACCAACCTTAATCCGGGCACCGAGTACGTTGTCAGCATCATTGCTGTTAATGGCAGAGAGGAGAGCCCGCCACTGATTGGCCAGCAAGCCACAGTT4 (0.000260%)
CCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCA10 (0.000650%)
CCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATA5 (0.000325%)
CCTCATGTCACGAACAGCAAAGCGACCAAGTGGAGGGTAGTCAGAGAAGCTCTCAACACACATGGGCTTGCCAGGGACCATATCAACAATGGCAGCATCG68 (0.004418%)
CCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCA4 (0.000260%)
CCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTC7 (0.000455%)
CCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCAT3 (0.000195%)
CCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCT7 (0.000455%)
CCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAG23 (0.001494%)
CCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCC9 (0.000585%)
CCTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTG27 (0.001754%)
CCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGTCCCGTGGGCTGCTCCAAATGTGC138 (0.008965%)
CCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAA12 (0.000780%)
CCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGG5 (0.000325%)
CCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTG4 (0.000260%)
CCTTAGCAAAGTTGCCCAGGGTGGCAGTGCAGCCTCTGGCTGAAGTGTAGCAGTCATCTATACCGGCCATCATCAGGAGCTTCTTGGGCACAGGAGCAGA5 (0.000325%)
CCTTAGGACACCTGCGTTACCGTTTGACAGGTGTACCGCCCCAGTCAAACTCCCCACCTGGCACTGTCCCCGGAGCGGGTCGCGCCCGCCCGCACGCGCG3 (0.000195%)
CCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGC5 (0.000325%)
CGAACAGCAAAGCGACCAAGTGGAGGGTAGTCAGAGAAGCTCTCAACACACATGGGCTTGCCAGGGACCATATCAACAATGGCAGCATCGCCAGACTTCA5 (0.000325%)
CGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCT4 (0.000260%)
CGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATC14 (0.000909%)
CGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTA7 (0.000455%)
CGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCTTGACCAGCTTCTTTCATGA71 (0.004612%)
CGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAG13 (0.000845%)
CGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGA29 (0.001884%)
CGAGGAGAAGCGCGAGGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAA5 (0.000325%)
CGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTCTG4 (0.000260%)
CGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTG3 (0.000195%)
CGATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCT8 (0.000520%)
CGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGC10 (0.000650%)
CGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCT10 (0.000650%)
CGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAA44 (0.002858%)
CGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTAC6 (0.000390%)
CGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTC4 (0.000260%)
CGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTCTGGAAACTTCTACAGAAACA3 (0.000195%)
CGCCTTAGGACACCTGCGTTACCGTTTGACAGGTGTACCGCCCCAGTCAAACTCCCCACCTGGCACTGTCCCCGGAGCGGGTCGCGCCCGCCCGCACGCG70 (0.004547%)
CGCGAATTGGCCGAGGAGAAGCGCGAGGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCAT28 (0.001819%)
CGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCA5 (0.000325%)
CGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGG26 (0.001689%)
CGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGG5 (0.000325%)
CGCGGTTCTATTTTGTTGGTTTTCGGAACTGAGGCCATGATTAAGAGGGACGGCCGGGGGCATTCGTATTGCGCCGCTAGAGGTGAAATTCTTGGACCGG14 (0.000909%)
CGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAA6 (0.000390%)
CGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGC31 (0.002014%)
CGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCC4 (0.000260%)
CGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTC35 (0.002274%)
CGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGC42 (0.001091%)
CGGAAGAGCACACGTCTGAACTCCAGTCACGTTACACTGC12 (0.000312%)
CGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGGGT14 (0.000909%)
CGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGACTGGTCCT8 (0.000520%)
CGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATA41 (0.002664%)
CGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCA50 (0.003248%)
CGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCACAC10 (0.000650%)
CGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACAT26 (0.001689%)
CGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTG4 (0.000260%)
CGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACC21 (0.001364%)
CGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCAC15 (0.000974%)
CGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCT4 (0.000260%)
CGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACCT4 (0.000260%)
CGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGGGT4 (0.000260%)
CGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGT8 (0.000520%)
CGTAGCTTCAGTATCATTGGTGCCCTATGGTTTTAACGGTTAATACGGGGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGAGAGGGGAGAGCAAT137 (0.008900%)
CGTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAA487 (0.031637%)
CGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTG7 (0.000455%)
CGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTG5 (0.000325%)
CGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTT15 (0.000974%)
CGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAAT10 (0.000650%)
CTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGA4 (0.000260%)
CTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACT5 (0.000325%)
CTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGG3 (0.000195%)
CTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCAC7 (0.000455%)
CTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCA3 (0.000195%)
CTCACCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGG328 (0.031536%)
CTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCT3 (0.000195%)
CTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAG3 (0.000195%)
CTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGGGTGGCGGG14 (0.000909%)
CTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATAC7 (0.000455%)
CTCATGTCACGAACAGCAAAGCGACCAAGTGGAGGGTAGTCAGAGAAGCTCTCAACACACATGGGCTTGCCAGGGACCATATCAACAATGGCAGCATCGC5 (0.000325%)
CTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAA4 (0.000260%)
CTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCG25 (0.001624%)
CTCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCC427 (0.027739%)
CTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAG24 (0.001559%)
CTCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAG15 (0.000974%)
CTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAG13 (0.000845%)
CTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCA51 (0.003313%)
CTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATC16 (0.001039%)
CTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTG15 (0.000974%)
CTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATA8 (0.000520%)
CTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAA4 (0.000260%)
CTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATC19 (0.001234%)
CTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGA138 (0.008965%)
CTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTT89 (0.005782%)
CTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGACTGGTCCTAGGAGCTGAAGGC3 (0.000195%)
CTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCA26 (0.001689%)
CTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGG8 (0.000520%)
CTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCA6 (0.000390%)
CTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCT8 (0.000520%)
CTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAG3 (0.000195%)
CTGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGA21 (0.001364%)
CTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTAT10 (0.000650%)
CTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGC26 (0.001689%)
CTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGA34 (0.002209%)
CTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTG3 (0.000195%)
CTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTT3 (0.000195%)
CTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGTCCCGTGGGCTGCTCCAAATGTGCC3 (0.000195%)
CTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAA21 (0.001364%)
CTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAG12 (0.000780%)
CTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGA6 (0.000390%)
CTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTC17 (0.001104%)
CTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATG11 (0.000715%)
CTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAAT22 (0.001429%)
CTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAG4 (0.000260%)
CTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGA23 (0.001494%)
CTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCT16 (0.001039%)
CTGGTCCGCACCAGTTCTAAGTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACC105 (0.006821%)
CTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCA4 (0.000260%)
CTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGC8 (0.000520%)
CTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGG11 (0.000715%)
CTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAG81 (0.005262%)
CTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGGGTGGCGGGGCCACAA4 (0.000260%)
CTGTTGTGCTTACTTGTTTAAAGCTTTCTCCAGGTACTCTTGGATCCACTTTAATTTCGGGTCAATGCACACTTGTCTGTTGTTGTTCTTCAGCCGTGCA34 (0.002209%)
CTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTC23 (0.001494%)
CTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCT13 (0.000845%)
CTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAAT6 (0.000390%)
CTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGA7 (0.000455%)
CTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCC9 (0.000585%)
CTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGCAGCTTTTCT5 (0.000325%)
CTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACA9 (0.000585%)
CTTCAGTATCATTGGTGCCCTATGGTTTTAACGGTTAATACGGGGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGAGAGGGGAGAGCAATTATGA7 (0.000455%)
CTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAA8 (0.000520%)
CTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGC8 (0.000520%)
CTTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGG260 (0.016891%)
CTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCT18 (0.001169%)
CTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACA5 (0.000325%)
CTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCC1880 (0.048853%)
CTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGTCCCGTGGGCTGCTCCAAATGTGCCCAGGG5 (0.000325%)
CTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTC18 (0.001169%)
CTTGGAGATGGCATCAAAGGTGGCCTTAGCAAAGTTGCCCAGGGTGGCAGTGCAGCCTCTGGCTGAAGTGTAGCAGTCATCTATACCGGCCATCATCAGG7 (0.000455%)
CTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAG27 (0.001754%)
CTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCA10 (0.000650%)
CTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCA12 (0.000780%)
CTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCAT17 (0.001104%)
CTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTAT24 (0.001559%)
CTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGCTGAAGTCCTGTGACTTAGAGGGGAAATCGAGGGAA5 (0.000325%)
CTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAA54 (0.003508%)
GAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGA28 (0.001819%)
GAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAG559 (0.036315%)
GAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAG14 (0.000909%)
GAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAA8 (0.000520%)
GAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATC4 (0.000260%)
GAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTG23 (0.001494%)
GAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAAGC12 (0.000780%)
GAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGC12 (0.000312%)
GAAGAGCACACGTCTGAACTCCAGTCACGTTACACTGCAT19 (0.000494%)
GAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTC55 (0.003573%)
GAAGCGCGAGGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGT4 (0.000260%)
GAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTG5 (0.000325%)
GAAGGTGGTACAGAGCTGTGGGAAGTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGAC274 (0.017800%)
GAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAA5 (0.000325%)
GAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCA17 (0.001104%)
GAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGT10 (0.000650%)
GACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAGAGAGGCTGTTC9 (0.000585%)
GACAAGGGAGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGCTGAAGTCCTGTGACTTAGAGGGGA7 (0.000455%)
GACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCT3 (0.000195%)
GACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGAGG3 (0.000195%)
GACCGCGGTTCTATTTTGTTGGTTTTCGGAACTGAGGCCATGATTAAGAGGGACGGCCGGGGGCATTCGTATTGCGCCGCTAGAGGTGAAATTCTTGGAC3 (0.000195%)
GACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTA6 (0.000390%)
GACGCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAG281 (0.018255%)
GACTGACAAGGGAGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGCTGAAGTCCTGTGACTTAGAG5 (0.000325%)
GACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTC5 (0.000325%)
GAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATC17 (0.001104%)
GAGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGCTGAAGTCCTGTGACTTAGAGGGGAAATCGAG5 (0.000325%)
GAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCAT32 (0.002079%)
GAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATC7 (0.000455%)
GAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGG8 (0.000520%)
GAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAA22 (0.001429%)
GAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTAC3398 (0.088298%)
GAGCACACGTCTGAACTCCAGTCACGTTACACTGCATCGC6 (0.000156%)
GAGCACACGTCTGAACTCCAGTCACGTTACACTGCATCTC11 (0.000286%)
GAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTC4 (0.000260%)
GAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCC11 (0.000715%)
GAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGAT8 (0.000520%)
GAGCTGTGGGAAGTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGAT7 (0.000455%)
GAGGAAGACAGAAAAGGTTGTAACGTAGAGGAAGTGAGACTGGTGAATTGGTTTGATTTTTTTCACATCTAGATGGCTGTCATAAAGTTTCTAGCATGTT82 (0.005327%)
GAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGG10 (0.000650%)
GAGGGACTGAATACCATCTACATCATCTTGAGAGAGATGGAAACGGGACAAGTCTGTGGAGGACTTGTAGACTGGGTACATCAGAGCTTCAGCCTTGGCT4 (0.000260%)
GAGGGCGTAGGCCACTTCTTCCGCGAATTGGCCGAGGAGAAGCGCGAGGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCT7 (0.000455%)
GAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAG4 (0.000260%)
GAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGAC3 (0.000195%)
GAGTTCCATAGAGGGACTGAATACCATCTACATCATCTTGAGAGAGATGGAAACGGGACAAGTCTGTGGAGGACTTGTAGACTGGGTACATCAGAGCTTC3 (0.000195%)
GATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATA4 (0.000260%)
GATCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTG6 (0.000390%)
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTACAC61 (0.001585%)
GATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGT7 (0.000455%)
GATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGAC3 (0.000195%)
GATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACA10 (0.000650%)
GATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTC13 (0.000845%)
GATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGA26 (0.001689%)
GATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCA10 (0.000650%)
GCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACT32 (0.002079%)
GCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGG46 (0.002988%)
GCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGATTAGGT7 (0.000455%)
GCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGTCCCGTGGGCTGCTCCAAATGTGCCCAGGGCTGTGTCTGCAAAGGCGCCGC4 (0.000260%)
GCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAA6 (0.000390%)
GCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACT17 (0.001104%)
GCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCC14 (0.000909%)
GCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTC5 (0.000325%)
GCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTA1736 (0.045111%)
GCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAG4 (0.000260%)
GCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTC5 (0.000325%)
GCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATA23 (0.001494%)
GCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGACTGGTCCTAG7 (0.000455%)
GCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTT4 (0.000260%)
GCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAAG42 (0.002728%)
GCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAAC8 (0.000520%)
GCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATT3 (0.000195%)
GCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGT5 (0.000325%)
GCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTC13 (0.000845%)
GCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGA8 (0.000520%)
GCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCT54 (0.003508%)
GCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACA14 (0.000909%)
GCCACTTCTTCCGCGAATTGGCCGAGGAGAAGCGCGAGGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGT25 (0.001624%)
GCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAG84 (0.005457%)
GCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAA10 (0.000650%)
GCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCT6 (0.000390%)
GCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAG16 (0.001039%)
GCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGT5 (0.000325%)
GCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGC7 (0.000455%)
GCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCA5 (0.000325%)
GCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATC3 (0.000195%)
GCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAA74 (0.004807%)
GCCGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTC8 (0.000520%)
GCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCC20 (0.001299%)
GCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCT15 (0.000974%)
GCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCC25 (0.001624%)
GCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAA20 (0.001299%)
GCCTTAGCAAAGTTGCCCAGGGTGGCAGTGCAGCCTCTGGCTGAAGTGTAGCAGTCATCTATACCGGCCATCATCAGGAGCTTCTTGGGCACAGGAGCAG3 (0.000195%)
GCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGT4 (0.000260%)
GCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGA8 (0.000520%)
GCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCG10 (0.000650%)
GCGAGGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAG562 (0.036510%)
GCGCACTTGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGC314 (0.020399%)
GCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGTCCCGTGGGCTGCTCCAAATGTGCCCAGGGCTGTGTCTGCAAAGG3 (0.000195%)
GCGCGAGGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATGTGCAGAAGCCATCTCAAGATGAATGGGGTAAA6 (0.000390%)
GCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAG13 (0.000845%)
GCGGAATTCCATCACCCTCACCAACCTTAATCCGGGCACCGAGTACGTTGTCAGCATCATTGCTGTTAATGGCAGAGAGGAGAGCCCGCCACTGATTGGC14 (0.000909%)
GCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGGG15 (0.000974%)
GCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCA58 (0.003768%)
GCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGGG10 (0.000650%)
GCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGA7 (0.000455%)
GCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTG17 (0.001104%)
GCGTAGGCCACTTCTTCCGCGAATTGGCCGAGGAGAAGCGCGAGGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCA30 (0.001949%)
GCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCG24 (0.001559%)
GCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTA60 (0.003898%)
GCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGC3 (0.000195%)
GCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCC9 (0.000585%)
GCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTA102 (0.006626%)
GCTGACTGACAAGGGAGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGCTGAAGTCCTGTGACTTA3 (0.000195%)
GCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCT5 (0.000325%)
GCTGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCC7 (0.000455%)
GCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGG8 (0.000520%)
GCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCG39 (0.002534%)
GCTGTGCTGACTGACAAGGGAGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGCTGAAGTCCTGTG5 (0.000325%)
GCTGTGGGAAGTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGA6 (0.000390%)
GCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGT4 (0.000260%)
GCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCAC12 (0.000780%)
GCTTCAGTATCATTGGTGCCCTATGGTTTTAACGGTTAATACGGGGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGAGAGGGGAGAGCAATTATG3 (0.000195%)
GCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACA35 (0.002274%)
GCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGACTGGTCCTAGGAG3 (0.000195%)
GCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTC24 (0.001559%)
GCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTA11 (0.000715%)
GGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGATGCCAG14 (0.000909%)
GGAAGAGCACACGTCTGAACTCCAGTCACGTTACACTGCA33 (0.000858%)
GGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTT32 (0.002079%)
GGAAGTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGC3 (0.000195%)
GGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGT10 (0.000650%)
GGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCA10 (0.000650%)
GGACCTGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTG380 (0.024686%)
GGACTGAATACCATCTACATCATCTTGAGAGAGATGGAAACGGGACAAGTCTGTGGAGGACTTGTAGACTGGGTACATCAGAGCTTCAGCCTTGGCTGAG6 (0.000390%)
GGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGAT24 (0.001559%)
GGAGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGCTGAAGTCCTGTGACTTAGAGGGGAAATCGA5 (0.000325%)
GGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGAT14 (0.000909%)
GGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAG4 (0.000260%)
GGAGGGCGTAGGCCACTTCTTCCGCGAATTGGCCGAGGAGAAGCGCGAGGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTC41 (0.002664%)
GGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATT27 (0.001754%)
GGAGTTCCATAGAGGGACTGAATACCATCTACATCATCTTGAGAGAGATGGAAACGGGACAAGTCTGTGGAGGACTTGTAGACTGGGTACATCAGAGCTT4 (0.000260%)
GGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGTT7 (0.000455%)
GGATGGCCGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAAC6 (0.000390%)
GGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATG52 (0.003378%)
GGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGG4 (0.000260%)
GGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCCT3 (0.000195%)
GGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGT10 (0.000650%)
GGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGACTGGTCCTA5 (0.000325%)
GGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAG12 (0.000780%)
GGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAG5 (0.000325%)
GGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCAC16 (0.001039%)
GGCCACTTCTTCCGCGAATTGGCCGAGGAGAAGCGCGAGGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCCAGGATG5 (0.000325%)
GGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAG3 (0.000195%)
GGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTCTGGAAACTTCTACAGAA3 (0.000195%)
GGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTG5 (0.000325%)
GGCGAGCCTACTCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGG323 (0.020983%)
GGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAG5 (0.000325%)
GGCGTAGGCCACTTCTTCCGCGAATTGGCCGAGGAGAAGCGCGAGGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTCC6 (0.000390%)
GGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTT5 (0.000325%)
GGGAAGTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATG12 (0.000780%)
GGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGG35 (0.002274%)
GGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACAT12 (0.000780%)
GGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATG12 (0.000780%)
GGGACTGAATACCATCTACATCATCTTGAGAGAGATGGAAACGGGACAAGTCTGTGGAGGACTTGTAGACTGGGTACATCAGAGCTTCAGCCTTGGCTGA4 (0.000260%)
GGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCG4 (0.000260%)
GGGAGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGCTGAAGTCCTGTGACTTAGAGGGGAAATCG8 (0.000520%)
GGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGA47 (0.003053%)
GGGAGTTCCATAGAGGGACTGAATACCATCTACATCATCTTGAGAGAGATGGAAACGGGACAAGTCTGTGGAGGACTTGTAGACTGGGTACATCAGAGCT27 (0.001754%)
GGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTTCTGT7 (0.000455%)
GGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTG7 (0.000455%)
GGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGACCC13 (0.000845%)
GGGCGTAGGCCACTTCTTCCGCGAATTGGCCGAGGAGAAGCGCGAGGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCGTGCACTCTTC6 (0.000390%)
GGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACT7 (0.000455%)
GGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTG81 (0.005262%)
GGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGT23 (0.001494%)
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG367 (0.009537%)
GGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCAC23 (0.001494%)
GGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACC3 (0.000195%)
GGTACAGAGCTGTGGGAAGTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCA4 (0.000260%)
GGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGA34 (0.002209%)
GGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTG11 (0.000715%)
GGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTG22 (0.001429%)
GGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCC3 (0.000195%)
GGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTT19 (0.001234%)
GGTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTG3 (0.000195%)
GGTGGTACAGAGCTGTGGGAAGTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGT4 (0.000260%)
GGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCG5 (0.000325%)
GGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACC4 (0.000260%)
GGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGACT4 (0.000260%)
GGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTC7 (0.000455%)
GGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGG5 (0.000325%)
GGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAA11 (0.000715%)
GTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCA4 (0.000260%)
GTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTC26 (0.001689%)
GTACAGAGCTGTGGGAAGTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAA17 (0.001104%)
GTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGATTAGGTGTATTAATAAGTGTCCTGC6 (0.000390%)
GTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGG3 (0.000195%)
GTAGCTTCAGTATCATTGGTGCCCTATGGTTTTAACGGTTAATACGGGGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGAGAGGGGAGAGCAATT4 (0.000260%)
GTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGAT8 (0.000520%)
GTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATAT10 (0.000650%)
GTATTGGATGGCCGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCA107 (0.006951%)
GTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGG35 (0.002274%)
GTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGG37 (0.002404%)
GTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTC28 (0.001819%)
GTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGT3 (0.000195%)
GTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGC11 (0.000715%)
GTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCAT3 (0.000195%)
GTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCA7 (0.000455%)
GTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACG28 (0.001819%)
GTCAGGTAGCTGTAAGTCTTGGAGATGGCATCAAAGGTGGCCTTAGCAAAGTTGCCCAGGGTGGCAGTGCAGCCTCTGGCTGAAGTGTAGCAGTCATCTA35 (0.002274%)
GTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGA25 (0.001624%)
GTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGGGTCGGAG9 (0.000585%)
GTCCAGGGCTGTGCTGACTGACAAGGGAGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGCTGAAG8 (0.000520%)
GTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGA14 (0.000909%)
GTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACAT31 (0.002014%)
GTCCGCACCAGTTCTAAGTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGAC25 (0.001624%)
GTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCCGCTGGCATTT6 (0.000390%)
GTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATACCTAG4 (0.000260%)
GTCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAAT27 (0.001754%)
GTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCAC47 (0.003053%)
GTCTGAACTCCAGTCACGTTACACTGCATCTCGTATGCCG9 (0.000234%)
GTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGG3 (0.000195%)
GTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAA4 (0.000260%)
GTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGACAA6 (0.000390%)
GTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTC11 (0.000715%)
GTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGC6 (0.000390%)
GTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGGGTGGCGGGGCCACAACC15 (0.000974%)
GTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGA4 (0.000260%)
GTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCG6 (0.000390%)
GTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCGCC3 (0.000195%)
GTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTC3 (0.000195%)
GTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGT6 (0.000390%)
GTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTG6 (0.000390%)
GTGGCCGAATCTTCCTGCAGGATATAAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGT7 (0.000455%)
GTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGC13 (0.000845%)
GTGGGAAGTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGA14 (0.000909%)
GTGGTACAGAGCTGTGGGAAGTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTG18 (0.001169%)
GTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTG26 (0.001689%)
GTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGCGGCCGGCGGGGGTCG4 (0.000260%)
GTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGG8 (0.000520%)
GTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATG3 (0.000195%)
GTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAG9 (0.000585%)
GTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCT10 (0.000650%)
GTGTTCTTCGACATCACGGCCGATGACGAGCCCTTGGGCCGCGTCTCCTTCGAGCTGTTTGCAGACAAAGTTCCAAAGACAGCAGAAAACTTTCGAGCTC70 (0.004547%)
GTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGACTG6 (0.000390%)
GTTCCATAGAGGGACTGAATACCATCTACATCATCTTGAGAGAGATGGAAACGGGACAAGTCTGTGGAGGACTTGTAGACTGGGTACATCAGAGCTTCAG27 (0.001754%)
GTTCTATTTTGTTGGTTTTCGGAACTGAGGCCATGATTAAGAGGGACGGCCGGGGGCATTCGTATTGCGCCGCTAGAGGTGAAATTCTTGGACCGGCGCA5 (0.000325%)
GTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCA7 (0.000455%)
GTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAA3 (0.000195%)
GTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCC17 (0.001104%)
GTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTA8 (0.000520%)
GTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGA8 (0.000520%)
GTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAA69 (0.004482%)
GTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGG8 (0.000520%)
TAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTT7 (0.000455%)
TAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTGCTAAAGTCATCAGCGAT4 (0.000260%)
TAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCA3 (0.000195%)
TAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGC6 (0.000390%)
TACAGAGCTGTGGGAAGTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAG3 (0.000195%)
TAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTAC1989 (0.051685%)
TAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTC8 (0.000520%)
TAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGG11 (0.000715%)
TAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCAC4 (0.000260%)
TATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTG3 (0.000195%)
TATATGTATATGTATATGTATATGTATATGTATATGTATA181 (0.004703%)
TATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCAT4 (0.000260%)
TATGTATATGTATATGTATATGTATATGTATATGTATATG6 (0.000156%)
TATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGA5 (0.000325%)
TATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATC3 (0.000195%)
TATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGT12 (0.000780%)
TCAAAAAAGAAGCCCAGAGAGAGGTAGGTGTAGGAGGCCCGCAGGTGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGAC4 (0.000260%)
TCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGC4 (0.000260%)
TCACCAGCGTCCAGGGCTGTGCTGACTGACAAGGGAGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTC221 (0.014357%)
TCACCTGGGGTCCCAGAAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGC5 (0.000481%)
TCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGACTGGT4 (0.000260%)
TCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATT12 (0.000780%)
TCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGT4 (0.000260%)
TCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATA4 (0.000260%)
TCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGC9 (0.000585%)
TCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACAT6 (0.000390%)
TCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGA3 (0.000195%)
TCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGT3 (0.000195%)
TCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACA5 (0.000325%)
TCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGC5 (0.000325%)
TCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGAT5 (0.000325%)
TCCCAGTCATCACGGTCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCT24 (0.001559%)
TCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGT382 (0.024816%)
TCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGC3 (0.000195%)
TCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGC5 (0.000325%)
TCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATT97 (0.006301%)
TCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTT9 (0.000585%)
TCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGG22 (0.001429%)
TCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATT5 (0.000325%)
TCCGCACCAGTTCTAAGTCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACG4 (0.000260%)
TCCGCCCCCCTTCAGGCACAGCAGCTGCACTTGTCGGAAGCCTCTTTGCAGATGCAGCCCTGGGAGCACTTCGCACAGCCCACGGGGCAGCAGGAGCAGC3 (0.000195%)
TCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGTCAGAGTAGGCTCGCCACATGTCTCTAGA3 (0.000195%)
TCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATAC4 (0.000260%)
TCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCAT9 (0.000585%)
TCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGC4 (0.000260%)
TCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAA7 (0.000455%)
TCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAG3 (0.000195%)
TCGATCTTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATG15 (0.000974%)
TCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAG18 (0.001169%)
TCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAG23 (0.001494%)
TCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCT3 (0.000195%)
TCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGAT52 (0.003378%)
TCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCC24 (0.001559%)
TCGGCTGCTAGGCGCCGGCCGAGGCGAGGCGCCGCGCGGAAAACCGCGGCCCGGGGGGCGGACCCGGCGGGGGAACACCGACGCGGAGGTTCCCCCCACA6 (0.000390%)
TCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTC7 (0.000455%)
TCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGC3 (0.000195%)
TCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCAT3 (0.000195%)
TCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAG50 (0.003248%)
TCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGT56 (0.003638%)
TCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAA10 (0.000650%)
TCTGACATGAAGAAAGCTAACTGGAAAAACTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCCGGAGGGGTCCCGGGGGAGCCTGGGCTG4 (0.000260%)
TCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTT8 (0.000520%)
TCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAA5 (0.000325%)
TCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGC3 (0.000195%)
TCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCT3 (0.000195%)
TCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACC3 (0.000195%)
TCTGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGA13 (0.000845%)
TCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTC5 (0.000325%)
TCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGAAGAA9 (0.000585%)
TCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATT3 (0.000195%)
TCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTA13 (0.000845%)
TGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGA27 (0.001754%)
TGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAAAGA7 (0.000455%)
TGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGG8 (0.000208%)
TGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCT4 (0.000260%)
TGAATCAGGCCCTCTTGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAA4 (0.000260%)
TGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATG22 (0.001429%)
TGAATTAATGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAG112 (0.007276%)
TGACAAGGGAGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGCTGAAGTCCTGTGACTTAGAGGGG19 (0.001234%)
TGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGC7 (0.000455%)
TGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAG6 (0.000390%)
TGACTGACAAGGGAGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGCTGAAGTCCTGTGACTTAGA4 (0.000260%)
TGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAG7 (0.000455%)
TGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTT11 (0.000715%)
TGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACT16 (0.001039%)
TGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGCAGAATATCTCTTTGA5 (0.000325%)
TGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGAC10 (0.000650%)
TGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTT5 (0.000325%)
TGCAAGTTGACCAGGCGGTTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGA7 (0.000455%)
TGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAAT12 (0.000780%)
TGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGT5 (0.000325%)
TGCAGGGATCACCTCCAAATTAGCGATCAATTTGGGATTAATTTTTGGAGTTACGGTTAAGCAAACACAACGCAGCTCCGTTGCGGCTATGACTGAGGAA9 (0.000585%)
TGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATGA13 (0.000845%)
TGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATT4 (0.000260%)
TGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAA5 (0.000325%)
TGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCC5 (0.000325%)
TGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCA8 (0.000520%)
TGCGAGGGAGACGCGGTGGTCATGGTGGCGGCGGGGCGAGGCGCGGTGGCGACGCTGGAGCGGCGGAACGACGAAGTTGCAAAGGGCTCAGGCTCGAAGC3 (0.000195%)
TGCGCCTGCAAGAACTGCAAGTGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGTCCCGTGGGCTGCTCCAAATGTGCCCAGGGCTGTGTCTGCAAAG4 (0.000260%)
TGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTT4 (0.000260%)
TGCTACTGCAAATTCTAGAATTGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCG4 (0.000260%)
TGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGT16 (0.001039%)
TGCTGACTGACAAGGGAGACTTTGCACAACACAGCATCAGCTGAAGCTTGTGAGGAGGAAGTCTCTGTTTTGCCCTGTTTCTGCTGAAGTCCTGTGACTT6 (0.000390%)
TGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCA3 (0.000195%)
TGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTT10 (0.000650%)
TGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATGTACTTCCTGCAAGAAAAGCTGCTG3 (0.000195%)
TGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGA6 (0.000390%)
TGGATCTGCATGCCCTGGGTTCTGCCCGCGCGGACCCTCATCTCTGTGACTTCCTGGAAAGCCACTATCTGGATAAGGAGGTGAAACTCATCAAGAAGAT6 (0.000390%)
TGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGAT50 (0.003248%)
TGGCATCAAAGGTGGCCTTAGCAAAGTTGCCCAGGGTGGCAGTGCAGCCTCTGGCTGAAGTGTAGCAGTCATCTATACCGGCCATCATCAGGAGCTTCTT3 (0.000195%)
TGGCATCGCTGATGACTTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCA899 (0.058402%)
TGGCTCTGGAGGGCGTAGGCCACTTCTTCCGCGAATTGGCCGAGGAGAAGCGCGAGGGCGCGGAGCGTCTCCTCGAGTTTCAGAACGATCGCGGGGGCCG123 (0.007991%)
TGGGAAGTCAATGAAAATGAAGGGTCTTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGAT33 (0.002144%)
TGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACA5 (0.000325%)
TGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATG3 (0.000195%)
TGGGAGTTCCATAGAGGGACTGAATACCATCTACATCATCTTGAGAGAGATGGAAACGGGACAAGTCTGTGGAGGACTTGTAGACTGGGTACATCAGAGC195 (0.012668%)
TGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGC4 (0.000260%)
TGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTT23 (0.001494%)
TGGGTTGGTCCGATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTG3 (0.000195%)
TGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGT30 (0.001949%)
TGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGC11 (0.000715%)
TGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTCCATCTCGCCATTCATGCGGATGGCG4 (0.000260%)
TGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGT48 (0.003118%)
TGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGT13 (0.000845%)
TGGTTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGA5 (0.000325%)
TGTATATGTATATGTATATGTATATGTATATGTATATGTA17 (0.000442%)
TGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACT12 (0.000780%)
TGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGG3 (0.000195%)
TGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAG20 (0.001299%)
TGTGAGTAGAAGTAAAATAATAAATGTAATGGTAGCTGTTGGTGGGCTAATATTTATTAATACTAGAGTAGCTCCTCCGATTAGGTGTATTAATAAGTGT3 (0.000195%)
TGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGA9 (0.000585%)
TGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTG4 (0.000260%)
TTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATGT4 (0.000260%)
TTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCA8 (0.000520%)
TTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTT5 (0.000325%)
TTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTG3 (0.000195%)
TTCAACCGCCGCCTCCACTCGCCATGGACCCCAACTGCTCCTGTGCCTCCGATGGATCCTGCTCCTGCGCTGGCGCCTGCAAATGCAAACAATGCAAATG4 (0.000260%)
TTCACGGCAGCTTCCACCTCGGTGGAATAATTCTGACGAATCTGAGAGGTCATGGCTGATCCGGAGTAGGAGCTAACCGCGAAGAGACGGTGCAGACTGG4 (0.000260%)
TTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCG18 (0.001169%)
TTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTT6 (0.000390%)
TTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACAT21 (0.001364%)
TTCAGTATCATTGGTGCCCTATGGTTTTAACGGTTAATACGGGGTTGTTGATTTCGTCTATTATATATAGAATGCGTAGAGAGGGGAGAGCAATTATGAT3 (0.000195%)
TTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCA3 (0.000195%)
TTCCCTCCTCTCCTTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGT8 (0.000520%)
TTCCGGTCCTGCTGTGGCTGTGTGTGGTTGTGTGCTCATCCTACCCATTGCATGACAGTGCAAGGGATGATGATGCTGGTATGGAGCTTCTGCAGAAATA8 (0.000520%)
TTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAA7 (0.000455%)
TTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGC16 (0.001039%)
TTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACA9 (0.000585%)
TTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCACATGCTGAACAAAGCACTTCCTTTCACAA6 (0.000390%)
TTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAA6 (0.000390%)
TTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTC6 (0.000390%)
TTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGT4 (0.000260%)
TTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCG6 (0.000156%)
TTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAAT4 (0.000260%)
TTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGATGGGTGCCCCTGAAGCTGGCATGGC23 (0.001494%)
TTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACATG5 (0.000325%)
TTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGC7 (0.000455%)
TTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGA15 (0.000974%)
TTGGCCGCCTGGCGGCCATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTCTGGAAACTTCTACAG5 (0.000325%)
TTGGGACACAGTGTAAGCTACACAGTGCTTCTGAACATCCTTTGACAACTTGACGTTGACTGGTGTCATCCATAGCTCCTGTTTGGTTCTGCCATAGCAC12 (0.000780%)
TTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGT16 (0.001039%)
TTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAG7 (0.000455%)
TTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGG17 (0.001104%)
TTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCAC6 (0.000390%)
TTTAGCAGCCCAGGCTCCCCCGGGACCCCTCCGGGCAGCATCATAGTTCCCCCGAGCATGGAAGTATTTGTCTGAGTTTTTCCAGTTAGCTTTCTTCATG4 (0.000260%)
TTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATT33 (0.002144%)
TTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCT9 (0.000585%)
TTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGAC8 (0.000520%)
TTTCTTTATATCCTGCAGGAAGATTCGGCCACCTCGCTGGTTCTGCAGCTTCATCAGTTTCTCGGCATGCTCCCTCTCCTCATGAGATTGGTGGAGAAAG15 (0.000974%)
TTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACATGTGGCGAGCCTACTCTGACAT73 (0.004742%)
TTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTG7 (0.000455%)
TTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAG16 (0.001039%)
TTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAA140 (0.009095%)
TTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCC3 (0.000195%)
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT549 (0.014266%)
Value of each position will be shown on mouse over.
Value of each position will be shown on mouse over.
Darker background means larger counts. The count will be shown on mouse over.
AAATACAGTATTTCTGCACTCCCGGAGTGCGG
AAAAAAAAAAAATAAAACAAAAGAAATAAAATTAAATCAAATGAAACAAAACTAAACCAAACGAAAGAAAAGTAAAGCAAAGG
AATAATAAAATATAATACAATAGAATTAAATTTAATTCAATTGAATCAAATCTAATCCAATCGAATGAAATGTAATGCAATGG
AACAACAAAACATAACACAACAGAACTAAACTTAACTCAACTGAACCAAACCTAACCCAACCGAACGAAACGTAACGCAACGG
AAGAAGAAAAGATAAGACAAGAGAAGTAAAGTTAAGTCAAGTGAAGCAAAGCTAAGCCAAGCGAAGGAAAGGTAAGGCAAGGG
ATAATAAAATAATATAACATAAGATATAATATTATATCATATGATACAATACTATACCATACGATAGAATAGTATAGCATAGG
ATTATTAAATTATATTACATTAGATTTAATTTTATTTCATTTGATTCAATTCTATTCCATTCGATTGAATTGTATTGCATTGG
ATCATCAAATCATATCACATCAGATCTAATCTTATCTCATCTGATCCAATCCTATCCCATCCGATCGAATCGTATCGCATCGG
ATGATGAAATGATATGACATGAGATGTAATGTTATGTCATGTGATGCAATGCTATGCCATGCGATGGAATGGTATGGCATGGG
ACAACAAAACAATACAACACAAGACATAACATTACATCACATGACACAACACTACACCACACGACAGAACAGTACAGCACAGG
ACTACTAAACTATACTACACTAGACTTAACTTTACTTCACTTGACTCAACTCTACTCCACTCGACTGAACTGTACTGCACTGG
ACCACCAAACCATACCACACCAGACCTAACCTTACCTCACCTGACCCAACCCTACCCCACCCGACCGAACCGTACCGCACCGG
ACGACGAAACGATACGACACGAGACGTAACGTTACGTCACGTGACGCAACGCTACGCCACGCGACGGAACGGTACGGCACGGG
AGAAGAAAAGAATAGAACAGAAGAGATAAGATTAGATCAGATGAGACAAGACTAGACCAGACGAGAGAAGAGTAGAGCAGAGG
AGTAGTAAAGTATAGTACAGTAGAGTTAAGTTTAGTTCAGTTGAGTCAAGTCTAGTCCAGTCGAGTGAAGTGTAGTGCAGTGG
AGCAGCAAAGCATAGCACAGCAGAGCTAAGCTTAGCTCAGCTGAGCCAAGCCTAGCCCAGCCGAGCGAAGCGTAGCGCAGCGG
AGGAGGAAAGGATAGGACAGGAGAGGTAAGGTTAGGTCAGGTGAGGCAAGGCTAGGCCAGGCGAGGGAAGGGTAGGGCAGGGG
TAATAAAATAAATTAAACTAAAGTAATATAATTTAATCTAATGTAACATAACTTAACCTAACGTAAGATAAGTTAAGCTAAGG
TATTATAATATATTATACTATAGTATTATATTTTATTCTATTGTATCATATCTTATCCTATCGTATGATATGTTATGCTATGG
TACTACAATACATTACACTACAGTACTATACTTTACTCTACTGTACCATACCTTACCCTACCGTACGATACGTTACGCTACGG
TAGTAGAATAGATTAGACTAGAGTAGTATAGTTTAGTCTAGTGTAGCATAGCTTAGCCTAGCGTAGGATAGGTTAGGCTAGGG
TTATTAAATTAATTTAACTTAAGTTATATTATTTTATCTTATGTTACATTACTTTACCTTACGTTAGATTAGTTTAGCTTAGG
TTTTTTAATTTATTTTACTTTAGTTTTATTTTTTTTTCTTTTGTTTCATTTCTTTTCCTTTCGTTTGATTTGTTTTGCTTTGG
TTCTTCAATTCATTTCACTTCAGTTCTATTCTTTTCTCTTCTGTTCCATTCCTTTCCCTTCCGTTCGATTCGTTTCGCTTCGG
TTGTTGAATTGATTTGACTTGAGTTGTATTGTTTTGTCTTGTGTTGCATTGCTTTGCCTTGCGTTGGATTGGTTTGGCTTGGG
TCATCAAATCAATTCAACTCAAGTCATATCATTTCATCTCATGTCACATCACTTCACCTCACGTCAGATCAGTTCAGCTCAGG
TCTTCTAATCTATTCTACTCTAGTCTTATCTTTTCTTCTCTTGTCTCATCTCTTCTCCTCTCGTCTGATCTGTTCTGCTCTGG
TCCTCCAATCCATTCCACTCCAGTCCTATCCTTTCCTCTCCTGTCCCATCCCTTCCCCTCCCGTCCGATCCGTTCCGCTCCGG
TCGTCGAATCGATTCGACTCGAGTCGTATCGTTTCGTCTCGTGTCGCATCGCTTCGCCTCGCGTCGGATCGGTTCGGCTCGGG
TGATGAAATGAATTGAACTGAAGTGATATGATTTGATCTGATGTGACATGACTTGACCTGACGTGAGATGAGTTGAGCTGAGG
TGTTGTAATGTATTGTACTGTAGTGTTATGTTTTGTTCTGTTGTGTCATGTCTTGTCCTGTCGTGTGATGTGTTGTGCTGTGG
TGCTGCAATGCATTGCACTGCAGTGCTATGCTTTGCTCTGCTGTGCCATGCCTTGCCCTGCCGTGCGATGCGTTGCGCTGCGG
TGGTGGAATGGATTGGACTGGAGTGGTATGGTTTGGTCTGGTGTGGCATGGCTTGGCCTGGCGTGGGATGGGTTGGGCTGGGG
CAACAAAACAAATCAAACCAAAGCAATACAATTCAATCCAATGCAACACAACTCAACCCAACGCAAGACAAGTCAAGCCAAGG
CATCATAACATATCATACCATAGCATTACATTTCATTCCATTGCATCACATCTCATCCCATCGCATGACATGTCATGCCATGG
CACCACAACACATCACACCACAGCACTACACTTCACTCCACTGCACCACACCTCACCCCACCGCACGACACGTCACGCCACGG
CAGCAGAACAGATCAGACCAGAGCAGTACAGTTCAGTCCAGTGCAGCACAGCTCAGCCCAGCGCAGGACAGGTCAGGCCAGGG
CTACTAAACTAATCTAACCTAAGCTATACTATTCTATCCTATGCTACACTACTCTACCCTACGCTAGACTAGTCTAGCCTAGG
CTTCTTAACTTATCTTACCTTAGCTTTACTTTTCTTTCCTTTGCTTCACTTCTCTTCCCTTCGCTTGACTTGTCTTGCCTTGG
CTCCTCAACTCATCTCACCTCAGCTCTACTCTTCTCTCCTCTGCTCCACTCCTCTCCCCTCCGCTCGACTCGTCTCGCCTCGG
CTGCTGAACTGATCTGACCTGAGCTGTACTGTTCTGTCCTGTGCTGCACTGCTCTGCCCTGCGCTGGACTGGTCTGGCCTGGG
CCACCAAACCAATCCAACCCAAGCCATACCATTCCATCCCATGCCACACCACTCCACCCCACGCCAGACCAGTCCAGCCCAGG
CCTCCTAACCTATCCTACCCTAGCCTTACCTTTCCTTCCCTTGCCTCACCTCTCCTCCCCTCGCCTGACCTGTCCTGCCCTGG
CCCCCCAACCCATCCCACCCCAGCCCTACCCTTCCCTCCCCTGCCCCACCCCTCCCCCCCCCGCCCGACCCGTCCCGCCCCGG
CCGCCGAACCGATCCGACCCGAGCCGTACCGTTCCGTCCCGTGCCGCACCGCTCCGCCCCGCGCCGGACCGGTCCGGCCCGGG
CGACGAAACGAATCGAACCGAAGCGATACGATTCGATCCGATGCGACACGACTCGACCCGACGCGAGACGAGTCGAGCCGAGG
CGTCGTAACGTATCGTACCGTAGCGTTACGTTTCGTTCCGTTGCGTCACGTCTCGTCCCGTCGCGTGACGTGTCGTGCCGTGG
CGCCGCAACGCATCGCACCGCAGCGCTACGCTTCGCTCCGCTGCGCCACGCCTCGCCCCGCCGCGCGACGCGTCGCGCCGCGG
CGGCGGAACGGATCGGACCGGAGCGGTACGGTTCGGTCCGGTGCGGCACGGCTCGGCCCGGCGCGGGACGGGTCGGGCCGGGG
GAAGAAAAGAAATGAAACGAAAGGAATAGAATTGAATCGAATGGAACAGAACTGAACCGAACGGAAGAGAAGTGAAGCGAAGG
GATGATAAGATATGATACGATAGGATTAGATTTGATTCGATTGGATCAGATCTGATCCGATCGGATGAGATGTGATGCGATGG
GACGACAAGACATGACACGACAGGACTAGACTTGACTCGACTGGACCAGACCTGACCCGACCGGACGAGACGTGACGCGACGG
GAGGAGAAGAGATGAGACGAGAGGAGTAGAGTTGAGTCGAGTGGAGCAGAGCTGAGCCGAGCGGAGGAGAGGTGAGGCGAGGG
GTAGTAAAGTAATGTAACGTAAGGTATAGTATTGTATCGTATGGTACAGTACTGTACCGTACGGTAGAGTAGTGTAGCGTAGG
GTTGTTAAGTTATGTTACGTTAGGTTTAGTTTTGTTTCGTTTGGTTCAGTTCTGTTCCGTTCGGTTGAGTTGTGTTGCGTTGG
GTCGTCAAGTCATGTCACGTCAGGTCTAGTCTTGTCTCGTCTGGTCCAGTCCTGTCCCGTCCGGTCGAGTCGTGTCGCGTCGG
GTGGTGAAGTGATGTGACGTGAGGTGTAGTGTTGTGTCGTGTGGTGCAGTGCTGTGCCGTGCGGTGGAGTGGTGTGGCGTGGG
GCAGCAAAGCAATGCAACGCAAGGCATAGCATTGCATCGCATGGCACAGCACTGCACCGCACGGCAGAGCAGTGCAGCGCAGG
GCTGCTAAGCTATGCTACGCTAGGCTTAGCTTTGCTTCGCTTGGCTCAGCTCTGCTCCGCTCGGCTGAGCTGTGCTGCGCTGG
GCCGCCAAGCCATGCCACGCCAGGCCTAGCCTTGCCTCGCCTGGCCCAGCCCTGCCCCGCCCGGCCGAGCCGTGCCGCGCCGG
GCGGCGAAGCGATGCGACGCGAGGCGTAGCGTTGCGTCGCGTGGCGCAGCGCTGCGCCGCGCGGCGGAGCGGTGCGGCGCGGG
GGAGGAAAGGAATGGAACGGAAGGGATAGGATTGGATCGGATGGGACAGGACTGGACCGGACGGGAGAGGAGTGGAGCGGAGG
GGTGGTAAGGTATGGTACGGTAGGGTTAGGTTTGGTTCGGTTGGGTCAGGTCTGGTCCGGTCGGGTGAGGTGTGGTGCGGTGG
GGCGGCAAGGCATGGCACGGCAGGGCTAGGCTTGGCTCGGCTGGGCCAGGCCTGGCCCGGCCGGGCGAGGCGTGGCGCGGCGG
GGGGGGAAGGGATGGGACGGGAGGGGTAGGGTTGGGTCGGGTGGGGCAGGGCTGGGCCGGGCGGGGGAGGGGTGGGGCGGGGG
Sampling rate: 1 / 20
overrepresented sequencecount (% of bases)distribution: cycle 1 ~ cycle 150
AAAAAGCTCACTTGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTATTATTATTGAAACAATTAGCCTATTTATTCAACCAATG4 (0.000260%)
AAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGA14 (0.000909%)
AAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGG43 (0.002793%)
AAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGC22 (0.001429%)
AAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAAC5 (0.000325%)
AAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACG8 (0.000520%)
AAAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCAC33 (0.002144%)
AAAGAACGTGTCGGTCAAAGATGTTAGACGAGGCAATGTTGCTGGTGACAGCAAAAACGACCCACCAATGGAAGCAGCTGGCTTCACTGCTCAGGTGATT9 (0.000585%)
AAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCACGTGGTCACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGA3 (0.000195%)
AAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAA4 (0.000260%)
AAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGG3 (0.000195%)
AAAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGG33 (0.002144%)
AAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCA17 (0.001104%)
AAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCA28 (0.001819%)
AAATAGGCTAATTGTTTCAATAATAATAAGTATTGGAATTAGTGAAATTGGAGTTCCTTGTGGAAGGAAGTGGGCAAGTGAGCTTTTTAGTTTGTGTCGG106 (0.006886%)
AAATGATCCTATAGAAGAGACAGTGTTTCATGTGGTGTAAGCATCTGGGTAGTCTGAGTAGCGTCGTGGTATTCCTGAAAGGCCCAGGAAATGTTGAGGG164 (0.010654%)
AAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGC6 (0.000390%)
AACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTG5 (0.000325%)
AACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGCTCCTA9 (0.000585%)
AACAGGAAGAGAAAACTCAGTATCTTTTAGGCAGGCCAGCAGGTCGGAAGTGGTTGGGGTCTTTGCCACTCCGGCCCCACTCATTGGCAAACTGGTCAGC4 (0.000260%)
AACAGTGCTTGAACGGAACCCGGTGCTCGACCCCTCCGACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGT3 (0.000195%)
AACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACT4 (0.000260%)
AACGGAACAGACCCGGGGATTCCCACTGTACTCGCTTCCAGCCGCCTTTACAAGTCTCTCCAGTCGCAGCCTCCGGGACCATCTCCTCGCTGCCTTCAGC5 (0.000325%)
AACTTATAGAAAAGATGAAGGCAGCCTGACATGCATGCACTGCCTCAGTGACCAGTAAAGTCACGTGGCTTTGGGGAAGTCAGCTTAGCTCTCATCACCG13 (0.000845%)
AACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCGCGTCTCCCTCGCAAGTGCGCCAGAACTACCACCAG3 (0.000195%)
AACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCCTGC4 (0.000260%)
AAGAAACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACA12 (0.000780%)
AAGAACTTTGCCAAATACTTTCTCCACCAATCTCATGAGGAGAGGGAGCATGCCGAGAAACTGATGAAGCTGCAGAACCAGCGAGGTGGCCGAATCTTCC9 (0.000585%)
AAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCA3 (0.000195%)
AAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGTGGTAGTTCTGGCGCACTTGCGA3 (0.000195%)
AAGAGCGTCGTGTAGGGAAAGAGTGTGATGTGTCGTGTGT6 (0.000156%)
AAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCTACTGACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAAC5 (0.000325%)
AAGAGTGTGATGTGTCGTGTGTAGATCTCGGTGGTCGCCG23 (0.000598%)
AAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGATGTG3547 (0.092170%)
AAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAAAGAAGCTGGTCAAGGGTCTAGAGACA7 (0.000455%)
AAGGAGCTCGCAGCACGAGCAGGATGAAGCCTTCCATTGCCATCATTCTTTGCATCTTGATCCTGGGAGTTGACAGCCAAAGATGGGTCCAGTTCATGAA3 (0.000195%)
AAGGAGGTGAAACTCATCAAGAAGATGGGCAACCATCTGACCAACCTCCGCAGGGTGGCGGGGCCACAACCAGCGCAGACTGGCGCGCCCCAGGGGTCTC3 (0.000195%)
AAGTATTTGGCAAAGTTCTTCAGAGCCACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGC12 (0.000780%)
AAGTCAGCTTAGCTCTCATCACCGTGTCCCAGGGTGTGCTTGTCAAAGAGATATTCTGCCATGCCAGCTTCAGGGGCACCCATCTTGCGTAAGTTGGTCA3 (0.000195%)
AATATTTTCTGAATGATTTTCTTTATCACAGGAGCTTCTGGATCCAGACAGACCTCCTTCTGGTTTTTCAGTTTAGCTATGACTTCCACCGTAGGGCACT5 (0.000325%)
AATCCCTGGTCCAGGTGCATAGGCATGAGCCAAGACTGTTCCAGGCCCATCAAAAGGGACAAAGTCTCCATGTTCTCCAACTGCAAAGGAGATCATTATG3 (0.000195%)
AATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACGCAAGA3 (0.000195%)
AATGCACTCGCAGTGGAAAGAACGGCCAGTGTTCAATAGAAAGATTTCTGAGGACTCTGACCCCAGTGAAGATAAGAAGAAAGGGCTGATTCTCTCCACC3 (0.000195%)
AATGCATTGGTCGGTGGGGACAGAGAAGATGATGTTGTCGTCCTTGAGGCCCAGAGACTTGGCAAAGCGGGTGAAACGTTCCTTCAGTTCAGGGGACAGC4 (0.000260%)
AATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGTTCCAGTAGTGAC58 (0.003768%)
AATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCA3 (0.000195%)
ACAAGAATGATCCCCACTTATGTGACTTCATTGAGACGTATTATCTGAGTGAACAGGTGAAATCCATTAAAGAACTGGGTGACCACGTGACCAACTTACG3 (0.000195%)
ACACACACACACACACACACACACACACACACACACACAC230 (0.005977%)
ACACCTCCTCCAGCATATCCCGAGCTGGTGCTCCCTGGTCCGGGATCTTGTCCACAATGAGCCTCCAGCTCCGCAGCTCCGCCCGCATCCCCAGCGGTTC5 (0.000325%)
ACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGACACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAGCAGGAGCAGCAGCTCTTCTTGCAGGAG3 (0.000195%)
ACATCATCTCGGTCAAAATAACAAGACATAGACAGATAGACGTAGGAGGCATACAACTCCAGGTTGATCTGGCGGTTGATGGCAGCCTCCGCGTCCTGGT8 (0.000520%)
ACCAGACCGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCACTGCACTTGGAAAAGAGTGTGAATCAGTCACTACTGGAACTGCACAAACTG13 (0.000845%)
ACCAGATCTCGGAATGGACCCCAACTGCTCCTGCTCCACCGGCGGCTCCTGCACTTGCACCAGCTCCTGCGCCTGCAAGAACTGCAAGTGCACCTCCTGC3 (0.000195%)
ACCCAGTTCTTTAATGGATTTCACCTGTTCACTCAGATAATACGTCTCAATGAAGTCACATAAGTGGGGATCATTCTTGTCAGTAGCCAGTTTGTGCAGT3 (0.000195%)
ACCCCCGCCGGCCGCTTCGAGCCTGAGCCCTTTGCAACTTCGTCGTTCCGCCGCTCCAGCGTCGCCACCGCGCCTCGCCCCGCCGCCACCATGACCACCG3 (0.000195%)